We thank Christian Lehner for providing the CENP-C antibody and Eric Joyce for recommendations on FISH. Work in the McKim lab was funded by a grant from NIH (GM101955).

Nota: Le procedure sono eseguite a temperatura ambiente salvo diversamente indicato. incubatori a temperatura controllata sono utilizzati per mantenere temperature per volare allevamento e attraversa se non diversamente specificato. 1. preparati <ol><li> Preparare mosche. <ol><li> Prometafase arricchito collezioni ovocita. <ol><li> Cancella adulto vola da sani, giovani stock o trasversali culture. bottiglie di età per due giorni a 25 ° C. NOTA: Generalmente due bottiglie sani sarà sufficiente, anche se più può essere necessaria per alcune culture trasversali. </li><li> Dopo due giorni, raccogliere ~ 100 a 300 femmine (che vanno da 0 a 2 giorni di età, a questo punto) dalle bottiglie. Le femmine non hanno bisogno di essere vergini. Aggiungere una piccola quantità di pasta di lievito al lato di una fiala e inserire 30 femmine e 10 a 15 maschi ciascuno nelle fiale yeasted. fiale di età per due giorni a 25 ° C. </li></ol></li><li> Metafase-arricchito ovociti Collezioni. <ol><li> Raccogliere ~ 100 a 300 femmine a magazzino o cross cultures. Aggiungere una piccola quantità di pasta di lievito al lato di una fiala e posizionare 30 femmine ogni (senza maschi aggiunti) nelle fiale yeasted. fiale di età per tre-cinque giorni a 25 ° C. </li></ol></li></ol></li><li> Preparare soluzioni. Nota: Le soluzioni possono essere conservate indefinitamente a temperatura ambiente, se non diversamente indicato. <ol><li> Preparare Modified Buffer di Robb (5x): 500 mM HEPES, 500 mM di saccarosio, 275 mM acetato di sodio, acetato di potassio 200 mM, 50 mM di glucosio, 6 mM cloruro di magnesio, cloruro di calcio e 5 mM. Utilizzare 10 N 11: 8 idrossido di sodio: idrossido di potassio per portare il pH a 7,4. Sterilizzare per filtrazione; Non sterilizzare in autoclave. Conservare a -20 ° C. Scongelare come necessario per preparare ~ 200 ml di 1x Robb per ovocita prep. </li><li> Soluzioni fissazione. <ol><li> Opzione # 1: Preparare la formaldeide / fissazione eptano. Preparare Fixation Buffer: soluzione salina 1x tampone fosfato (PBS) più 150 mM saccarosio. Per utilizzare, rendere fresco con 687,5 ml Fixation Buffer e 312,5 ml 16% di formaldeideper ovocita prep. ATTENZIONE: Indossare guanti durante l&#39;utilizzo di soluzioni di formaldeide in una cappa aspirante. Smaltire i rifiuti secondo le linee guida istituzionali. </li><li> Opzione # 2: Preparare la formaldeide / fissazione cacodilato. Preparare Mix Fix: 250 mm saccarosio, 100 mM acetato di potassio (pH 7,5), 25 mM di sodio acetato (pH 7,0), e 25 mM EGTA (pH 8,0). Per utilizzare, fare fresco con 400 ml Fix Mix, 100 cacodilato ml di potassio (1 M, pH 7,2), e 500 microlitri di formaldeide al 16% per ovocita prep. ATTENZIONE: cacodilato potassio contiene arsenico. </li></ol></li><li> Preparare PBS / Triton X-100: 1x PBS + 1% o 0,05% Triton X-100. Conservare a 4 ° C. </li><li> Preparare PBS-Tween 20-Bovine Serum Albumin (BSA) (PTB): 1x PBS, 0,5% BSA (w / v), e 0,1% Tween-20. Può essere conservato a 4 ° C per una settimana. </li><li> Ibridazione in situ fluorescente (FISH) Solutions. <ol><li> Preparare 20X Sodio cloruro-sodio citrato (SSC): 3 M di cloruro di sodio e 0,3 M di sodio citrato. </li><li> Preparare 2x SSC-Tween-20 (SSCT): 2x SSC più 0,1% di Tween-20. Fare freschi, ~ 20 ml per ovocita prep. </li><li> Preparare soluzioni formammide: 2x SSC, 0,1% Tween-20, più formammide. Fare fresco, 1 ml 20% formammide, 0,5 ml 40% formammide, e 2 ml di 50% formammide per ovocita prep. ATTENZIONE: Indossare guanti durante l&#39;utilizzo di soluzioni formammide in una cappa aspirante. Smaltire i rifiuti secondo le linee guida istituzionali. </li><li> Preparare la soluzione di ibridazione: 2x SSC, 50% formammide, e il 10% di solfato di destrano (w / v). Conservare a 4 ° C. </li></ol></li><li> Sonde pesce. <ol><li> Ordine oligonucleotidi (vedi Tabella 1 per le sequenze) con la purificazione HPLC e desiderato 5 modifica &#39;fluorescente (per esempio, Cy3 o Cy5). Risospendere in Tris-EDTA (TE) a 50 ng / ml. NOTA: Proteggere oligonucleotidi da esposizione alla luce in ogni momento. </li></ol></li></ol></li></ol> 2. Raccolta di ritardo-fase di Drosophila ovociti <ol><li> Come <em&gt; ovociti Drosophila con membrane intatte si attacca alla plastica e vetro, pre-rivestire l&#39;interno di un tubo 5 ml e una pipetta Pasteur per ovocita preparazione con PTB. </li><li> Anestetizzare tutti ~ 100 a 300 mosche yeasted con anidride carbonica e aggiungere ad un frullatore contenente ~ 100 ml di 1x tampone di Robb. Pulse tre volte (~ 1 sec ciascuno). Mantenere gli ovociti in Robb di per &lt;20 min per evitare l&#39;attivazione. NOTA: In alternativa, gli ovociti possono essere sezionati a mano dalle femmine. Il vantaggio di questo metodo è che richiede meno femmine. Tuttavia, la cura deve essere presa per limitare l&#39;esposizione al biossido di carbonio a solo pochi minuti per evitare artefatti associata con ipossia 7. </li><li> Filtrare maglie larghe (~ 1.500 micron) in 250 ml bicchiere per rimuovere grandi parti del corpo. Se molti addomi intatte rimangono ancora sul materiale della maglia, ri-macinare con ulteriore buffer di Robb, e filtro. Lasciare riposare ~ 2 min, poi aspirare al largo strato superiore, eliminando come molti dei grandi parti del corpo il più possibile. </li><li> Filtro attraverso piccoli mesh (~ 300 micron) in un becher da 250 ml. Risciacquare rimanenti ovociti su primo bicchiere usando aggiuntivo di Robb e rivestito Pasteur pipetta. Lasciare riposare ~ 3 min; ovociti si depositerà fuori. Aspirare fuori tutti ma ~ 10 ml. </li><li> Versare la maggior quantità di 10 ml, come si inserisce nel tubo rivestito da 5 ml. Lasciare riposare, rimuovere il liquido, e ripetere con resto. Risciacquare ovociti rimanenti di coppa con ulteriore Pasteur pipetta di Robb e rivestito. Lasciate stabilirsi in 5 ml di tubo per ~ 3-5 minuti. </li></ol> 3. Trattamenti farmacologici (Opzionale) <ol><li> Coat un secondo tubo 5 ml con PTB per ogni preparazione ovocita. Aggiungere solvente appropriato (controllo) o farmaco per 1 ml di Robb ciascuno per ogni prep ovocita (Tabella 2). </li><li> ovociti diviso in seconda rivestito tubo 5 ml. Lasciare riposare, rimuovere il liquido e aggiungere 1 ml di Robb più solventi in un tubo e 1 ml di Robb più farmaco nel secondo tubo. Nutate un&#39;adeguata quantità di tempo per il trattamento farmacologico (Tabella 2). Let stabilirsi. </li></ol> 4. Fissazione <ol><li> Aspirare fuori tutto il liquido e subito aggiungere 1 ml Fix. </li><li> Opzione # 1: Formaldeide / eptano fissazione (fissazione Buffer più 5% di formaldeide). <ol><li> Fix per 2,5 minuti su un nutator. Aggiungere 1 ml di eptano e vortex 1 min. Lasciare riposare ~ 1 min. </li><li> Rimuovere tutto il liquido, e quindi aggiungere 1 ml di PBS 1x. Vortex 30 sec. Lasciare riposare ~ 1 min. </li><li> Rimuovere tutto il liquido, e quindi riempire il tubo con PBS 1x. NOTA: Gli oociti possono essere utilizzati immediatamente o conservare sul nutator per diverse ore a temperatura ambiente. </li></ol></li><li> Opzione # 2: la fissazione Formaldeide / cacodilato (Fix Mix più 8% di formaldeide e 100 mm cacodilato). <ol><li> Fix per 6 minuti su un nutator. Lasciare riposare 2 minuti. Rimuovere il liquido, e quindi riempire il tubo con PBS 1x. NOTA: Gli oociti possono essere utilizzati immediatamente o conservare sul nutator per diverse ore a temperatura ambiente. </li></ol></li></ol> 5. Rimozione Membrane ( &quot;Rolling&quot;) <ol><li> Utilizzando rivestito pipetta Pasteur, aggiungere ~ 500 a 1.000 ovociti alla parte (sabbiato) smerigliato di un vetrino. Rimuovere tutte le parti del corpo e dei materiali con pinze estranei. Non lasciate che