Un grand merci à Silke Kipper, Sarah Kiefer, Michael Weiß, Conny Bartsch et Silke Voigt-Heucke pour la collecte de l&#39;échantillon enthousiaste dans le domaine, à Janett Birkenfeld d&#39;une assistance continue, à Ulla Kobalz pour les beaux gels et Tobias Krause pour un soutien moral.

Toutes les procédures ont été effectuées en conformité avec la loi allemande pour la protection des animaux (TierSchG). 1. Préparation des réactifs et consommables <ol><li> Préparer une 5% (p / p) de Chelex-100 solution dans l&#39;eau de qualité moléculaire. Préparer des aliquotes de 200 pl dans des tubes de réaction de 1,5 ml standard. Comme la résine Chelex précipite rapidement à partir de la suspension, il est nécessaire de ré-homogénéiser la suspension constamment au cours de la préparation des fractions aliquotes. Il est conseillé de préparer 50 ml ou plus en un seul lot et maintenir la suspension homogénéisée à l&#39;aide d&#39;un agitateur magnétique. La solution Chelex peut être stocké pendant des années dans les conditions ambiantes. </li><li> Couper des morceaux de papier Whatman avec une largeur inférieure à la largeur du bec de l&#39;oiseau à tester. La longueur du papier dépend de la méthode de prélever l&#39;échantillon: <ol><li> En utilisant des pinces, la pièce doit être suffisamment longue pour permettre le prélèvement de l&#39;échantillon sans la pince étant insérée dans le bec de l&#39;oiseau. En tant queestimation approximative, pour une longueur de bec de 0,5 cm un morceau de papier avec la longueur de 1 cm doit être fine. </li><li> Si ce n&#39;est pas l&#39;aide de pinces, la pièce doit être plus long, mais la rigidité de la pièce doit toujours permettre l&#39;échantillonnage des cellules épithéliales. </li></ol></li><li> Préparer une aliquote de prémélange de PCR pour chaque échantillon à analyser. Pour une PCR dans un volume total de 25 ul du mélange contient mM dNTP à 0,18, 2 mM de MgCl2, 70 mM Tris-HCl, le sulfate d&#39;ammonium 17,25 mM, 0,1% de Tween-20, 0,32 uM amorce P2 (TCTGCATCGCTAAATCCTTT), 0,32 uM P8 amorce (CTCCCAAGGATGAGRAAYTG) 16 et 2 unités de Taq polymérase. Maison Taq polymerase 17 peut être utilisé. Afin de permettre l&#39;addition de la quantité maximale d&#39;ADN-solution, un pré-mélange de 6 pi peut être préparé et conservé à -20 ° C pendant plusieurs semaines. </li></ol> 2. Prélèvement des échantillons Le port de gants n&#39;est pas essentielle pour la détermination du sexe aviaire que les amorces de PCR peuvent pas s&#39;hybrider avec l&#39;ADN humain. Pourd&#39;autres fins de génotypage, il pourrait être souhaitable. <ol><li> Capturer l&#39;oiseau d&#39;intérêt et tenir doucement dans un exemple de pair avec la «prise de sonnerie» 18. Assurez-vous de ne pas presser l&#39;oiseau. </li><li> Placez une feuille de papier Whatman avec une pince et la glisser à plusieurs reprises dans l&#39;intérieur des joues, la langue et la choane. Habituellement, les échantillons sont obtenus en moins de 30 secondes. <ol><li> Les animaux adultes: selon les espèces, il pourrait être difficile d&#39;obtenir l&#39;oiseau d&#39;ouvrir son bec. Habituellement toucher le côté du bec et appliquant une légère pression va fonctionner. </li><li> Les oisillons: échantillonnage de nouveau-nés ou des oisillons est particulièrement facile en utilisant cette technique, que leur comportement mendicité offre un accès facile à l&#39;intérieur du bec. Il pourrait même être possible d&#39;obtenir l&#39;échantillon sans les manipuler à tous, comme ils mendient facilement par exemple lorsque leur nichoir est ouvert. </li></ol></li><li> Stocker immédiatement le papier dans un préparés contai tube de réactionning 200 ul de 5% (p / p) Chelex-100 solution. </li></ol> Si vous avez l&#39;intention aussi / besoin de marquer les poussins, faites-le maintenant comme décrit dans la section 6. 