The OPPF-UK is funded by the Medical Research Council, UK (grant MR/K018779/1) and the Membrane Protein Laboratory by the Wellcome Trust (grant 099165/Z/12/Z).

1. Construction of Expression Vectors
<ol>
	<li>Use PCR Infusion cloning to construct up to 96 expression plasmids in parallel using the vectors pOPINE-3C-GFP and pOPIN-N-GFP which add either cleavable C-terminal or N-terminal GFP-His6 fusions to the sequences13&#160;respectively. 
	Note: The choice of vector is dictated by the topology of the protein since the GFP needs to be expressed in the cytosol, thus for a protein with a cytosolic N-terminus and extracellular C-terminus we would use pOPIN-N-GFP and for an extracellular N-terminus and cytosolic C-terminus in we would use pOPINE-3C-GFP. Where both termini are cytosolic we would use pOPINE-3C-GFP unless there is functional reason not to tag the C-terminus.</li>
	<li>Amplify the DNA sequences encoding the membrane proteins with primers incorporating the following extensions shown: 
	pOPINE-3C-GFP (Forward primer &#8212; AGGAGATATACCATG; Reverse primer &#8212; CAGAACTTCCAGTTT) and pOPIN-N-GFP (Forward primer &#8212; AAGTTCTGTTTCAGGGCCCG; Reverse primer &#8212; ATGGTCTAGAAAGCTTTA).</li>
	<li>Analyze the PCR reaction by agarose gel electrophoresis. Once clean PCR products have been obtained, add 5 U DpnI to each well (make up in 5 &#181;l of 1x DpnI reaction buffer). Purify the PCR products using magnetic beads in a 96-well format. 
	Note: DpnI is added to remove the template vector; this step is not necessary if genomic DNA is used as template.</li>
	<li>Add 1 &#956;l (100 ng) of the appropriate linearized vector to each well of a PCR plate.</li>
	<li>Using a multichannel pipettor add x &#956;l of purified PCR insert to the appropriate wells of the PCR plate. Ensure that all products are in the range of 10-250 ng.</li>
	<li>Add (9-x) &#956;l of water to the well and transfer the whole 10 &#956;l to a tube containing the dry-down in-fusion reagent. Leave for 30 sec.</li>
	<li>Mix contents briefly by pipetting up and down. Transfer the reactions back to the original PCR plate and seal.</li>
	<li>Incubate for 30 min at 42 &#176;C in a thermocycler.</li>
	<li>Immediately transfer the reactions to ice as soon as the reaction is complete and add 40 &#956;l of TE (10 mM Tris, pH 8.0, 1 mM EDTA).</li>
	<li>Freeze at once or transform into competent cells. For transformation, use 3 &#181;l of the diluted reaction per 50 &#956;l aliquot of high competency (&#62; 5 x 109 transformants/&#181;g) competent E. coli cells.</li>
	<li>Add 1 ml of LB agar supplemented with 50 &#181;g/ml carbenicillin per well of a 24-well tissue culture plate (for cloning, prepare wells for 2 x number of constructs).</li>
	<li>Following outgrowth, Following outgrowth plate out 25 &#956;l and 25 &#956;l of a 1 in 5 dilution of the culture onto the agar containing 24-well tissue culture plates.</li>
	<li>Spread the cells by gently tilting the plate.</li>
	<li>Dry the plate with the lid off for 10-15 min at 37 &#176;C or in a flow hood at room temperature.</li>
	<li>Replace the lid and turn the plate upside down and incubate overnight at 37 &#176;C.</li>
	<li>Pick two colonies and mini-prep the vectors.</li>
	<li>PCR verify the constructs using the construct specific reverse primer and a vector specific forward primer (e.g. pOPIN_FOR GAC CGA AAT TAA TAC GAC TCA CTA TAG GG).</li>
</ol>
2. Transformation of E. coli Expression Strains
Note: Prior to performing this protocol, E. coli competent cells are made, aliquotted and stored frozen at -80 &#176;C as described previously13. Membrane protein expression is routinely screened in two strains, Lemo21(DE3) and C41(DE3)pLysS. To aid interpretation of the results it can be helpful to include a positive control, e.g. a plasmid expressing GFP or a membrane protein fused to GFP known to express and an empty vector negative control.
<ol>
	<li>Thaw the aliquotted E. coli on ice. Add 3 &#181;l of mini-prepped expression plasmid to each aliquot of competent cells.</li>
	<li>Incubate the mix on ice for 30 min.</li>
	<li>Heat-shock the cells for 30 sec at 42 &#176;C.</li>
	<li>Allow cells to recover on ice for 2 min and then add 300 &#181;l of power broth to each tube.</li>
	<li>Incubate for 1 hr in a 37 &#176;C static incubator.</li>
	<li>Prepare the LB Agar in a 24-well tissue culture plate, supplemented with 50 &#181;g/ml carbenicillin and 35 &#181;g/ml chloramphenicol. Add rhamnose to a final concentration of 0.25 mM to the wells containing Lemo21 (DE3). 
	Note: If the product is likely to be toxic the wells containing C41(DE3) pLysS can be supplemented with 1% (w/v) glucose.</li>
	<li>Transfer 30 &#181;l of cells from the transformation mix onto the LB Agar plates. Spread and dry the plate as described in 1.13-1.15.</li>
</ol>
3. Preparation of Overnight Starter Cultures
Note: Always prepare overnight cultures the day after transformation never from an old transformation plate.
<ol>
	<li>Add 0.7 ml power broth to each well of a 96-well deep-well plate supplemented with 50 &#181;g/ml carbenicillin and 35 &#181;g/ml chloramphenicol. Add rhamnose to the wells containing Lemo21 (DE3) to a final concentration of 0.25 mM. Optionally, supplement C41(DE3) pLysS with 1% (w/v) glucose; see above (2.6 note).</li>
	<li>Pick one colony from the overnight transformation plates into each well. Seal the block with a gas-permeable seal.</li>
	<li>Shake the block at 250 rpm in an incubator with a large throw (e.g. a 25 mm orbit) or at 600 rpm in an incubator with a small throw (e.g. a 4.3 mm orbit) at 37 &#176;C overnight.</li>
</ol>
4. Growth and Induction of Cultures
<ol>
	<li>Add 3 ml of power broth supplemented with 50 &#181;g/ml carbenicillin and 35 &#181;g/ml chloramphenicol to each well of 24-well deep-well plate. Add L-rhamnose (and glucose) as described in section 3.1. Use 3 ml of culture to allow harvesting in duplicate and to allow for some evaporation of water through the gas permeable seal.</li>
	<li>Set up the expression cultures by adding 150 &#181;l of Lemo21 (DE3) or C41(DE3) pLysS overnight cultures to each well of the 24-well deep-well blocks.</li>