gli ovociti asciugare; aggiungere 1x PBS come necessario. </li><li> Posizionare un vetrino in cima degli ovociti e delicatamente ovociti &quot;Roll&quot;, fino tutte le membrane vengono rimossi (trascinando il bordo del vetrino attraverso gli ovociti funziona meglio.) Controllare periodicamente i progressi sotto il microscopio, l&#39;aggiunta più 1x PBS, se necessario. Fare attenzione a come troppa pressione distruggerà gli ovociti. NOTA: Per immunofluorescenza solo continuare con il passo 6. Per il pesce (con o senza immunofluorescenza), passare al punto 7. </li></ol> 6. Anticorpo colorazione di Drosophila ovociti <ol><li> Estrazione e Blocco <ol><li> Risciacquare ovociti arrotolato in un tubo da 15 ml contenente ~ 15 ml di PBS / 1% Triton X-100. ovociti Nutate in questa soluzione per non meno di 1,5 ore e non più di 2 ore.Questo passaggio consente la penetrazione degli anticorpi. </li><li> Lasciate ovociti stabilirsi ~ 2 min. Rimuovere il liquido insieme con il maggior numero possibile di membrane, quindi aggiungere PBS / 0,05% Triton X-100. NOTA: Le membrane si depositerà più lento di ovociti laminati. </li><li> Lasciate ovociti depositano ~ 2 minuti, quindi rimuovere tutti tranne ~ 1 ml di liquido. ovociti Trasferire graduato da 1,5 ml di tubo e rimuovere il liquido restante. Aggiungere 1 ml PTB per il blocco e nutate per 1 ora. </li></ol></li><li> colorazione degli anticorpi <ol><li> Pre-assorbimento di anticorpi secondari contro embrioni. NOTA: Questo passaggio elimina la colorazione di fondo da non specifici anticorpi interazioni con le proteine di Drosophila. <ol><li> Raccogliere e risolvere embrioni di Drosophila (~ 25 microlitri) per procedura tipica 8. Conservare in metanolo a -20 ° C. </li><li> Rimuovere metanolo da embrioni, aggiungere 800 ml di metanolo più 200 ml 1x PBS, e nutate per 15 min. Togliere 500 ml di surnatante e sostituire con 500 microlitri PBS 1x. Poi nutate per 15 min. Ripetere due volte (per un totale di ~ 1 ora di lavaggi) e quindi completare in PTB. NOTA: Gli embrioni possono essere utilizzati immediatamente o mantenimento in nutator per diverse ore a temperatura ambiente. </li><li> Rimuovere liquido, riempire con PTB a 200 ml per ovocita di preparazione, e aggiungere anticorpi secondari fluorescenza marcata in opportune diluizioni (tenendo presente che il volume finale sarà di 300 ml;. Vedi punto 7.4) Nutate a 4 ° C per una notte (preferibile) oa temperatura ambiente per 3 a 4 ore. NOTA: Gli anticorpi pre-assorbito saranno utilizzati nel passaggio 6.2.4. NOTA: I campioni al buio per quanto possibile, una volta sono stati aggiunti anticorpi fluorescenti. </li></ol></li><li> Rimuovere il liquido da ovociti, riempire con PTB a 300 ml, e aggiungere anticorpi primari a diluizioni appropriate. Nutate a 4 ° C per una notte (preferibile) oa temperatura ambiente per 3 a 4 ore. </li><li> Lavare ovociti quattro volte per 15 minuti ciascuno con 1 ml PTB. </li><li> Rimuovereliquido da ovociti, aggiungere 200 ml di surnatante da embrioni (pre-assorbito anticorpi secondari). Poi riempire con PTB a 300 ml. Nutate a temperatura ambiente per 3 a 4 ore (preferibile) sia a 4 ° C durante la notte. </li><li> Lavare ovociti una volta per 15 minuti con 1 ml PTB, rimuovere il liquido. Quindi aggiungere 0,5 ml Hoechst 33342 e 500 microlitri PTB e nutate per 7 minuti. </li><li> Lavare ovociti due volte per 15 minuti ciascuno con 1 ml PTB. NOTA: ovociti possono essere montati su una slitta immediatamente o possono essere conservati in PTB a 4 ° C fino al momento imaging. </li></ol></li></ol> 7. FISH (continuare dal punto 5 di cui sopra) <ol><li> Risciacquare ovociti laminati in un tubo da 15 ml contenente 15 ml ~ 2x SSCT. Lasciate ovociti stabilirsi ~ 2 min. Rimuovere tutti ma ~ 0,5 ml di liquido lungo con il maggior numero possibile di membrane. NOTA: Le membrane si depositerà più lento di ovociti laminati. </li><li> Trasferimento ovociti a 0,5 ml di tubo e rimuovere il liquido restante. Successivamente aggiungere e rimuovere 500 microlitri20%, 40%, e 50% formammide soluzioni, oscillante per 10 min in ciascuna soluzione. NOTA: Gli oociti si depositerà più lento con percentuali più elevate di formammide. </li><li> Rimuovere il liquido, quindi aggiungere soluzione formammide 500 microlitri 50%, e nutate a 37 ° C per 1 a 5 ore. NOTA: più lunga incubazione si traducono in una migliore penetrazione della sonda. </li><li> Rimuovere il liquido, lasciando non più di ~ 100 microlitri oociti, e aggiungere la soluzione di ibridazione 36 microlitri più 2 ml di sonda (50 ng / ml) e 2 ml di acqua o 2 microlitri di una sonda 2 nd (Tabella 1). </li><li> Incubare a 91 ° C per 3 min (solo FISH) o 80 ° C per 20 min (FISH più immunofluorescenza), seguita da incubazione in un bagno d&#39;acqua a 37 ° C durante la notte. NOTA: Questi passaggi possono essere eseguite in un termociclatore. </li><li> Non rimuovere il liquido. Aggiungere 500 microlitri soluzione al 50% formammide e nutate a 37 ° C per 1 ora. </li><li> Lasciare riposare, rimuovere il liquido, aggiungere la soluzione formammide 500 microlitri 50%, und nutate a 37 ° C per 1 ora. </li><li> Lasciare riposare, rimuovere il liquido, aggiungere la soluzione formammide 500 microlitri 20%, e nutate a temperatura ambiente per 10 min. </li><li> Eseguire tre lavaggi rapidi in 500 microlitri 2x SSCT (lasciare riposare, eliminare e aggiungere liquido, capovolgere diverse volte, ripetere.) Lasciare riposare, rimuovere il liquido, quindi aggiungere 500 microlitri PTB e nutate per 4 ore. </li></ol> 8. colorazione degli anticorpi dopo la FISH <ol><li> Rimuovere il liquido da ovociti, riempire con PTB a 300 ml e aggiungere 10 ml di anticorpi anti-α-tubulina coniugato con FITC. In alternativa, altri anticorpi possono essere utilizzati, seguendo il protocollo sopra. Nutate a temperatura ambiente per una notte. </li><li> Lavare ovociti una volta per 15 minuti con 500 microlitri PTB, rimuovere il liquido, quindi aggiungere 0,5 ml Hoechst 33342 e 500 microlitri PTB e nutate per 7 minuti. </li><li> Lavare ovociti due volte per 15 minuti ciascuno con 500 microlitri PTB. NOTA: Gli oociti possono essere montati su una slitta immediatamente o possono essere conservati in PTB a 4 ° C fino al momentoimaging. Mantenere ovociti al buio per quanto possibile, una volta sono stati aggiunti anticorpi fluorescenti. </li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td fo:width="1in"> Ripetere Nome </td><td fo:width="1in"> Cromosoma </td><td> Oligo Sequenza * </td></tr><tr><td> 359 </td><td> X </td><td> GGGATCGTTAGCACTGGTAATTAGCTGC </td></tr><tr><td> AACAC </td><td> 2 </td><td> AACACAACACAACACAACACAACACAACACAACACAACAC </td></tr><tr><td> dodeca </td><td> 3 </td><td> CCCGTACTGGTCCCGTACTCGGTCCCGTACTCGGT </td></tr><tr><td> 1.686 </td><td> 2 + 3 </td><td> AATAACATAGAATAACATAGAATAACATAG </td></tr><tr><td> AATAT </td><td> 4 (+ Y) </td><td> AATATAATATAATATAATATAATATAATAT </td></tr><tr><td colspan="3"> * 359 sequenza di Eric Joyce, comunicazione personale, altre sequenze di Sullivan et al. 8 </td&gt; </tr></tbody></table> Tabella 1: sonde FISH per Drosophila ripete centromeriche. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Droga </td><td> Solvente </td><td> la concentrazione della </td><td> concentrazione finale </td><td> Tempo di trattamento </td><td> Effetto </td></tr><tr><td> colchicina </td><td> etanolo </td><td> 125 mm </td><td> 150 pM </td><td> 10 min o 30 min </td><td> destabilizzare non cinetocore (10 min) 9 o tutti i microtubuli (30 min) </td></tr><tr><td> paclitaxel </td><td> DMSO </td><td> 10 mM </td><td> 10 mM </td><td> 10 minuti </td><td> stabilizzare microtubules </td></tr><tr><td> Binucleine 2 </td><td> DMSO </td><td> 25 mM </td><td> 25 micron </td><td> 20 min </td><td> inibire Aurora B chinasi 10 </td></tr></tbody></table> Tabella 2: Trattamento farmacologico.