3. Stockage des échantillons avant l&#39;extraction de l&#39;ADN <ol><li> Si travaillant dans le laboratoire, les échantillons à -20 ° C. Si ce n&#39;est pas possible de stocker des échantillons ou difficile (par exemple dans le domaine) à température ambiante. </li><li> Les échantillons peuvent être conservés pendant plus de 3 ans à des températures allant de la température ambiante à -20 ° C. </li></ol> 4. DNA Extraction <ol><li> Si l&#39;échantillon est congelé, le décongeler à la température ambiante. </li><li> Assurez-vous que le morceau de papier est présent dans le fond du tube immergé dans la solution Chelex-100. </li><li> Incuber les échantillons pendant 15 min à 56 ° C. </li><li> brièvement Vortex et centrifuger le contenu du tube. </li><li> Incuber les échantillons à 8 min à 100 ° C. </li><li> Faites tourner les échantillons à 15 000 g pendant 3 min. </li><li> Utilisez les supernatant pour le génotypage ultérieur. </li></ol> 5. Moléculaire Détermination du sexe <ol><li> Préparer un tube PCR avec 6 pi prémélange par échantillon plus deux tubes supplémentaires pour le négatif (obligatoire) et contrôle positif (en option). Pour la détermination du sexe de routine inclure un échantillon de la dernière sexage réussie en tant que contrôle positif. </li><li> Ajouter 19 ul de surnageant provenant de l&#39;extraction de l&#39;ADN de la pré-mélange PCR. Assurez-vous de la pipette de la surface de la solution pour éviter le report des perles Chelex. Ceci est crucial, comme Chelex est un échangeur de cations et par conséquent inhibe fortement les réactions enzymatiques. </li><li> Exécuter le programme de PCR suivant: incubation à 94 ° C pendant 3 min, 45 cycles chacune avec une fusion de l&#39;étape 30 sec 94 ° C, suivie d&#39;une étape de recuit de 30 secondes à 55 ° C, suivie d&#39;une étape d&#39;élongation de 45 secondes à 72 ° C. Dans une étape finale chasser, les réactions sont incubées pendant 5 min à 72 ° C. </li><li> Préparer un TBE standard de 2% ou TAE agaro<html> soi gel pour séparer les produits de PCR. </li><li> Exécuter le gel d&#39;agarose avec des réglages de tension appropriées. </li><li> Visualiser les bandes sous lumière UV et prendre une photo. Assurez-vous que les deux bandes dans les échantillons provenant de femmes sont bien séparés. </li><li> Distinguer mâle à partir d&#39;échantillons de femmes par la présence d&#39;un deux bandes (femelle) (mâle) ou. </li></ol> 6. Marquage oisillons <ol><li> Vérifiez nids pour les poussins nouvellement éclos sur une appropriée de calendrier pour l&#39;espèce / étude (par exemple, les contrôles quotidiens le matin est conseillé que la plupart des poussins éclosent alors). </li><li> Couper le duvet de chaque poussin dans un nid à un endroit caractéristique différente. Dans les diamants mandarins touffes de bas poussent à quatre zones caractéristiques et distinctes de l&#39;organisme (figure 4A) de l&#39;oisillon. Pour chaque poussin couper une zone (figure 4B). Si il ya plus de quatre poussins dans un nid, les quatre «décotes» uniques peuvent être combinés. </li></ol>ove_content &quot;&gt; Pour les diamants mandarins: Appliquer des bandes de jambe à une dizaine de jours après l&#39;éclosion quand duvet deviennent difficiles à détecter et la taille des oisillons permet de sonner.