	<li>Shake the blocks at 37 &#176;C until the average O.D. at 595 nm is ~0.5 through the plate.</li>
	<li>Induce expression by adding IPTG to the cultures to a final concentration of 1.0 mM IPTG.</li>
	<li>Grow the cultures overnight (18-20 hr) with shaking at 20 &#176;C.</li>
</ol>
5. Analysis of Expression by In-gel Fluorescence
<ol>
	<li>Harvest in duplicate. Transfer 1 ml of culture from each well into a square well, conical bottom, 96-well deep-well block. 
	Note: Harvest in duplicate in case of breakage of the block or to allow the testing of an alternative detergent if desired.</li>
	<li>Seal the blocks and harvest the cells by centrifugation at 6,000 x g for 10 min.</li>
	<li>Invert the block and decant the media. Tap the block gently onto a paper towel to drain remaining media.</li>
	<li>Seal the plates and store at -80 &#176;C for a minimum of 20 min. Optionally, leave the experiment at this point and the block processed when convenient.</li>
	<li>De-frost the pellets for 20 min at room temperature.</li>
	<li>Use either a multi-channel pipette or an orbital shaker (1,000 rpm for 10 min) at 4 &#176;C to resuspend&#160;the cells completely in 200 &#181;l of lysis buffer (50 mM NaH2PO4,&#160;300 mM NaCl 10 mM Imidazole 1% v/v Tween 20, adjust the pH to 8.0 using NaOH).</li>
	<li>Add 20 &#181;l of the DLPI solution (20 &#181;l DNaseI (4,000 units/ml), 20 mg lysozyme, and 20 &#181;l protease inhibitor cocktail in a final volume of 2 ml of water). Incubate for 10 min with shaking (~1,000 rpm) at 4 &#176;C.</li>
	<li>Add 25 &#181;l of 10% n-Dodecyl &#946;-D-maltoside (DDM).</li>
	<li>Incubate for 60 min with shaking (~1,000 rpm) at 4 &#176;C.</li>
	<li>Centrifuge the deep-well block at 6,000 x g for 30 min at 4 &#176;C.</li>
	<li>Transfer 10 &#956;l of the cleared lysate to a microtitre plate and add 10 &#956;l of SDS PAGE gel loading buffer (100 mM Tris, pH 6.8, 4% w/v SDS, 0.2% w/v Bromophenol blue, 10% v/v &#946;-mercaptoethanol, and 20% v/v glycerol). CAUTION! DO NOT BOIL THE SAMPLE.</li>
	<li>Load 10 &#956;l of sample from step 5.11/well onto SDS PAGE gel(s) and run at 100-120 V (constant voltage) in a cold room until the dye front reaches the bottom (2-2.5 hr).</li>
	<li>Place the gel onto an imager (e.g. with a blue-light filter to detect the GFP fusion proteins). The exposure time is chosen to ensure that the brightest bands are not saturated.</li>
</ol>
6. Scale-up of Cell Cultures
<ol>
	<li>Transform an aliquot of competent E. coli as described in section 2.</li>
	<li>Pick a colony into 10 ml of power broth (supplemented as described in section 3) and grow overnight at 37 &#176;C.</li>
	<li>Dilute 5 ml of the overnight culture into 500 ml power broth.</li>
	<li>Grow with shaking at 250 rpm at 37 &#176;C until the O.D. at 595 nm is ~0.5.</li>
	<li>Induce expression by adding IPTG to a final concentration of 1.0 mM.</li>
	<li>Grow overnight with shaking at 250 rpm at 20 &#176;C.</li>
	<li>Harvest cells by centrifugation at 5,000 x g for 15 min.</li>
	<li>Discard supernatant. Cell pellets can be stored at -80 &#176;C.</li>
</ol>
7. Preparation of Membranes
<ol>
	<li>Thaw cells (if necessary) at room temperature and resuspend in 1x PBS pH 7.5 at a volume of 5ml per gram of cell pellet; Increase volume as necessary until viscosity reduces to a runny consistency.&#160;Add&#160;MgCl2 to final concentration of 1 mM, DNAse I to final concentration of 10 &#956;g/ml and one pre-packaged protease inhibitor tablet per 20 g of cell pellet. Break open cells using a chilled cell disrupter at a pressure of 30 kpsi.</li>
	<li>Pellet the unbroken cells and debris at 30,000 g for 15 min at 4 &#176;C. Transfer supernatant to an ultra-centrifugation tube.</li>
	<li>Collect the total membrane fraction by spinning down the supernatant in an ultra-centrifuge at 200,000 x g for 1 hr at 4 &#176;C.</li>
	<li>Discard the supernatant.</li>
	<li>Re-suspend the membrane pellet in ice-cold 10 ml PBS pH 7.5 using a cell homogenizer. 1 ml resuspended membranes are required for each detergent. Optionally, at this stage, flash freeze the membrane suspension in liquid nitrogen and store at -80 &#176;C.</li>
</ol>
8. Solubilization and Analysis of the Membrane Fraction
<ol>
	<li>Thaw membrane fraction (if necessary), and for each detergent to be used for solubilization, aliquot 900 &#181;l of the membrane suspension into a 1.5 ml polyallomer micro-centrifuge tube.</li>
	<li>Add 100 &#181;l of each freshly prepared detergent (10% w/v solutions of DDM, DM, Cymal-6 and LDAO) to a final concentration of 1% to the specified 1.5 ml tube. For solubilization of eukaryotic membrane proteins cholesterol hemisuccinate (0.2% final concentration) can be added to the detergents.</li>
	<li>Incubate the mixtures at 4 &#176;C for 1 hr with mild agitation.</li>
	<li>Pellet the detergent insoluble fraction with a bench top ultra-centrifuge, ensuring tubes are at least half-full, at 150,000 g at 4 &#176;C for 45 min and retain supernatant. 
	Note: The effectiveness of detergent solubilization can be estimated using a fluorescent plate reader by measuring the GFP fluorescence of the solubilized membranes with the detergent insoluble fraction resuspended in the same volume of PBS.</li>
	<li>Analyze the mono-dispersity of the different detergent : membrane protein complexes using fluorescence-detected size exclusion chromatography (FSEC).</li>
	<li>For FSEC analysis, equilibrate a size exclusion column with a broad fractionation range, e.g. 5,000 to 5,000,000 in molecular weight, with running buffer (20 mM Tris pH 7.5, 150 mM NaCl, 0.03% DDM) at a flow rate of 0.3 ml/min. Use this buffer for all samples, i.e. it is not changed for each detergent tested.</li>
	<li>Inject 100 &#181;l of solubilized membranes onto the column at a flow rate of 0.3 ml/min. Monitor elution profile using fluorescence optics (excitation at 488 nm and emission at 512 nm). If an inline fluorescence monitor is not available, collect the fractions and read the fluorescence in a plate reader.</li>
	<li>Import elution volume and fluorescence intensity data into a spreadsheet program for graphical display.</li>
	<li>Analyse remaining solubilized membrane material by in-gel fluorescence as described in section 5.</li>
</ol>