<ol>
	<li>Bridges, C. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-disjunction+as+proof+of+the+chromosome+theory+of+heredity.">Non-disjunction as proof of the chromosome theory of heredity.</a> Genetics. 1 (1), 1-52 (1916).</li><li>Hassold, T., Hunt, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=To+err+(meiotically)+is+human:+the+genesis+of+human+aneuploidy.">To err (meiotically) is human: the genesis of human aneuploidy.</a> Nat Rev Genet. 2 (4), 280-291 (2001).</li><li>Theurkauf, W. E., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Meiotic+spindle+assembly+in+Drosophila+females:+behavior+of+nonexchange+chromosomes+and+the+effects+of+mutations+in+the+nod+kinesin-like+protein.">Meiotic spindle assembly in Drosophila females: behavior of nonexchange chromosomes and the effects of mutations in the nod kinesin-like protein.</a> J Cell Biol. 116 (5), 1167-1180 (1992).</li><li>Zou, J., Hallen, M. A., Yankel, C. D., Endow, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microtubule-destabilizing+kinesin+motor+regulates+spindle+length+and+anchoring+in+oocytes.">A microtubule-destabilizing kinesin motor regulates spindle length and anchoring in oocytes.</a> J Cell Biol. 180 (3), 459-466 (2008).</li><li>Dernburg, A. F., Sedat, J. W., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+evidence+of+a+role+for+heterochromatin+in+meiotic+chromosome+segregation.">Direct evidence of a role for heterochromatin in meiotic chromosome segregation.</a> Cell. 86 (1), 135-146 (1996).</li><li>Gilliland, W. D., Hughes, S. F., Vietti, D. R., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Congression+of+achiasmate+chromosomes+to+the+metaphase+plate+in+Drosophila+melanogaster+oocytes.">Congression of achiasmate chromosomes to the metaphase plate in Drosophila melanogaster oocytes.</a> Dev Biol. 325 (1), 122-128 (2009).</li><li>Gilliland, W. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypoxia+transiently+sequesters+mps1+and+polo+to+collagenase-sensitive+filaments+in+Drosophila+prometaphase+oocytes.">Hypoxia transiently sequesters mps1 and polo to collagenase-sensitive filaments in Drosophila prometaphase oocytes.</a> PLoS One. 4 (10), e7544 (2009).</li><li>Sullivan, W., Ashburner, M., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Drosophila Protocols. , (2000).</li><li>Radford, S. J., Hoang, T. L., G&#322;uszek, A. A., Ohkura, H., McKim, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lateral+and+End-On+Kinetochore+Attachments+Are+Coordinated+to+Achieve+Bi-orientation+in+Drosophila+Oocytes.">Lateral and End-On Kinetochore Attachments Are Coordinated to Achieve Bi-orientation in Drosophila Oocytes.</a> PLoS Genet. 11 (10), e1005605 (2015).</li><li>Smurnyy, Y., Toms, A. V., Hickson, G. R., Eck, M. J., Eggert, U. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binucleine+2,+an+isoform-specific+inhibitor+of+Drosophila+Aurora+B+kinase,+provides+insights+into+the+mechanism+of+cytokinesis.">Binucleine 2, an isoform-specific inhibitor of Drosophila Aurora B kinase, provides insights into the mechanism of cytokinesis.</a> ACS Chem Biol. 5 (11), 1015-1020 (2010).</li><li>Mahowald, A. P., Goralski, T. J., Caulton, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+activation+of+Drosophila+eggs.">In vitro activation of Drosophila eggs.</a> Dev Biol. 98 (2), 437-445 (1983).</li><li>Page, A. W., Orr-Weaver, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+meiotic+divisions+in+Drosophila+oocytes.">Activation of the meiotic divisions in Drosophila oocytes.</a> Dev Biol. 183 (2), 195-207 (1997).</li><li>Tavosanis, G., Llamazares, S., Goulielmos, G., Gonzalez, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+role+for+gamma-tubulin+in+the+acentriolar+female+meiotic+spindle+of+Drosophila.">Essential role for gamma-tubulin in the acentriolar female meiotic spindle of Drosophila.</a> EMBO J. 16 (8), 1809-1819 (1997).</li><li>Endow, S. A., Komma, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spindle+dynamics+during+meiosis+in+Drosophila+oocytes.">Spindle dynamics during meiosis in Drosophila oocytes.</a> J Cell Biol. 137 (6), 1321-1336 (1997).</li><li>Matthies, H. J., Clarkson, M., Saint, R. B., Namba, R., Hawley, R. S., Sullivan, W., Ashburner, M., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Drosophila Protocols. , 67-85 (2000).</li><li>Colombi&#233;, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+roles+of+Incenp+crucial+to+the+assembly+of+the+acentrosomal+metaphase+spindle+in+female+meiosis.">Dual roles of Incenp crucial to the assembly of the acentrosomal metaphase spindle in female meiosis.</a> Development. 135 (19), 3239-3246 (2008).</li></ol>