<ol>
	<li>Russell, W. M. S., Burch, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+principles+of+humane+experimental+technique.">The principles of humane experimental technique.</a> , (1959).</li><li>Robertson, B. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+sexing+of+individual+kakapo,+Strigops+habroptilus+Aves,+from+feces.">Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces.</a> Mol. Ecol. 8, 1349-1350 (1999).</li><li>Yannic, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Description+of+microsatellite+markers+and+genotyping+performances+using+feathers+and+buccal+swabs+for+the+Ivory+gull+(Pagophila+eburnea).">Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea).</a> Mol. Ecol. Resour. 11, 877-889 (2011).</li><li>Bello, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+feathers.">Isolation of genomic DNA from feathers.</a> J. Vet. Diagn. Invest. 13, 162-164 (2001).</li><li>Handel, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+buccal+swabs+for+sampling+DNA+from+nestling+and+adult+birds.">Use of buccal swabs for sampling DNA from nestling and adult birds.</a> Wildl. Soc. Bull. 34, 1094-1100 (2006).</li><li>Brubaker, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+noninvasive,+direct+real-time+PCR+method+for+sex+determination+in+multiple+avian+species.">A noninvasive, direct real-time PCR method for sex determination in multiple avian species.</a> Mol. Ecol. Resour. 11, 415-417 (2011).</li><li>Arima, H., Ohnishi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Usefulness+of+avian+buccal+cells+for+molecular+sexing.">Usefulness of avian buccal cells for molecular sexing.</a> Ornithological Science. 5, 139-143 (2006).</li><li>Seki, S. -. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+sexing+of+individual+Ryukyu+Robins+Erithacus+komadori+using+buccal+cells+as+a+non-invasive+source+of+DNA.">Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA.</a> Ornithological Science. 2, 135-137 (2003).</li><li>Wellbrock, A. H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Buccal+swabs+as+a+reliable+source+of+DNA+for+sexing+young+and+adult+Common+Swifts+(Apus+apus).">Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus).</a> J. Ornithol. 153, 991-994 (2012).</li><li>Marion, W. R., Shamis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Annotated-Bibliography+of+Bird+Marking+Techniques.">Annotated-Bibliography of Bird Marking Techniques.</a> Bird Banding. 48, 42-61 (1977).</li><li>Scharff, C., Adam, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurogenetics+of+birdsong.">Neurogenetics of birdsong.</a> Curr. Opin. Neurobiol. , (2012).</li><li>Griffith, S. C., Buchanan, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Zebra+Finch:+the+ultimate+Australian+supermodel.">The Zebra Finch: the ultimate Australian supermodel.</a> Emu. 110, 5-12 (2010).</li><li>Fee, M. S., Scharff, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+songbird+as+a+model+for+the+generation+and+learning+of+complex+sequential+behaviors.">The songbird as a model for the generation and learning of complex sequential behaviors.</a> Ilar J. 51, 362-377 (2010).</li><li>Honarmand, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stressful+dieting:+nutritional+conditions+but+not+compensatory+growth+elevate+corticosterone+levels+in+zebra+finch+nestlings+and+fledglings.">Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings.</a> PLoS On. 5, (1371).</li><li>Krause, E. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebra+finch+nestlings+beg+more+under+better+nutritional+conditions.">Zebra finch nestlings beg more under better nutritional conditions.</a> Behaviour. 148, 1239-1255 (2011).</li><li>Griffiths, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+DNA+test+to+sex+most+birds.">A DNA test to sex most birds.</a> Mol. Ecol. 7, 1071-1075 (1998).</li><li>Pluthero, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+purification+of+high-activity+Taq+DNA+polymerase.">Rapid purification of high-activity Taq DNA polymerase.</a> Nucleic Acids Res. 21, 4850-4851 (1993).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Joint+Working+Group+on+Refinement.+Laboratory+birds:+refinements+in+husbandry+and+procedures.+Fifth+report+of+BVAAWF/FRAME/RSPCA/UFAW+Joint+Working+Group+on+Refinement.">Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement.</a> Lab Anim. 35, 1-163 (2001).</li></ol>