<ol>
	<li>Wallin, E., von Heijne, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+integral+membrane+proteins+from+eubacterial,+archaean,+and+eukaryotic+organisms.">Genome-wide analysis of integral membrane proteins from eubacterial, archaean, and eukaryotic organisms.</a> Protein Sci. 7 (4), 1029-1038 (1998).</li><li>Fagerberg, L., Jonasson, K., von Heijne, G., Uhlen, M., Berglund, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prediction+of+the+human+membrane+proteome.">Prediction of the human membrane proteome.</a> Proteomics. 10 (6), 1141-1149 (2010).</li><li>Okada, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-Ray+diffraction+analysis+of+three-dimensional+crystals+of+bovine+rhodopsin+obtained+from+mixed+micelles.">X-Ray diffraction analysis of three-dimensional crystals of bovine rhodopsin obtained from mixed micelles.</a> J Struct Biol. 130 (1), 73-80 (2000).</li><li>Palczewski, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+rhodopsin:+A+G+protein-coupled+receptor.">Crystal structure of rhodopsin: A G protein-coupled receptor.</a> Science. 289 (5480), 739-745 (2000).</li><li>Miroux, B., Walker, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Over-production+of+proteins+in+Escherichia+coli:+mutant+hosts+that+allow+synthesis+of+some+membrane+proteins+and+globular+proteins+at+high+levels.">Over-production of proteins in Escherichia coli: mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels.</a> J Mol Biol. 260 (3), 289-298 (1996).</li><li>Wagner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tuning+Escherichia+coli+for+membrane+protein+overexpression.">Tuning Escherichia coli for membrane protein overexpression.</a> Proc Natl Acad Sci U S A. 105 (38), 14371-14376 (2008).</li><li>Schlegel, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+membrane+protein+overexpression+in+the+Escherichia+coli+strain+Lemo21(DE3).">Optimizing membrane protein overexpression in the Escherichia coli strain Lemo21(DE3).</a> J Mol Biol. 423 (4), 648-659 (2012).</li><li>Chun, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+partner+toolchest+for+the+stabilization+and+crystallization+of+G+protein-coupled+receptors.">Fusion partner toolchest for the stabilization and crystallization of G protein-coupled receptors.</a> Structure. 20 (6), 967-976 (2012).</li><li>Drew, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GFP-based+optimization+scheme+for+the+overexpression+and+purification+of+eukaryotic+membrane+proteins+in+Saccharomyces+cerevisiae.">GFP-based optimization scheme for the overexpression and purification of eukaryotic membrane proteins in Saccharomyces cerevisiae.</a> Nat Protoc. 3 (5), 784-798 (2008).</li><li>Drew, D. E., von Heijne, G., Nordlund, P., de Gier, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Green+fluorescent+protein+as+an+indicator+to+monitor+membrane+protein+overexpression+in+Escherichia+coli.">Green fluorescent protein as an indicator to monitor membrane protein overexpression in Escherichia coli.</a> FEBS Lett. 507 (2), 220-224 (2001).</li><li>Kawate, T., Gouaux, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence-detection+size-exclusion+chromatography+for+precrystallization+screening+of+integral+membrane+proteins.">Fluorescence-detection size-exclusion chromatography for precrystallization screening of integral membrane proteins.</a> Structure. 14 (4), 673-681 (2006).</li><li>Newstead, S., Kim, H., von Heijne, G., Iwata, S., Drew, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+fluorescent-based+optimization+of+eukaryotic+membrane+protein+overexpression+and+purification+in+Saccharomyces+cerevisiae.">High-throughput fluorescent-based optimization of eukaryotic membrane protein overexpression and purification in Saccharomyces cerevisiae.</a> Proc Natl Acad Sci U S A. 104 (35), 13936-13941 (2007).</li><li>Busso, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+protein+complexes+using+multiple+Escherichia+coli+protein+co-expression+systems:+a+benchmarking+study.">Expression of protein complexes using multiple Escherichia coli protein co-expression systems: a benchmarking study.</a> J Struct Biol. 175 (2), 159-170 (2011).</li><li>Sonoda, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Benchmarking+membrane+protein+detergent+stability+for+improving+throughput+of+high-resolution+X-ray+structures.">Benchmarking membrane protein detergent stability for improving throughput of high-resolution X-ray structures.</a> Structure. 19 (1), 17-25 (2011).</li><li>Low, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+analytical+gel+filtration+screening+of+integral+membrane+proteins+for+structural+studies.">High-throughput analytical gel filtration screening of integral membrane proteins for structural studies.</a> Biochim Biophys Acta. 1830 (6), 3497-3508 (2013).</li></ol>

The authors have nothing to disclose.