The authors have nothing to disclose.

Messa in scena Drosophila ovociti Anche se un cariosoma allungata è spesso visto in ovociti prometafase, utilizzando cariosoma forma di distinguere prometafase da ovociti in metafase può essere problematico. Durante prometafase, il cariosoma inizia come una forma rotonda, si allunga, e poi si ritrae ad una forma rotonda come l&#39;ovocita si avvicina l&#39;arresto metafase. Ciò significa che molti ovociti prometafase non hanno un cariosoma allungata. Inoltre, se ...

The study of meiosis is sometimes described as the "genetics of genetics". This is because the fundamental properties of chromosome inheritance and independent assortment are carried out through the segregation of chromosomes during gamete production. An important demonstration of the chromosome theory of inheritance came in 1916 from the work of Calvin Bridges in Drosophila melanogaster1. This and other classical genetics studies in Drosophila contributed greatly to our understanding of genetics. Cytological examination of meiotic chromosomes in Drosophila oocytes, however, has been challenging. This is primarily because immunofluorescence of late-stage Drosophila oocytes, when the spindle assembles and chromosomes are oriented for segregation, is hampered by the presence of membranes that render the oocyte impenetrable to antibodies.
Despite this challenge, Drosophila oocytes remain an attractive model for the study of chromosome behavior and spindle assembly. This is because of the powerful genetic tools available in Drosophila, but also because the oocytes arrest at metaphase I, when the chromosomes are oriented and the spindle is fully formed. This facilitates the collection and examination of large numbers of oocytes at this important stage of cell division. In addition, a simple model organism that is amenable to genetic manipulation for the study of oocyte chromosome segregation can provide an important contribution to our understanding of human reproductive health. Errors in chromosome number are the leading genetic cause of miscarriage and birth defects in humans2. A majority of these errors can be traced to the oocyte and are correlated with increasing maternal age. The average age of mothers in the U.S. has been increasing, making this a major public health concern.
We describe here methods for the cytological examination of Drosophila oocytes, including a demonstration of how to remove the oocyte membranes. These methods are modifications of protocols first described by Theurkauf and Hawley3, Zou et al.4, and Dernburg et al.5. We also include methods for the enrichment of different stages of oocytes, based on a protocol first described by Gilliland et al.6. Finally, we add instructions for the drug treatment of Drosophila oocytes. Together, these methods allow the cytological investigation of oocyte chromosome segregation and spindle assembly in Drosophila.