Les auteurs n&#39;ont rien à révéler.

Sexage de frottis buccal à l&#39;aide de Chelex ont montré un taux de réussite très élevé. Les duvet de nouveau-nés de coupe ont permis la différenciation entre les oisillons jusqu&#39;à ce que la jambe bandes était possible. Extraction Chelex-ADN à partir d&#39;un frottis buccal a donné suffisamment d&#39;ADN pour réaliser avec succès le sexage moléculaire. La détermination du sexe était de 100% correctes, validé par le plumage dimorphisme sexuel. Le taux rapporté ici de ...

Reconnaissance individuelle, sexage et le génotypage sont des préalables fondamentaux à une série d&#39;études expérimentales. Obtenir du matériel d&#39;appui de l&#39;ADN et le marquage des sujets clairement (même à un âge précoce) devrait avoir un impact minimal sur la physiologie, le comportement et la survie. Chaque fois que possible, des procédures invasives doivent être évitées selon le principe de RRR 1. Les méthodes non-invasives ne sont pas seulement bénéfique pour l&#39;animal, mais aussi peut améliorer les données obtenues car les animaux sont moins affectés par les traitements. Chez les oiseaux, l&#39;ADN sexage peut être effectuée sur un certain nombre de matériaux obtenus de façon non invasive les fientes, les plumes 2 3,4 ou frottis buccal 3,5,9. Indépendamment de la condition et de l&#39;âge des écouvillons buccaux de question sont la méthode de choix pour le sexage aviaire, car ils sont faciles à réaliser, peu sûr et la manipulation est courte. Jusqu&#39;à présent, l&#39;ADN de prélèvements buccauxa été extrait avec de l&#39;une ou l&#39;autre des kits disponibles dans le commerce ou 3,6 chronophages protocoles d&#39;extraction d&#39;ADN standards 3,6-8. Les kits sont non seulement assez cher, mais leurs protocoles peuvent imposer des défis pour le travail de terrain. Certains détails de la procédure, par exemple, le séchage et l&#39;incubation des échantillons, ne sont pas pratiques dans le domaine. Surtout dans un contexte où les protocoles expérimentaux nécessitent un traitement dépendant du sexe à partir dès que quelques minutes après l&#39;éclosion, il est instamment pour une méthode rapide, non invasive, fiable et facile d&#39;obtenir des résultats. Dans l&#39;ensemble du taxons aviaire une boîte à outils considérable pour les personnes de marquage a été développé 10. Le large éventail des techniques disponibles représente la variété des objectifs de la recherche, des espèces et des budgets. Toutefois, le marquage des petits oisillons a été confrontée à des chercheurs avec des défis supplémentaires. Chez certaines espèces (par exemple les passereaux) poussins sont trop petits pour appliquer des bandes de jambe et nécessitent des méthodes alternatives, quine modifie pas le comportement des parents-enfants. La prise de conscience et l&#39;intérêt dans l&#39;amélioration du bien-être et les techniques dans des études de terrain et de laboratoire animal est de plus en plus, l&#39;utilisation de techniques non invasives est fortement encouragée et préférée. Ce protocole fournit une méthode non-invasive, rapide, facilement reconnaissable et persistant pour marquer individuellement les très jeunes oisillons avant d&#39;appliquer des bandes de jambe est possible. Cette méthode de marquage est introduit sur ​​l&#39;une des espèces les plus importantes du modèle de laboratoire aviaire, le Finch Zebra (Taeniopygia de guttata) 11-13. Le protocole est conforme à tous les objectifs précédemment publiés pour les techniques de marquage individuels 10 et a déjà été appliquée avec succès 14,15.

<table border="0" cellpadding="0" cellspacing="0" width="702">
	<tbody>
		<tr height="75">
			<td height="75" style="height:75px;width:191px;">Whatman 3MM Chromatography paper</td>
			<td style="width:163px;">e.g. Fisher Scientific</td>
			<td style="width:269px;">No.:3030-153</td>
			<td style="width:80px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:191px;">Chelex 100 Resin</td>
			<td style="width:163px;">Biorad</td>
			<td style="width:269px;">#143-2832</td>
			<td></td>
		</tr>
		<tr height="50">
			<td height="50" style="height:50px;width:191px;">Taq polymerase</td>
			<td style="width:163px;">addgene</td>
			<td style="width:269px;">http://www.addgene.org/25712/</td>
			<td></td>
		</tr>
		<tr height="75">
			<td height="75" style="height:75px;width:191px;">leg band (Flexi number rings for birds, diameter 2,5 mm)</td>
			<td style="width:163px;">Horst Stengel &#38; Sohn</td>
			<td style="width:269px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

who is who? non-invasive methods to individually sex and mark altricial chicks

De nombreuses expériences nécessitent détermination précoce du sexe de la progéniture ainsi que tôt le marquage des nouveau-nés pour la reconnaissance individuelle. Selon les directives de protection des animaux, les techniques non invasives devraient être privilégiées cas échéant. Dans notre groupe, nous travaillons sur différentes espèces d&#39;oiseaux chanteurs dans le laboratoire et sur le terrain, et nous appliquons avec succès des méthodes non invasives pour le sexe et individuellement marquons poussins. Cet article présente une boîte à outil non invasif complet. Sexage des oiseaux avant l&#39;expression de caractères sexuels secondaires nécessite la collecte de matériel ADN portant pour la PCR. Nous avons établi une méthode rapide et facile pour les oiseaux de tout âge (post-éclosion) de sexe par extraction d&#39;ADN à partir d&#39;un frottis buccal. Les résultats peuvent être obtenus dans les 3 heures. Pour les duvet de marquage individuel chiches sont garnis de motifs spécifiques permettant l&#39;identification rapide dans l&#39;ordre d&#39;éclosion. Cet ensemble de méthodes est facilement applicable dans un laboratoire standard équipée et particulièrement adapté pour Working dans le domaine comme aucun équipement spécial n&#39;est requis pour l&#39;échantillonnage et le stockage. Manipulation des poussins est minimisée et le marquage et la détermination du sexe techniques sont non-invasive soutenant ainsi le RRR-principe de directives de protection des animaux.