In the protocol described in this article, ligation independent cloning into a GFP reporter vector is combined with fluorescence detection to rapidly screen the relative expression of multiple membrane proteins in E. coli. Vectors can be made in four working days with primary expression screening taking a further week. In-gel fluorescence of detergent lysates of whole cells is used to rank expression hits for further analysis in a secondary screen. The primary expression screen as presented does not require any specialist equipment apart from a shaker incubator suitable for growing cells in deep well blocks. All other liquid handling involving 96-well SBS plates can be carried out using multi-channel pipettes. The protocol can be readily modified to include other E.coli strains grown under different expression conditions (e.g. lower temperature). In the case of the LEMO21(DE3) titrating the level of rhamnose (from 0 to 2.0 mM) added to modulate the rate of transcription can increase the level of expression of some membrane proteins7 . Detergents other than DDM could be used for extraction in the primary screen though harsher detergents may solubilize proteins from inclusion bodies and therefore give false positives. Clearly, the more elaborate the initial screen becomes, the more time-consuming the experiment.
The secondary screen involves preparing a total membrane fraction from the expression hits identified in the primary screen. This is a critical step as it will confirm the localisation of the fusion proteins to the membrane of the E. coli cells. Subsequent extraction of the GFP fusion protein in different detergents is monitored by fluorescence-detected size exclusion chromatography of solubilized material to assess the mono-dispersity of the detergent-protein complexes. This is another critical step since it identifies the most appropriate detergent for solubilization of the membrane protein for subsequent downstream processing. However, experience shows that further optimization of the choice of detergent(s) may still be required during purification and crystallization. Evidence of uniform behavior in different detergents including ones with a relatively small micelle size (e.g. LDAO) appears to be good indicator of a propensity to form well diffracting crystals at least for prokaryotic membrane proteins14. In this respect the profile shown for the membrane protein in Figure 2B appears highly favorable.
The main advantage of using a GFP reporter is that it gives a rapid read-out of expression in un-purified samples. A disadvantage is that the GFP fusion protein has to be removed during the purification of the protein for crystallization. In the case of the vectors used here, a rhinovirus 3C protease site enables cleavage of the GFP. Alternatively, it is straightforward to re-clone candidate proteins, identified in the screen, into vectors which only add a polyhistidine or other affinity tag for subsequent purification. This assumes that fusion to GFP is not necessary for expression. The main alternative to using fusion to GFP for detection of membrane protein expression and solubilization is to add only a histidine tag. However this approach typically requires starting with a membrane fraction15 which for the evaluation of many variants would become very time-consuming.
In summary, the main purpose of the protocol described in this article is to enable a large number of membrane protein sequence variants to be rapidly evaluated in terms of expression and detergent solubilization and prioritized for deeper analysis.

It has been estimated that membrane proteins account for approximately 20-30% of the genes coded in all sequenced genomes 1, including the human genome 2. Given their critical role in many biological processes, for example transport of metabolites, energy generation and as drug targets, there is intense interest in determining their three dimensional structure. However compared to soluble proteins, membrane proteins are highly under-represented in the Protein Data Bank. In fact, of the 99,624 released structures in the PDB (<a href="http://www.rcsb.org/pdb/">http://www.rcsb.org/pdb/</a>) only 471 (<a href="http://blanco.biomol.uci.edu/mpstruc/">http://blanco.biomol.uci.edu/mpstruc/</a>) are classified as membrane proteins. This reflects the technical difficulties of working with membrane proteins which are naturally expressed at relatively low levels; rhodopsin is one of a few exceptions3,4. Over-expression of recombinant versions in heterologous cells often results in misfolding and poor targeting to the membrane which limits the overall level of production. Selecting the best detergent for extraction and solubilization of a membrane protein once expressed makes subsequent purification difficult and requires careful optimization.
Escherichia coli remains the most commonly used expression host for membrane proteins accounting for 72% (<a href="http://blanco.biomol.uci.edu/mpstruc/">http://blanco.biomol.uci.edu/mpstruc/</a>) of structures solved to date which are almost exclusively from bacterial sources. Specific E. coli strains, C41(DE3) and C43(DE3), have been isolated which do not lead to the over-expression of membrane proteins and hence avoid the effects of toxicity observed for other BL21 strains5,6. Tuning the level of recombinant membrane protein expression appears to be critical for optimizing the level of production6,7.
In many cases successful production of membrane proteins for structure determination has required the evaluation of multiple versions including amino- and carboxy-terminal deletions, multiple orthologues to exploit natural sequence variation and different fusion proteins6-8. Therefore, a method for the expression screening of multiple membrane proteins in parallel is essential. One commonly used approach is to fuse the protein to green fluorescent protein (GFP) enabling expression to be tracked without the need to purify the protein. In this way, information about expression level, stability and behavior in different detergents can be assessed with small amounts of un-purified material9-12.
In this article we describe a streamlined protocol for cloning and expression screening of membrane proteins in E. coli using fusion to GFP as a reporter of production and subsequent characterization of detergent: protein complexes (Figure 1).