<table><tbody><tr><td>15 ml conical tubes</td><td>Various</td><td></td><td></td></tr><tr><td>16% formaldehyde</td><td>Ted Pella, Inc.</td><td>18505</td><td>HAZARDOUS; once opened, discard after one month</td></tr><tr><td>250 ml beakers</td><td>Various</td><td></td><td></td></tr><tr><td>5 ml tubes</td><td>Various</td><td></td><td></td></tr><tr><td>active dry yeast</td><td>Various</td><td></td><td>mix with water to make a paste the consistency of peanut butter</td></tr><tr><td>anti-&amp;alpha;-tubulin antibody conjugated to FITC</td><td>Sigma</td><td>F2168</td><td>clone DM1A</td></tr><tr><td>Binucleine 2</td><td>Sigma</td><td>B1186</td><td>HAZARDOUS</td></tr><tr><td>blender</td><td>Various</td><td></td><td></td></tr><tr><td>bovine serum albumin</td><td>Sigma</td><td>A4161</td><td></td></tr><tr><td>calcium chloride</td><td>Various</td><td></td><td></td></tr><tr><td>colchicine</td><td>Sigma</td><td>C-9754</td><td>HAZARDOUS</td></tr><tr><td>coverslips</td><td>VWR</td><td>48366-227</td><td>No. 1 1/2</td></tr><tr><td>dextran sulfate</td><td>Various</td><td></td><td></td></tr><tr><td>DMSO</td><td>Various</td><td></td><td></td></tr><tr><td>EGTA</td><td>Various</td><td></td><td></td></tr><tr><td>ethanol</td><td>Various</td><td></td><td></td></tr><tr><td>forceps</td><td>Ted Pella, Inc.</td><td>5622</td><td>Dumont tweezers high precision grade style 5</td></tr><tr><td>formamide</td><td>Sigma</td><td>47670-250ML-F</td><td></td></tr><tr><td>glass slides</td><td>VWR</td><td>48312-003</td><td></td></tr><tr><td>glucose</td><td>Various</td><td></td><td></td></tr><tr><td>graduated 1.5 ml tubes</td><td>Various</td><td></td><td></td></tr><tr><td>HEPES</td><td>VWR</td><td>EM-5330</td><td>available from several venders</td></tr><tr><td>Hoechst 33342</td><td>Various</td><td></td><td></td></tr><tr><td>magnesium chloride</td><td>Various</td><td></td><td></td></tr><tr><td>methanol</td><td>Various</td><td></td><td></td></tr><tr><td>large mesh (~1,500 &amp;micro;m)</td><td>VWR</td><td>AA43657-NK</td><td>variety of formats and other suppliers, 12 or 14 mesh</td></tr><tr><td>small mesh (~300 &amp;micro;m)</td><td>Spectrum labs</td><td>146 424</td><td>variety of formats, &lt;em&gt;e.g.&lt;/em&gt;, 146 422 or 146 486</td></tr><tr><td>nutator</td><td>Various</td><td></td><td></td></tr><tr><td>Pasteur pipets</td><td>Various</td><td></td><td></td></tr><tr><td>potassium acetate</td><td>Various</td><td></td><td></td></tr><tr><td>Cacodylic acid</td><td>Sigma</td><td>C0125</td><td>HAZARDOUS; alternatively, sodium cacodylate may be substituted</td></tr><tr><td>potassium hydroxide</td><td>Various</td><td></td><td></td></tr><tr><td>sodium acetate</td><td>Various</td><td></td><td></td></tr><tr><td>sodium chloride</td><td>Various</td><td></td><td></td></tr><tr><td>sodium citrate</td><td>Various</td><td></td><td></td></tr><tr><td>sodium hydroxide</td><td>Various</td><td></td><td></td></tr><tr><td>sucrose</td><td>Various</td><td></td><td></td></tr><tr><td>taxol (paclitaxel)</td><td>Sigma</td><td>T1912</td><td>HAZARDOUS</td></tr><tr><td>Triton X-100</td><td>Fisher</td><td>PI-28314</td><td></td></tr><tr><td>Tween 20</td><td>Fisher</td><td>PI-28320</td><td></td></tr><tr><td>vortex</td><td>Various</td><td></td><td></td></tr></tbody></table>

techniques for imaging prometaphase and metaphase of meiosis i in fixed drosophila oocytes

Chromosome segregation in human oocytes is error prone, resulting in aneuploidy, which is the leading genetic cause of miscarriage and birth defects. The study of chromosome behavior in oocytes from model organisms holds much promise to uncover the molecular basis of the susceptibility of human oocytes to aneuploidy. Drosophila melanogaster is amenable to genetic manipulation, with over 100 years of research, community, and technique development. Visualizing chromosome behavior and spindle assembly in Drosophila oocytes has particular challenges, however, due primarily to the presence of membranes surrounding the oocyte that are impenetrable to antibodies. We describe here protocols for the collection, preparation, and imaging of meiosis I spindle assembly and chromosome behavior in Drosophila oocytes, which allow the molecular dissection of chromosome segregation in this important model organism.

I metodi che abbiamo descritto qui comporterà la raccolta di fase tardo-ovociti Drosophila che rappresentano tre fasi della meiosi (Figura 1). Gli ovociti in profase si distinguono per la presenza della membrana nucleare, che è visibile dalla mancanza di segnale di tubulina nella regione circostante il cariosoma (Figura 1A). Prometafase è il periodo dopo la rottura membrana nucleare durante il quale le assembla mandrino. Durante prometafase, ...

Watch this Scientific Journal Video about Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes at JoVE.com

Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

We present protocols for the collection, preparation, and imaging of mature Drosophila oocytes. These methods allow the visualization of chromosome behavior and spindle assembly and function during meiosis.

Tecniche di Imaging Prometafase e metafase della meiosi I nel fisso<em&gt; Drosophila</em&gt; ovociti

Chromosome segregation in human oocytes is error prone, resulting in aneuploidy, which is the leading genetic cause of miscarriage and birth defects. The ...

techniques-for-imaging-prometaphase-metaphase-meiosis-i-fixed

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

Unit 2

Meiosis

SCIENTISTS IN ACTION

9.0K Views.  Rutgers University. We present protocols for the collection, preparation, and imaging of mature Drosophila oocytes. These methods allow the visualization of chromosome behavior and spindle assembly and function during meiosis.

Video: Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

Using Mouse Oocytes to Assess Human Gene Function During Meiosis I

Embryonic aneuploidy is the major genetic cause of infertility in humans. Most of these events originate during female meiosis, and albeit positively correlated with maternal age, age alone is not always predictive of the risk of generating an aneuploid embryo. Therefore, gene variants might account for incorrect chromosome segregation during oogenesis. Given that access to human oocytes is limited for research purposes, a series of assays were developed to study human gene function during meiosis I using mouse oocytes. First, messenger RNA (mRNA) of the gene and gene variant of interest are microinjected into prophase I-arrested mouse oocytes. After allowing time for expression, oocytes are synchronously released into meiotic maturation to complete meiosis I. By tagging the mRNA with a sequence of a fluorescent reporter, such as green fluorescent protein (Gfp), the localization of the human protein can be assessed in addition to the phenotypic alterations. For example, gain or loss of function can be investigated by establishing experimental conditions that challenge the gene product to fix meiotic errors. Although this system is advantageous in investigating human protein function during oogenesis, adequate interpretation of results should be undertaken given that protein expression is not at endogenous levels and, unless controlled for (i.e. knocked out or down), murine homologs are also present in the system.