<html> Prélèvements dans la bouche peuvent être utilisées pour obtenir de l&#39;ADN pour la détermination du sexe dans une variété de petits oiseaux Les échantillons ont été prélevés diamants mandarins (Taeniopygia guttata, 99 personnes, âge 0 jours - 5 ans), Canaries (Serinus canaria), bengalis Pinsons (Lonchura striata), des rossignols (Luscinia megarhynchos), Mésanges (Parus major) et merles (Turdus merula) (pour toutes les a...

Watch this Scientific Journal Video about Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks at JoVE.com

Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks

Ce protocole fournit un ensemble pratique de méthodes, ce qui permet extrêmement rapide, facile, non invasif, fiable et à faible coût, la détermination du sexe moléculaire des oiseaux et de leur non-invasive, rapide, sécurisé et facilement reconnaissable marquage peu après l&#39;éclosion. Seulement manipulation limitée des poussins est nécessaire. Cette boîte à outils pratique de méthodes est conforme entièrement aux RRR-directives.

Qui est qui? Méthodes non-invasives pour Individuellement sexe et Mark nidicoles poussins

Many experiments require early determination of offspring's sex as well as early marking of newborns for individual recognition. According to animal ...

who-is-who-non-invasive-methods-to-individually-sex-mark-altricial

Research

JoVE Journal

Biology

18.2K vues.  Freie Universität Berlin.  Ce protocole fournit un ensemble pratique de méthodes, ce qui permet extrêmement rapide, facile, non invasif, fiable et à faible coût, la détermination du sexe moléculaire des oiseaux et de leur non-invasive, rapide, sécurisé et facilement reconnaissable marquage peu après l'éclosion. Seulement manipulation limitée des poussins est nécessaire. Cette boîte à outils pratique de méthodes est conforme entièrement aux RRR-directives. 

Vidéo: Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks

Labeling hESCs and hMSCs with Iron Oxide Nanoparticles for Non-Invasive in vivo Tracking with MR Imaging

In recent years, stem cell research has led to a better understanding of developmental biology, various diseases and its potential impact on regenerative medicine. A non-invasive method to monitor the transplanted stem cells repeatedly in vivo would greatly enhance our ability to understand the mechanisms that control stem cell death and identify trophic factors and signaling pathways that improve stem cell engraftment. MR imaging has been proven to be an effective tool for the in vivo depiction of stem cells with near microscopic anatomical resolution. In order to detect stem cells with MR, the cells have to be labeled with cell specific MR contrast agents. For this purpose, iron oxide nanoparticles, such as superparamagnetic iron oxide particles (SPIO), are applied, because of their high sensitivity for cell detection and their excellent biocompatibility. SPIO particles are composed of an iron oxide core and a dextran, carboxydextran or starch coat, and function by creating local field inhomogeneities, that cause a decreased signal on T2-weighted MR images. This presentation will demonstrate techniques for labeling of stem cells with clinically applicable MR contrast agents for subsequent non-invasive in vivo tracking of the labeled cells with MR imaging.

For the evaluation of new stem cell therapies it is important to non-invasively track the injected cells in vivo. This video will show you how to label human mesenchymal and embryonic stem cells with iron oxide based contrast agents in vivo for subsequent MR imaging in vivo.

Étiquetage CSEh et hMSCs d&#39;oxyde de fer nanoparticules pour les non-invasives dans le suivi in ​​vivo avec IRM

In recent years, stem cell research has led to a better understanding of developmental biology, various diseases and its potential impact on regenerative ...

Recherche

Biologie

Labeling Stem Cells with Fluorescent Dyes for non-invasive Detection with Optical Imaging

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo labeling of stem cells with a fluorescent dye, subsequent intravenous injection of the labeled cells and visualization of their accumulation in specific target organs or pathologies. The presented technique demonstrates how we label human mesenchymal stem cells (hMSC) by simple incubation with the lipophilic fluorescent dye DiD (C67H103CIN2O3S) and how we label human embryonic stem cells (hESC) with the FDA approved fluorescent dye Indocyanine Green (ICG). The uptake mechanism is via adherence and diffusion of the lypophilic dye across the phospholipid cell membrane bilayer. The labeling efficiency is usually improved if the cells are incubated with the dye in serum-free media as opposed to incubation in serum-containing media. Furthermore, the addition of the transfection agent Protamine Sulfate significantly improves contrast agent uptake.