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Name of Material</td>
			<td>Company</td>
			<td>Catalog Number</td>
		</tr>
		<tr>
			<td>pOPIN-N-GFP</td>
			<td>addgene (www.addgene.org)</td>
			<td></td>
		</tr>
		<tr>
			<td>pOPINE-3C-GFP</td>
			<td>addgene (www.addgene.org)</td>
			<td></td>
		</tr>
		<tr>
			<td>C41(DE3)pLysS</td>
			<td>Lucigen (http://lucigen.com/</td>
			<td>60444-1</td>
		</tr>
		<tr>
			<td>LEMO21(DE3)</td>
			<td>New England Biolabs</td>
			<td>C2528H</td>
		</tr>
		<tr>
			<td>In-Fusion HD EcoDry Cloning System, 96 Rxns</td>
			<td>Clontech/Takara</td>
			<td>639688</td>
		</tr>
		<tr>
			<td>Power broth</td>
			<td>Molecular Dimensions (http://www.moleculardimensions.com/)</td>
			<td>MD12-106-1</td>
		</tr>
		<tr>
			<td>Protease Inhibitor tablets</td>
			<td>Roche</td>
			<td>11697498001</td>
		</tr>
		<tr>
			<td>cOmplete, Mini, EDTA-Free; Protease Inhibitor Cocktail&#160;</td>
			<td>Roche</td>
			<td>11836170001</td>
		</tr>
		<tr>
			<td>L-Rhamnose monohydrate</td>
			<td>Sigma-Aldrich</td>
			<td>83650</td>
		</tr>
		<tr>
			<td>Protease Inhibitor Cocktail&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>P8849</td>
		</tr>
		<tr>
			<td>DNAse 1</td>
			<td>Sigma-Aldrich</td>
			<td>DN25</td>
		</tr>
		<tr>
			<td>Lysozyme</td>
			<td>Sigma-Aldrich</td>
			<td>L7651</td>
		</tr>
		<tr>
			<td>Cholesterol hemisuccinate</td>
			<td>Sigma-Aldrich</td>
			<td>C6512</td>
		</tr>
		<tr>
			<td>CYMAL-6 ( 6-Cyclohexyl-1-Hexyl-&#946;-D-Maltoside)</td>
			<td>Anatrace</td>
			<td>C326</td>
		</tr>
		<tr>
			<td>DDM ( n-Dodecyl &#223;-maltoside )</td>
			<td>Generon</td>
			<td>D97002</td>
		</tr>
		<tr>
			<td>DM (n-Decyl &#223;-maltoside)</td>
			<td>Generon</td>
			<td>D99003</td>
		</tr>
		<tr>
			<td>LDAO ( N,N-Dimethyl-n-dodecylamine N-oxide)</td>
			<td>Generon</td>
			<td>D71111</td>
		</tr>
		<tr>
			<td>E1 ClipTip Eq384 8 channel 1-30 ul&#160;</td>
			<td>Thermo Scientific&#160;</td>
			<td>4672030</td>
		</tr>
		<tr>
			<td>Rainin Pipette Pipet-Lite XLS 6ch 100-1200&#181;L LTS Spacer</td>
			<td>Anachem</td>
			<td>LA6-300XLS</td>
		</tr>
		<tr>
			<td>Rainin Pipette Light XLS+ 8ch 2-20&#181;L LTS</td>
			<td>Anachem</td>
			<td>L8-20XLSPLUS</td>
		</tr>
		<tr>
			<td>Pipette Pipet-Lite XLS 8ch 100-1200&#181;L LTS Tip</td>
			<td>Anachem</td>
			<td>L8-1200XLS</td>
		</tr>
		<tr>
			<td>24 well V bottom deep well blocks</td>
			<td>Porvair sciences</td>
			<td>360115</td>
		</tr>
		<tr>
			<td>BenchMark Fluorescent Protein Standard</td>
			<td>Life Technologies</td>
			<td>LC5928</td>
		</tr>
		<tr>
			<td>NuPAGE Novex 10% Bis-Tris Midi Protein Gels, 26 well</td>
			<td>Life Technologies</td>
			<td>WG1203BOX</td>
		</tr>
		<tr>
			<td>XCell4 SureLock Midi-Cell</td>
			<td>Life Technologies</td>
			<td>WR0100</td>
		</tr>
		<tr>
			<td>Vibramax 100</td>
			<td>Heidolph</td>
			<td>544-21200-00</td>
		</tr>
		<tr>
			<td>Tension rollers attachment</td>
			<td>Heidolph</td>
			<td>549-81000-00</td>
		</tr>
		<tr>
			<td>ptima L-100 Ultracentrifuge running 45-Ti rotor</td>
			<td>Beckman Coulter</td>
			<td>393253</td>
		</tr>
		<tr>
			<td>Optima Max-XP ultracentrifuge running TLA-55 rotor</td>
			<td>Beckman Coulter</td>
			<td>393315</td>
		</tr>
		<tr>
			<td>Floor standing centrifuge, Avanti J-26S XPI running JA-17 and JS-5.3 rotors&#160;</td>
			<td>Beckman Coulter</td>
			<td>B14535</td>
		</tr>
		<tr>
			<td>Prominence UFLC with RF-20A Fluorescence detector</td>
			<td>Shimadzu</td>
			<td></td>
		</tr>
		<tr>
			<td>Sepharose 6 10/300 GL size exclusion column</td>
			<td>GE Healthcare</td>
			<td>17-5172-01&#160;</td>
		</tr>
		<tr>
			<td>SSI5R-HS SHEL LAB Floor Model Shaking Incubator, 5 Cu.Ft. (144 L), 30-850 RPMs</td>
			<td>Shel Lab&#160;</td>
			<td>SSI5R-HS</td>
		</tr>
		<tr>
			<td>Innova44R incubator</td>
			<td>New Brunswick /Eppendorf</td>
			<td>Innova44R</td>
		</tr>
		<tr>
			<td>TS SERIES 0.75KW DISRUPTER 230V 50HZ 1PH (40KPSI)</td>
			<td>Constant systems</td>
			<td>PL083016</td>
		</tr>
		<tr>
			<td>L-Rhamnose monohydrate</td>
			<td>Sigma</td>
			<td>83650</td>
		</tr>
	</tbody>
</table>

green fluorescent protein-based expression screening of membrane proteins in escherichia coli