As the genetic variants associated with human disease begin to become uncovered, it is becoming increasingly important to develop systems with which to rapidly evaluate the biological significance of those identified variants. This protocol describes methods for evaluating human gene function during female meiosis I using mouse oocytes.

Usando i Oocytes del Mouse per valutare la funzione del Gene umano durante la meiosi I

Embryonic aneuploidy is the major genetic cause of infertility in humans. Most of these events originate during female meiosis, and albeit positively ...

Ricerca

Genetica

Using Fluorescence In Situ Hybridization (FISH) to Monitor the State of Arm Cohesion in Prometaphase and Metaphase I Drosophila Oocytes

In humans, chromosome segregation errors in oocytes are responsible for the majority of miscarriages and birth defects. Moreover, as women age, their risk of conceiving an aneuploid fetus increases dramatically and this phenomenon is known as the maternal age effect. One requirement for accurate chromosome segregation during the meiotic divisions is maintenance of sister chromatid cohesion during the extended prophase period that oocytes experience. Cytological evidence in both humans and model organisms suggests that meiotic cohesion deteriorates during the aging process. In addition, segregation errors in human oocytes are most prevalent during meiosis I, consistent with premature loss of arm cohesion. The use of model organisms is critical for unraveling the mechanisms that underlie age-dependent loss of cohesion. Drosophila melanogaster offers several advantages for studying the regulation of meiotic cohesion in oocytes. However, until recently, only genetic tests were available to assay for loss of arm cohesion in oocytes of different genotypes or under different experimental conditions. Here, a detailed protocol is provided for using fluorescence in situ hybridization (FISH) to directly visualize defects in arm cohesion in prometaphase I and metaphase I arrested Drosophila oocytes. By generating a FISH probe that hybridizes to the distal arm of the X chromosome and collecting confocal Z stacks, a researcher can visualize the number of individual FISH signals in three dimensions and determine whether sister chromatid arms are separated. The procedure outlined makes it possible to quantify arm cohesion defects in hundreds of Drosophila oocytes. As such, this method provides an important tool for investigating the mechanisms that contribute to cohesion maintenance as well as the factors that lead to its demise during the aging process.

Using Fluorescence In Situ Hybridization FISH to Monitor the State of Arm Cohesion in Prometaphase and Metaphase I Drosophila Oocytes

This manuscript presents a detailed method for generating X-chromosome arm probes and performing fluorescence in situ hybridization (FISH) to examine the state of sister chromatid cohesion in prometaphase and metaphase I arrested Drosophila oocytes. This protocol is suitable for determining whether meiotic arm cohesion is intact or disrupted in different genotypes.

Mediante ibridazione In Situ di fluorescenza (pesce) per monitorare lo stato di coesione braccio in prometafase e metafase I Oocytes di Drosophila

In humans, chromosome segregation errors in oocytes are responsible for the majority of miscarriages and birth defects. Moreover, as women age, their risk ...

Biologia dello sviluppo

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of the Drosophila melanogaster syncytial embryo for studying mitosis1. Drosophila has useful genetics with a sequenced genome, and it can be easily maintained and manipulated. Many mitotic mutants exist, and transgenic flies expressing functional fluorescently (e.g. GFP) - tagged mitotic proteins have been and are being generated. Targeted gene expression is possible using the GAL4/UAS system2. 

The Drosophila early embryo carries out multiple mitoses very rapidly (cell cycle duration, &asymp;10 min). It is well suited for imaging mitosis, because during cycles 10-13, nuclei divide rapidly and synchronously without intervening cytokinesis at the surface of the embryo in a single monolayer just underneath the cortex. These rapidly dividing nuclei probably use the same mitotic machinery as other cells, but they are optimized for speed; the checkpoint is generally believed to not be stringent, allowing the study of mitotic proteins whose absence would cause cell cycle arrest in cells with a strong checkpoint. Embryos expressing GFP labeled proteins or microinjected with fluorescently labeled proteins can be easily imaged to follow live dynamics (Fig. 1). In addition, embryos can be microinjected with function-blocking antibodies or inhibitors of specific proteins to study the effect of the loss or perturbation of their function3. These reagents can diffuse throughout the embryo, reaching many spindles to produce a gradient of concentration of inhibitor, which in turn results in a gradient of defects comparable to an allelic series of mutants. Ideally, if the target protein is fluorescently labeled, the gradient of inhibition can be directly visualized4. It is assumed that the strongest phenotype is comparable to the null phenotype, although it is hard to formally exclude the possibility that the antibodies may have dominant effects in rare instances, so rigorous controls and cautious interpretation must be applied. Further away from the injection site, protein function is only partially lost allowing other functions of the target protein to become evident.

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of microinjection and high resolution imaging in the Drosophila melanogaster syncytial embryo to study mitosis.

Tecniche di microiniezione per Studiare Mitosi in Drosophila melanogaster Embryo sinciziale

This protocol describes the use of the Drosophila melanogaster syncytial embryo  for studying mitosis1.  Drosophila has useful genetics with a sequenced ...

Biologia

Nuclear Migration in the Drosophila Oocyte

Live cell imaging is particularly necessary to understand the cellular and molecular mechanisms that regulate organelle movements, cytoskeleton rearrangements, or polarity patterning within the cells. When studying oocyte nucleus positioning, live-imaging techniques are essential to capture the dynamic events of this process. The Drosophila egg chamber is a multicellular structure and an excellent model system to study this phenomenon because of its large size and availability of numerous genetic tools. During Drosophila mid-oogenesis, the nucleus migrates from a central position within the oocyte to adopt an asymmetric position mediated by microtubule-generated forces. This migration and positioning of the nucleus are necessary to determine the polarity axes of the embryo and the subsequent adult fly. One characteristic of this migration is that it occurs in three dimensions (3D), creating a necessity for live imaging. Thus, to study the mechanisms that regulate nuclear migration, we have developed a protocol to culture the dissected egg chambers and perform live imaging for 12 h by time-lapse acquisitions using spinning-disk confocal microscopy. Overall, our conditions allow us to preserve Drosophila egg chambers alive for a long period of time, thereby enabling the completion of nuclear migration to be visualized in a large number of samples in 3D.

Nuclear Migration in the Drosophila Oocyte

In Drosophila, the oocyte nucleus undergoes microtubule-dependent migration during oogenesis. Here, we describe a protocol that was developed to follow the migration by performing live imaging on egg chambers ex-vivo. Our procedure maintains egg chambers alive for 12 h to acquire multi-position 3D time-lapse movies using spinning-disk confocal microscopy.

Migrazione nucleare nell'ovocita di Drosophila

Live cell imaging is particularly necessary to understand the cellular and molecular mechanisms that regulate organelle movements, cytoskeleton ...