This video shows techniques for labeling of human embryonic stem cells and mesenchymal stem cells with fluorescent dyes. This technique can be used for an in vivo tracking of transplanted stem cells with optical imaging and for histopathological correlations with fluorescence microscopy.

Étiquetage des cellules souches avec des colorants fluorescents pour les non-invasive de détection avec l&#39;imagerie optique

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo ...

Non-invasive 3D-Visualization with Sub-micron Resolution Using Synchrotron-X-ray-tomography

Little is known about the internal organization of many micro-arthropods with body sizes below 1 mm. The reasons for that are the small size and the hard cuticle which makes it difficult to use protocols of classical histology. In addition, histological sectioning destroys the sample and can therefore not be used for unique material. Hence, a non-destructive method is desirable which allows to view inside small samples without the need of sectioning.
We used synchrotron X-ray tomography at the European Synchrotron Radiation Facility (ESRF) in Grenoble (France) to non-invasively produce 3D tomographic datasets with a pixel-resolution of 0.7&micro;m. Using volume rendering software, this allows us to reconstruct the internal organization in its natural state without the artefacts produced by histological sectioning. These date can be used for quantitative morphology, landmarks, or for the visualization of animated movies to understand the structure of hidden body parts and to follow complete organ systems or tissues through the samples.

We used synchrotron X-ray tomography at the European Synchrotron Radiation Facility (ESRF) to non-invasively produce 3D tomographic datasets with a pixel-resolution of 0.7&micro;m. Using volume rendering software, this allows the reconstruction of internal structures in their natural state without the artefacts produced by histological sectioning.

Non-invasive visualisation 3D avec résolution submicronique utilisant synchrotron à rayons X-tomographie

Little is known about the internal organization of many micro-arthropods with body sizes below 1 mm. The reasons for that are the small size and the hard ...

A Magnetic Tether System to Investigate Visual and Olfactory Mediated Flight Control in Drosophila

It has been clear for many years that insects use visual cues to stabilize their heading in a wind stream. Many animals track odors carried in the wind. As such, visual stabilization of upwind tracking directly aids in odor tracking. But do olfactory signals directly influence visual tracking behavior independently from wind cues? Also, the recent deluge of research on the neurophysiology and neurobehavioral genetics of olfaction in Drosophila has motivated ever more technically sophisticated and quantitative behavioral assays. Here, we modified a magnetic tether system originally devised for vision experiments by equipping the arena with narrow laminar flow odor plumes. A fly is glued to a small steel pin and suspended in a magnetic field that enables it to yaw freely. Small diameter food odor plumes are directed downward over the fly s head, eliciting stable tracking by a hungry fly. Here we focus on the critical mechanics of tethering, aligning the magnets, devising the odor plume, and confirming stable odor tracking.

Here we describe how to tether a fly in an olfactory magnetic-tether (OMT) apparatus. We describe how to align the rare-earth magnets and odor ports, and how to set mass flow rates for both the stimulus delivery and vacuum suction to achieve optimal odor tracking.

Un système d&#39;attache magnétique d&#39;enquêter sur les visuels et olfactifs Flight Control Mediated chez la drosophile

It has been clear for many years that insects use visual cues to stabilize their heading in a wind stream. Many animals track odors carried in the wind. ...

Cell Block Preparation from Cytology Specimen with Predominance of Individually Scattered Cells

This video demonstrates Shidham's method for preparation of cell blocks from liquid based cervicovaginal cytology specimens containing individually scattered cells and small cell groups. This technique uses HistoGel (Thermo Scientific) with conventional laboratory equipment.
The use of cell block sections is a valuable ancillary tool for evaluation of non-gynecologic cytology. They enable the cytopathologist to study additional morphologic specimen detail including the architecture of the lesion. Most importantly, they allow for the evaluation of ancillary studies such as immunocytochemistry, in-situ hybridization tests (FISH/CISH) and in-situ polymerase chain reaction (PCR). Traditional cell block preparation techniques have mostly been applied to non-gynecologic cytology specimens, typically for body fluid effusions and fine needle aspiration biopsies.
Liquid based cervicovaginal specimens are relatively less cellular than their non-gynecologic counterparts with many individual scattered cells. Because of this, adequate cellularity within the cell block sections is difficult to achieve. In addition, the histotechnologist sectioning the block cannot visualize the level at which the cells are at the highest concentration. Therefore, it is difficult to monitor the appropriate level at which sections can be selected to be transferred to the glass slides for testing. As a result, the area of the cell block with the cells of interest may be missed, either by cutting past or not cutting deep enough. Current protocol for Shidham's method addresses these issues. Although this protocol is standardized and reported for gynecologic liquid based cytology specimens, it can also be applied to non-gynecologic specimens such as effusion fluids, FNA, brushings, cyst contents etc for improved quality of diagnostic material in cell block sections.