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and the inherent instability of many membrane proteins once solubilized in detergents. A protocol is described that combines ligation independent cloning of membrane proteins as GFP fusions with expression in Escherichia coli detected by GFP fluorescence. This enables the construction and expression screening of multiple membrane protein/variants to identify candidates suitable for further investment of time and effort. The GFP reporter is used in a primary screen of expression by visualizing GFP fluorescence following SDS polyacrylamide gel electrophoresis (SDS-PAGE). Membrane proteins that show both a high expression level with minimum degradation as indicated by the absence of free GFP, are selected for a secondary screen. These constructs are scaled and a total membrane fraction prepared and solubilized in four different detergents. Following ultracentrifugation to remove detergent-insoluble material, lysates are analyzed by fluorescence detection size exclusion chromatography (FSEC). Monitoring the size exclusion profile by GFP fluorescence provides information about the mono-dispersity and integrity of the membrane proteins in different detergents. Protein: detergent combinations that elute with a symmetrical peak with little or no free GFP and minimum aggregation are candidates for subsequent purification. Using the above methodology, the heterologous expression in E. coli of SED (shape, elongation, division, and sporulation) proteins from 47 different species of bacteria was analyzed. These proteins typically have ten transmembrane domains and are essential for cell division. The results show that the production of the SEDs orthologues in E. coli was highly variable with respect to the expression levels and integrity of the GFP fusion proteins. The experiment identified a subset for further investigation.

The SEDS family of proteins (shape, elongation, division, and sporulation) is essential for bacterial cell division. These integral proteins typically have ten transmembrane domains with both amino and carboxy termini inside the cell. To exemplify the protocol described above, 47 SEDs orthologues were cloned into the vector pOPINE-3C-eGFP. A small scale expression screen of the constructs was carried out in two E .coli strains, Lemo21(DE3) grown in the presence of 0.25 mM rhamnose to block leaky expression and C41(DE3) pLysS, which are routinely used for the expression of membrane proteins5-8.
Detergent solubilized lysates of induced cultures were analyzed by SDS-polyacrylamide electrophoresis. Using in-gel fluorescence to visualize expressed GFP fusion proteins showed that between the two strains 38 out of the 47 SEDs constructs were produced. Interestingly there were differences between the two expression strains. Of the 38 expressed constructs, only 18 were produced in both strains, 14 only expressed in Lemo21(DE3) and 6 only in C41(DE3) pLysS. Overall, there was a higher success rate for the Lemo21(DE3) compared to the C41(DE3) pLysS (38 vs 24). However the observation that some proteins appeared to be strain specific means that screening in both is useful.
Representative data for 24 of the 47 SEDs constructs are shown in Figure 1. The intensity of the bands gives an indication of the level of expression, e.g. the fusion protein in well C4 in Figure 1A and 1B is expressed well in both strains however the additional lower molecular weight bands suggest that the protein is partially degraded. In many lanes there is a band which corresponds in size to GFP alone. A qualitative assessment of the integrity of the protein can be carried out by looking at the intensity of fusion protein relative to the free GFP; e.g. G4 and H4 are completely broken down to free GFP in C41(DE3) pLysS (Figure 1B) whereas in the Lemo21(DE3) there is some intact protein (Figure 1A). For 14 out of the 38 expressed proteins the intensity of the free GFP band is similar to that of the fusion protein, for 21 the intensity of the free GFP band is greater than that of the fusion protein and a minority of the fusion proteins (3/38 expressed) e.g. F6 and G6 in Figure 1A have relatively little free GFP compared to the fusion protein.
Two of the constructs that expressed well in the primary screen B5 (high intensity bands for free GFP and fusion proteins) and G6 (little free GFP) were expressed and a total membrane fraction prepared from 500 ml cell culture. Resuspended membranes were divided into aliquots and analyzed by fluorescence-detected size exclusion chromatography (FSEC). The FSEC profiles are presented in Figure 2A and 2B respectively and show that the two SEDs proteins behave differently in the four detergents tested. In one case (Figure 2A: sample B5) the protein only gave a symmetrical peak with little aggregation in DDM which would therefore be the detergent of choice for subsequent purification. By contrast the other fusion protein (Figure 2B: sample G6) gave a similar profile in all detergents tested.
<img alt="Figure 1" src="/files/ftp_upload/52357/52357fig1highres.jpg" width="700px" /> 
Figure 1: Diagram of workflow for screening membrane protein expression in E. coli using a GFP reporter.
<img alt="Figure 2" src="/files/ftp_upload/52357/52357fig2highres.jpg" /> 
Figure 2: Primary screen of membrane protein expression using in-gel fluorescence. Detergent lysates of E. coli cells were analyzed by SDS-PAGE and gels imaged using Blue Epi illumination and a 530/28 filter. The results are shown for 24 constructs (labeled A4-H6 based on their position in a 96-well plate). The positions of the bands for free GFP and GFP fusion proteins are indicated. (A) Proteins expressed in Lemo21(DE3). (B) Proteins expressed in C41(DE3) pLysS.
<img alt="Figure 3" src="/files/ftp_upload/52357/52357fig3highres.jpg" /> 
Figure 3: Secondary screen of membrane protein expression using Fluorescence-detected size exclusion chromatography (FSEC). Total membrane fractions were extracted in four different detergents and the solubilized membrane proteins analyzed by size exclusion chromatography using a FPLC system coupled to a fluorescence detector. FSEC profiles for (A) membrane protein B5 and (B) membrane protein G6. The position of the peaks corresponding to aggregated protein, solubilized GFP fusion protein and free GFP are indicated. The detergents tested are indicated below the profiles.