Confocal and Super-Resolution Imaging of Polarized Intracellular Trafficking and Secretion of Basement Membrane Proteins During Drosophila Oogenesis

The basement membrane (BM) - a specialized sheet of extracellular matrix present at the basal side of epithelial cells - is critical for the establishment and maintenance of epithelial tissue morphology and organ morphogenesis. Moreover, the BM is essential for tissue modeling, serving as a signaling platform, and providing external forces to shape tissues and organs. Despite the many important roles that the BM plays during normal development and pathological conditions, the biological pathways controlling the intracellular trafficking of BM-containing vesicles and how basal secretion leads to the polarized deposition of BM proteins are poorly understood. The follicular epithelium of the Drosophila ovary is an excellent model system to study the basal deposition of BM membrane proteins, as it produces and secretes all major components of the BM. Confocal and super-resolution imaging combined with image processing in fixed tissues allows for the identification and characterization of cellular factors specifically involved in the intracellular trafficking and deposition of BM proteins. This article presents a detailed protocol for staining and imaging BM-containing vesicles and deposited BM using endogenously tagged proteins in the follicular epithelium of the Drosophila ovary. This protocol can be applied to address both qualitative and quantitative questions and it was developed to accommodate high-throughput screening, allowing for the rapid and efficient identification of factors involved in the polarized intracellular trafficking and secretion of vesicles during epithelial tissue development.

Confocal and Super-Resolution Imaging of Polarized Intracellular Trafficking and Secretion of Basement Membrane Proteins During Drosophila Oogenesis

The basement membrane is essential for tissue and organ morphogenesis during development. To better understand the mechanisms leading to proper placement of this structure, the protocol presented describes methods to visualize and characterize the intracellular trafficking and secretion of basement membrane proteins in epithelial cells using confocal and super-resolution microscopy.

Imaging confocale e a super-risoluzione del traffico intracellulare polarizzato e della secrezione di proteine della membrana basale durante l'oogenesi della drosophila

The basement membrane (BM) - a specialized sheet of extracellular matrix present at the basal side of epithelial cells - is critical for the establishment ...

Mouse Oocyte Microinjection, Maturation and Ploidy Assessment

Mistakes in chromosome segregation lead to aneuploid cells. In somatic cells, aneuploidy is associated with cancer but in gametes, aneuploidy leads to infertility, miscarriages or developmental disorders like Down syndrome. Haploid gametes form through species-specific developmental programs that are coupled to meiosis. The first meiotic division (MI) is unique to meiosis because sister chromatids remain attached while homologous chromosomes are segregated. For reasons not fully understood, this reductional division is prone to errors and is more commonly the source of aneuploidy than errors in meiosis II (MII) or than errors in male meiosis 1,2. 
In mammals, oocytes arrest at prophase of MI with a large, intact germinal vesicle (GV; nucleus) and only resume meiosis when they receive ovulatory cues. Once meiosis resumes, oocytes complete MI and undergo an asymmetric cell division, arresting again at metaphase of MII. Eggs will not complete MII until they are fertilized by sperm. Oocytes also can undergo meiotic maturation using established in vitro culture conditions 3. Because generation of transgenic and gene-targeted mouse mutants is costly and can take long periods of time, manipulation of female gametes in vitro is a more economical and time-saving strategy. 
Here, we describe methods to isolate prophase-arrested oocytes from mice and for microinjection. Any material of choice may be introduced into the oocyte, but because meiotically-competent oocytes are transcriptionally silent 4,5 cRNA, and not DNA, must be injected for ectopic expression studies. To assess ploidy, we describe our conditions for in vitro maturation of oocytes to MII eggs. Historically, chromosome-spreading techniques are used for counting chromosome number 6. This method is technically challenging and is limited to only identifying hyperploidies. Here, we describe a method to determine hypo-and hyperploidies using intact eggs 7-8. This method uses monastrol, a kinesin-5 inhibitor, that collapses the bipolar spindle into a monopolar spindle 9 thus separating chromosomes such that individual kinetochores can readily be detected and counted by using an anti-CREST autoimmune serum. Because this method is performed in intact eggs, chromosomes are not lost due to operator error.

Oocytes are prone to aneuploidy due to errors in chromosome segregation during meiotic maturation. Aneuploid eggs can cause infertility, miscarriages or developmental disorders like Down syndrome. Here, we describe methods to introduce materials of choice into oocytes and methods to study meiotic maturation and assess ploidy.

Microiniezione degli ovociti mouse, Maturazione e Ploidia valutazione

Mistakes in chromosome segregation lead to aneuploid cells.  In somatic cells, aneuploidy is associated with cancer but in gametes, aneuploidy leads to ...

Studying Mitotic Checkpoint by Illustrating Dynamic Kinetochore Protein Behavior and Chromosome Motion in Living Drosophila Syncytial Embryos

The spindle assembly checkpoint (SAC) mechanism is an active signal, which monitors the interaction between chromosome kinetochores and spindle microtubules to prevent anaphase onset until the chromosomes are properly connected. Cells use this mechanism to prevent aneuploidy or genomic instability, and hence cancers and other human diseases like birth defects and Alzheimer's1. A number of the SAC components such as Mad1, Mad2, Bub1, BubR1, Bub3, Mps1, Zw10, Rod and Aurora B kinase have been identified and they are all kinetochore dynamic proteins2. Evidence suggests that the kinetochore is where the SAC signal is initiated. The SAC prime regulatory target is Cdc20. Cdc20 is one of the essential APC/C (Anaphase Promoting Complex or Cyclosome) activators3 and is also a kinetochore dynamic protein4-6. When activated, the SAC inhibits the activity of the APC/C to prevent the destruction of two key substrates, cyclin B and securin, thereby preventing the metaphase to anaphase transition7,8. Exactly how the SAC signal is initiated and assembled on the kinetochores and relayed onto the APC/C to inhibit its function still remains elusive.
Drosophila is an extremely tractable experimental system; a much simpler and better-understood organism compared to the human but one that shares fundamental processes in common. It is, perhaps, one of the best organisms to use for bio-imaging studies in living cells, especially for visualization of the mitotic events in space and time, as the early embryo goes through 13 rapid nuclear division cycles synchronously (8-10 minutes for each cycle at 25 &deg;C) and gradually organizes the nuclei in a single monolayer just underneath the cortex9.
Here, I present a bio-imaging method using transgenic Drosophila expressing GFP (Green Fluorescent Protein) or its variant-targeted proteins of interest and a Leica TCS SP2 confocal laser scanning microscope system to study the SAC function in flies, by showing images of GFP fusion proteins of some of the SAC components, Cdc20 and Mad2, as the example.