Shidham's method for preparation of cell blocks with AV-marker from cytology specimens containing individually scattered cells and small cell groups.

Préparation Cell Block de cytologie avec une prédominance de cellules individuellement épars

This video demonstrates Shidham's method for preparation of cell blocks from liquid based cervicovaginal cytology specimens containing individually ...

A Practical Approach to Genetic Inducible Fate Mapping: A Visual Guide to Mark and Track Cells In Vivo

Fate maps are generated by marking and tracking cells in vivo to determine how progenitors contribute to specific structures and cell types in developing and adult tissue. An advance in this concept is Genetic Inducible Fate Mapping (GIFM), linking gene expression, cell fate, and cell behaviors in vivo, to create fate maps based on genetic lineage.
GIFM exploits X-CreER lines where X is a gene or set of gene regulatory elements that confers spatial expression of a modified bacteriophage protein, Cre recombinase (CreERT). CreERT contains a modified estrogen receptor ligand binding domain which renders CreERT sequestered in the cytoplasm in the absence of the drug tamoxifen. The binding of tamoxifen releases CreERT, which translocates to the nucleus and mediates recombination between DNA sequences flanked by loxP sites. In GIFM, recombination typically occurs between a loxP flanked Stop cassette preceding a reporter gene such as GFP.
Mice are bred to contain either a region- or cell type-specific CreER and a conditional reporter allele. Untreated mice will not have marking because the Stop cassette in the reporter prevents further transcription of the reporter gene. We administer tamoxifen by oral gavage to timed-pregnant females, which provides temporal control of CreERT release and subsequent translocation to the nucleus removing the Stop cassette from the reporter. Following recombination, the reporter allele is constitutively and heritably expressed. This series of events marks cells such that their genetic history is indelibly recorded. The recombined reporter thus serves as a high fidelity genetic lineage tracer that, once on, is uncoupled from the gene expression initially used to drive CreERT.
We apply GIFM in mouse to study normal development and ascertain the contribution of genetic lineages to adult cell types and tissues. We also use GIFM to follow cells on mutant genetic backgrounds to better understand complex phenotypes that mimic salient features of human genetic disorders.
This video article guides researchers through experimental methods to successfully apply GIFM. We demonstrate the method using our well characterized Wnt1-CreERT;mGFP mice by administering tamoxifen at embryonic day (E)8.5 via oral gavage followed by dissection at E12.5 and analysis by epifluorescence stereomicroscopy. We also demonstrate how to micro-dissect fate mapped domains for explant preparation or FACS analysis and dissect adult fate-mapped brains for whole mount fluorescent imaging. Collectively, these procedures allow researchers to address critical questions in developmental biology and disease models.

A Practical Approach to Genetic Inducible Fate Mapping: A Visual Guide to Mark and Track Cells In Vivo

Genetic Inducible Fate Mapping (GIFM) marks and tracks cells with fine spatial and temporal control in vivo and elucidates how cells from a specific genetic lineage contribute to developing and adult tissues. Demonstrated here are the techniques required to fate map E12.5 mouse embryos for epifluorescent and explant analysis.

Une approche pratique de la cartographie inductible destin génétique: un guide visuel à Mark et Track Cellules In Vivo</em

Fate maps are generated by marking and tracking cells in vivo to determine how progenitors contribute to specific structures and cell types in developing ...