Watch this Scientific Journal Video about Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli at JoVE.com

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

A streamlined approach to screening for the expression of recombinant membrane proteins in Escherichia coli based on fusion to green fluorescent protein is presented.

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...

green-fluorescent-protein-based-expression-screening-membrane

Research

JoVE Journal

Biology

32.3K vues.  Research Complex at Harwell.  Une approche rationalisée de dépistage de l'expression des protéines membranaires recombinantes dans Escherichia coli basée sur la fusion de la protéine fluorescente verte est présenté. 

Vidéo: Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Staining of Proteins in Gels with Coomassie G-250 without Organic Solvent and Acetic Acid

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents (Methanol, Ethanol or 2-Propanol) and acetic acid are used for fixation, staining and destaining of proteins in a gel after SDS-PAGE. To speed up the procedure, heating the staining solution in the microwave oven for a short time is frequently used. This usually results in evaporation of toxic or hazardous Methanol, Ethanol or 2-Propanol and a strong smell of acetic acid in the lab which should be avoided due to safety considerations. In a protocol originally published in two patent applications by E.M. Wondrak (US2001046709 (A1), US6319720 (B1)), an alternative composition of the staining solution is described in which no organic solvent or acid is used. The CBB is dissolved in bidistilled water (60-80mg of CBB G-250 per liter) and 35 mM HCl is added as the only other compound in the staining solution. The CBB staning of the gel is done after SDS-PAGE and thorough washing of the gel in bidistilled water. By heating the gel during the washing and staining steps, the process can be finished faster and no toxic or hazardous compunds are evaporating. The staining of proteins occurs already within 1 minute after heating the gel in staining solution and is fully developed after 15-30 min with a slightly blue background that is destained completely by prolonged washing of the stained gel in bidistilled water, without affecting the stained protein bands.

A short protocol for protein staining with Coomassie Brilliant Blue (CBB) G-250 in polyacrylamide gels is described without using organic solvents or acetic acid as in the classical staining procedures with CBB.

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents ...

An Assay for Measuring the Activity of Escherichia coli Inducible Lysine Decarboxyase

Escherichia coli is an enteric bacterium that is capable of growing over a wide range of pH values (pH 5 - 9)1 and, incredibly, is able to survive extreme acid stresses including passage through the mammalian stomach where the pH can fall to as low as pH 1 - 22. To enable such a broad range of acidic pH survival, E. coli possesses four different inducible amino acid decarboxylases that decarboxylate their substrate amino acids in a proton-dependent manner thus raising the internal pH. The decarboxylases include the glutamic acid decarboxylases GadA and GadB3, the arginine decarboxylase AdiA4, the lysine decarboxylase LdcI5, 6 and the ornithine decarboxylase SpeF7. All of these enzymes utilize pyridoxal-5'-phospate as a co-factor8 and function together with inner-membrane substrate-product antiporters that remove decarboxylation products to the external medium in exchange for fresh substrate2. In the case of LdcI, the lysine-cadaverine antiporter is called CadB. Recently, we determined the X-ray crystal structure of LdcI to 2.0 &#197;, and we discovered a novel small-molecule bound to LdcI the stringent response regulator guanosine 5'-diphosphate,3'-diphosphate (ppGpp) 14. The stringent response occurs when exponentially growing cells experience nutrient deprivation or one of a number of other stresses9. As a result, cells produce ppGpp which leads to a signaling cascade culminating in the shift from exponential growth to stationary phase growth10. We have demonstrated that ppGpp is a specific inhibitor of LdcI 14. Here we describe the lysine decarboxylase assay, modified from the assay developed by Phan et al.11, that we have used to determine the activity of LdcI and the effect of pppGpp/ppGpp on that activity. The LdcI decarboxylation reaction removes the &alpha;-carboxy group of L-lysine and produces carbon dioxide and the polyamine cadaverine (1,5-diaminopentane)5. L-lysine and cadaverine can be reacted with 2,4,6-trinitrobenzensulfonic acid (TNBS) at high pH to generate N,N'-bistrinitrophenylcadaverine (TNP-cadaverine) and N,N&#8242;-bistrinitrophenyllysine (TNP-lysine), respectively11. The TNP-cadaverine can be separated from the TNP-lysine as the former is soluble in organic solvents such as toluene while the latter is not (See Figure 1). The linear range of the assay was determined empirically using purified cadaverine.

An Assay for Measuring the Activity of Escherichia coli Inducible Lysine Decarboxyase

The activity of the inducible lysine decarboxylase is monitored by reacting the substrate L-lysine and the product cadaverine with 2,4,6-trinitrobenzensulfonic acid to form adducts that have differential solubility in toluene.

Escherichia coli is an enteric bacterium that is capable of growing over a wide range of pH values (pH 5 - 9)1 and, incredibly, is able to survive extreme ...

Crystallization of Membrane Proteins in Lipidic Mesophases

Membrane proteins perform critical functions in living cells related to signal transduction, transport and energy transformations, and, as such, are implicated in a multitude of malfunctions and diseases. However, a structural and functional understanding of membrane proteins is strongly lagging behind that of their soluble partners, mainly, due to difficulties associated with their solubilization and generation of diffraction quality crystals. Crystallization in lipidic mesophases (also known as in meso or LCP crystallization) is a promising technique which was successfully applied to obtain high resolution structures of microbial rhodopsins, photosynthetic proteins, outer membrane beta barrels and G protein-coupled receptors. In meso crystallization takes advantage of a native-like membrane environment and typically produces crystals with lower solvent content and better ordering as compared to traditional crystallization from detergent solutions. The method is not difficult, but requires an understanding of lipid phase behavior and practice in handling viscous mesophase materials. Here we demonstrate a simple and efficient way of making LCP and reconstituting a membrane protein in the lipid bilayer of LCP using a syringe mixer, followed by dispensing nanoliter portions of LCP into an assay or crystallization plate, conducting pre-crystallization assays and harvesting crystals from the LCP matrix. These protocols provide a basic guide for approaching in meso crystallization trials; however, as with any crystallization experiment, extensive screening and optimization are required, and a successful outcome is not necessarily guaranteed.