Studying Mitotic Checkpoint by Illustrating Dynamic Kinetochore Protein Behavior and Chromosome Motion in Living Drosophila Syncytial Embryos

The kinetochore is where the SAC initiates its signal monitoring the mitotic segregation of the sister chromatids. A method is described to visualize the recruitment and turnover of one of the kinetochore proteins and its coordination with the chromosome motion in Drosophila embryos using a Leica laser scanning confocal system.

Studiare Checkpoint mitotica illustrando un comportamento dinamico delle proteine ​​cinetocoro e Motion cromosoma in Living<em&gt; Drosophila</em&gt; Embrioni sinciziale

The spindle assembly checkpoint (SAC) mechanism is an active signal, which monitors the interaction between chromosome kinetochores and spindle ...

Live Imaging of GFP-labeled Proteins in Drosophila Oocytes

The Drosophila oocyte has been established as a versatile system for investigating fundamental questions such as cytoskeletal function, cell organization, and organelle structure and function. The availability of various GFP-tagged proteins means that many cellular processes can be monitored in living cells over the course of minutes or hours, and using this technique, processes such as RNP transport, epithelial morphogenesis, and tissue remodeling have been described in great detail in Drosophila oocytes1,2.
The ability to perform video imaging combined with a rich repertoire of mutants allows an enormous variety of genes and processes to be examined in incredible detail. One such example is the process of ooplasmic streaming, which initiates at mid-oogenesis3,4. This vigorous movement of cytoplasmic vesicles is microtubule and kinesin-dependent5 and provides a useful system for investigating cytoskeleton function at these stages.
Here I present a protocol for time lapse imaging of living oocytes using virtually any confocal microscopy setup.

Live Imaging of GFP-labeled Proteins in Drosophila Oocytes

A protocol for live imaging of GFP-tagged proteins or autofluorescent structures in individual Drosophila oocytes is described.

Vivo Imaging delle proteine ​​GFP-etichettati in<em&gt; Drosophila</em&gt; Gli oociti

The  Drosophila oocyte has been established as a versatile system for investigating  fundamental questions such as cytoskeletal function, cell ...

Cytological Analysis of Spermatogenesis: Live and Fixed Preparations of Drosophila Testes

Drosophila melanogaster is a powerful model system that has been widely used to elucidate a variety of biological processes. For example, studies of both the female and male germ lines of Drosophila have contributed greatly to the current understanding of meiosis as well as stem cell biology. Excellent protocols are available in the literature for the isolation and imaging of Drosophila ovaries&#160;and testes3-12. Herein, methods for the dissection and preparation of Drosophila testes for microscopic analysis are described with an accompanying video demonstration. A protocol for isolating testes from the abdomen of adult males and preparing slides of live tissue for analysis by phase-contrast microscopy as well as a protocol for fixing and immunostaining testes for analysis by fluorescence microscopy are presented. These techniques can be applied in the characterization of Drosophila mutants that exhibit defects in spermatogenesis as well as in the visualization of subcellular localizations of proteins.

Cytological Analysis of Spermatogenesis: Live and Fixed Preparations of Drosophila Testes

Methods for isolating and preparing Drosophila testes samples (live and fixed) for imaging by phase-contrast and fluorescence microscopy are described herein.&#160;

L&#39;analisi citologica della spermatogenesi: Preparati Live e fisse di<em&gt; Drosophila</em&gt; Testicoli

Drosophila melanogaster is a powerful model system that has been widely used to elucidate a variety of biological processes. For example, studies of both ...

Preparation of Fixed Drosophila Oocytes for Immunostaining: A High-Throughput Method to Fix and Remove the Outer Membrane

Source: Radford, S. J., McKim, K. S. <a href="https://www.jove.com/video/54666/" target="_blank">Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes</a>. J. Vis. Exp. (2016).
Immunostaining of Drosophila late-stage oocytes can prove challenging due to the oocytes&#39; surrounding membranes. This video describes a high-throughput method for obtaining oocytes, their fixation, and membranes&#39; removal for immunostaining. The featured protocol demonstrates these techniques with late-stage oocytes used to visualize different stages of meiosis.

Preparazione di ovociti di Drosophila fissati per l'immunocolorazione: un metodo ad alto rendimento per fissare e rimuovere la membrana esterna

Source: Radford, S. J., McKim, K. S. Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes. J. Vis. Exp. (2016).
...

Tecniche di Imaging Prometafase e metafase della meiosi I nel fisso

Riepilogo

Esplora Altri Video

Capitoli in questo video

Usando i Oocytes del Mouse per valutare la funzione del Gene umano durante la meiosi I

Mediante ibridazione In Situ di fluorescenza (pesce) per monitorare lo stato di coesione braccio in prometafase e metafase I Oocytes di Drosophila

Tecniche di microiniezione per Studiare Mitosi in Drosophila melanogaster Embryo sinciziale

Migrazione nucleare nell'ovocita di Drosophila

Imaging confocale e a super-risoluzione del traffico intracellulare polarizzato e della secrezione di proteine della membrana basale durante l'oogenesi della drosophila

Microiniezione degli ovociti mouse, Maturazione e Ploidia valutazione

Studiare Checkpoint mitotica illustrando un comportamento dinamico delle proteine cinetocoro e Motion cromosoma in Living

Vivo Imaging delle proteine GFP-etichettati in

L'analisi citologica della spermatogenesi: Preparati Live e fisse di

Preparazione di ovociti di Drosophila fissati per l'immunocolorazione: un metodo ad alto rendimento per fissare e rimuovere la membrana esterna

Tecniche di Imaging Prometafase e metafase della meiosi I nel fisso

Riepilogo

Esplora Altri Video

Capitoli in questo video

Usando i Oocytes del Mouse per valutare la funzione del Gene umano durante la meiosi I

Mediante ibridazione In Situ di fluorescenza (pesce) per monitorare lo stato di coesione braccio in prometafase e metafase I Oocytes di Drosophila

Tecniche di microiniezione per Studiare Mitosi in Drosophila melanogaster Embryo sinciziale

Migrazione nucleare nell'ovocita di Drosophila

Imaging confocale e a super-risoluzione del traffico intracellulare polarizzato e della secrezione di proteine della membrana basale durante l'oogenesi della drosophila

Microiniezione degli ovociti mouse, Maturazione e Ploidia valutazione

Studiare Checkpoint mitotica illustrando un comportamento dinamico delle proteine ​​cinetocoro e Motion cromosoma in Living

Vivo Imaging delle proteine ​​GFP-etichettati in

L'analisi citologica della spermatogenesi: Preparati Live e fisse di

Preparazione di ovociti di Drosophila fissati per l'immunocolorazione: un metodo ad alto rendimento per fissare e rimuovere la membrana esterna

Studiare Checkpoint mitotica illustrando un comportamento dinamico delle proteine cinetocoro e Motion cromosoma in Living

Vivo Imaging delle proteine GFP-etichettati in