A Reversible, Non-invasive Method for Airway Resistance Measurements and Bronchoalveolar Lavage Fluid Sampling in Mice

Airway hyperreactivity (AHR) measurements and bronchoalveolar lavage (BAL) fluid sampling are essential to experimental asthma models, but repeated procedures to obtain such measurements in the same animal are generally not feasible.  Here, we demonstrate protocols for obtaining from mice repeated measurements of AHR and bronchoalveolar lavage fluid samples.  Mice were challenged intranasally seven times over 14 days with a potent allergen or sham treated.  Prior to the initial challenge, and within 24 hours following each intranasal challenge, the same animals were anesthetized, orally intubated and mechanically ventilated.  AHR, assessed by comparing dose response curves of respiratory system resistance (RRS) induced by increasing intravenous doses of acetylcholine (Ach) chloride between sham and allergen-challenged animals, were determined.  Afterwards, and via the same intubation, the left lung was lavaged so that differential enumeration of airway cells could be performed.  These studies reveal that repeated measurements of AHR and BAL fluid collection are possible from the same animals and that maximal airway hyperresponsiveness and airway eosinophilia are achieved within 7-10 days of initiating allergen challenge.  This novel technique significantly reduces the number of mice required for longitudinal experimentation and is applicable to diverse rodent species, disease models and airway physiology instruments.  

Repeated measurements of rodent respiratory physiology and sampling of airway inflammatory cells are desirable, but generally not feasible. Here we describe a repeatable method for orally intubating mice that permits repeated measurements of airway hyperreactivity and sampling of airway inflammatory cells.

Une réversible, méthode non-invasive pour les mesures de résistance des voies aériennes et d&#39;échantillonnage du liquide de lavage broncho-alvéolaire chez des souris

Airway hyperreactivity (AHR) measurements and bronchoalveolar lavage (BAL) fluid sampling are essential to experimental asthma models, but repeated ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

Fecal glucocorticoïdes Analyse: Surveillance surrénale non invasive en Equidés

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

Methods to Discover Alternative Promoter Usage and Transcriptional Regulation of Murine Bcrp1

Gene expression in different tissues is often controlled by alternative promoters that result in the synthesis of mRNA with unique &#8212; usually untranslated &#8212; first exons. Bcrp1 (Abcg2), the murine orthologue of the ABC transporter Breast Cancer Resistance Protein (BCRP, ABCG2), has at least four alternative promoters that are designated by the corresponding four alternative first exons produced: E1U, E1A, E1B, and E1C. Herein, in-silico protocols are presented to predict alternative promoter usage for Bcrp1. Furthermore, reporter assay methods are described to produce reporter constructs for alternative promoters and to determine the functionality of putative promoters upstream of the alternative first exons that are identified.

With the murine ABC transporter Bcrp1 (Abcg2) as an example, in-silico protocols are presented to detect alternative promoter usage in genes expressed in mouse tissues, and to evaluate the functionality of the alternative promoters identified using reporter assays.

Méthodes à découvrir Alternative Utilisation de promoteur et la régulation transcriptionnelle de Murine BCRP1

Gene expression in different tissues is often controlled by alternative promoters that result in the synthesis of mRNA with unique &#8212; usually ...

Methods to Classify Cytoplasmic Foci as Mammalian Stress Granules

Cells are often challenged by sudden environmental changes. Stress Granules (SGs), cytoplasmic ribonucleoprotein complexes that form in cells exposed to stress conditions, are implicated in various aspects of cell metabolism and survival. SGs modulate cellular signaling pathways, post-transcriptional gene expression, and stress response programs. The formation of these mRNA-containing granules is directly connected to cellular translation. SG assembly is triggered by inhibited translation initiation, and SG disassembly is promoted by translation activation or by inhibited translation elongation. This relationship is further highlighted by SG composition. Core SG components are stalled translation pre-initiation complexes, mRNA, and selected RNA-binding Proteins (RBPs). The purpose of SG assembly is to conserve cellular energy by sequestering translationally stalled housekeeping mRNAs, allowing for the enhanced translation of stress-responsive proteins. In addition to the core constituents, such as stalled translation preinitiation complexes, SGs contain a plethora of other proteins and signaling molecules. Defects in SG formation can impair cellular adaptation to stress and can thus promote cell death. SGs and similar RNA-containing granules have been linked to a number of human diseases, including neurodegenerative disorders and cancer, leading to the recent interest in classifying and defining RNA granule subtypes. This protocol describes assays to characterize and quantify mammalian SGs.

Stress Granules (SGs) are nonmembranous cytoplasmic structures that form in cells exposed to a variety of stresses. SGs contain mRNAs, RNA-binding proteins, small ribosomal subunits, translation-related factors, and various cell signaling proteins. This protocol describes a workflow that uses several experimental approaches to detect, characterize, and quantify bona fide SGs.

Méthodes pour classer les foyers cytoplasmiques sous forme de granulés de stress mammalien

Cells are often challenged by sudden environmental changes. Stress Granules (SGs), cytoplasmic ribonucleoprotein complexes that form in cells exposed to ...