The protocols describe the essential steps for obtaining diffraction quality crystals of a membrane protein starting from reconstitution of the protein in a lipidic cubic phase (LCP), finding initial conditions with LCP-FRAP pre-crystallization assays, setting up LCP crystallization trials and harvesting crystals.

Membrane proteins perform critical functions in living cells related to signal transduction, transport and energy transformations, and, as such, are ...

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

Cellulase enzymes (endoglucanases, cellobiohydrolases, and &beta;-glucosidases) hydrolyze cellulose into component sugars, which in turn can be converted into fuel alcohols1. The potential for enzymatic hydrolysis of cellulosic biomass to provide renewable energy has intensified efforts to engineer cellulases for economical fuel production2. Of particular interest are fungal cellulases3-8, which are already being used industrially for foods and textiles processing.
Identifying active variants among a library of mutant cellulases is critical to the engineering process; active mutants can be further tested for improved properties and/or subjected to additional mutagenesis. Efficient engineering of fungal cellulases has been hampered by a lack of genetic tools for native organisms and by difficulties in expressing the enzymes in heterologous hosts. Recently, Morikawa and coworkers developed a method for expressing in E. coli the catalytic domains of endoglucanases from H. jecorina3,9, an important industrial fungus with the capacity to secrete cellulases in large quantities. Functional E. coli expression has also been reported for cellulases from other fungi, including Macrophomina phaseolina10 and Phanerochaete chrysosporium11-12. 
We present a method for high throughput screening of fungal endoglucanase activity in E. coli. (Fig 1) This method uses the common microbial dye Congo Red (CR) to visualize enzymatic degradation of carboxymethyl cellulose (CMC) by cells growing on solid medium. The activity assay requires inexpensive reagents, minimal manipulation, and gives unambiguous results as zones of degradation (&#x201C;halos&#x201D;) at the colony site. Although a quantitative measure of enzymatic activity cannot be determined by this method, we have found that halo size correlates with total enzymatic activity in the cell. Further characterization of individual positive clones will determine , relative protein fitness. 
Traditional bacterial whole cell CMC/CR activity assays13 involve pouring agar containing CMC onto colonies, which is subject to cross-contamination, or incubating cultures in CMC agar wells, which is less amenable to large-scale experimentation. Here we report an improved protocol that modifies existing wash methods14 for cellulase activity: cells grown on CMC agar plates are removed prior to CR staining. Our protocol significantly reduces cross-contamination and is highly scalable, allowing the rapid screening of thousands of clones. In addition to H. jecorina enzymes, we have expressed and screened endoglucanase variants from the Thermoascus aurantiacus and Penicillium decumbens (shown in Figure 2), suggesting that this protocol is applicable to enzymes from a range of organisms.

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

We describe a low cost, high throughput method to screen for fungal endoglucanase activity in E. coli. The method relies on a simple visual readout of substrate degradation, does not require enzyme purification, and is highly scalable. This allows for the rapid screening of large libraries of enzyme variants.

Cellulase enzymes (endoglucanases, cellobiohydrolases, and &beta;-glucosidases) hydrolyze cellulose into component sugars, which in turn can be converted ...

Use of a Robot for High-throughput Crystallization of Membrane Proteins in Lipidic Mesophases

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through macromolecular X-ray crystallography (MX). An essential ingredient of MX is a steady supply of ideally diffraction-quality crystals. The in meso or lipidic cubic phase (LCP) method for crystallizing membrane proteins is one of several methods available for crystallizing membrane proteins. It makes use of a bicontinuous mesophase in which to grow crystals. As a method, it has had some spectacular successes of late and has attracted much attention with many research groups now interested in using it. One of the challenges associated with the method is that the hosting mesophase is extremely viscous and sticky, reminiscent of a thick toothpaste. Thus, dispensing it manually in a reproducible manner in small volumes into crystallization wells requires skill, patience and a steady hand. A protocol for doing just that was developed in the Membrane Structural &amp; Functional Biology (MS&amp;FB) Group1-3. JoVE video articles describing the method are available1,4. 
The manual approach for setting up in meso trials has distinct advantages with specialty applications, such as crystal optimization and derivatization. It does however suffer from being a low throughput method. Here, we demonstrate a protocol for performing in meso crystallization trials robotically. A robot offers the advantages of speed, accuracy, precision, miniaturization and being able to work continuously for extended periods under what could be regarded as hostile conditions such as in the dark, in a reducing atmosphere or at low or high temperatures. An in meso robot, when used properly, can greatly improve the productivity of membrane protein structure and function research by facilitating crystallization which is one of the slow steps in the overall structure determination pipeline. 
In this video article, we demonstrate the use of three commercially available robots that can dispense the viscous and sticky mesophase integral to in meso crystallogenesis. The first robot was developed in the MS&amp;FB Group5,6. The other two have recently become available and are included here for completeness.	
An overview of the protocol covered in this article is presented in Figure 1. All manipulations were performed at room temperature (~20 &deg;C) under ambient conditions.

Herein is described a robotic approach to high-throughput crystallization of membrane proteins in lipidic mesophases for use in structure determination using macromolecular X-ray crystallography. Three robots capable of handling the viscous and sticky protein-laden mesophase integral to the method are introduced.

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through ...

Intravital Microscopy for Imaging Subcellular Structures in Live Mice Expressing Fluorescent Proteins

Here we describe a procedure to image subcellular structures in live rodents that is based on the use of confocal intravital microscopy. As a model organ, we use the salivary glands of live mice since they provide several advantages. First, they can be easily exposed to enable access to the optics, and stabilized to facilitate the reduction of the motion artifacts due to heartbeat and respiration. This significantly facilitates imaging and tracking small subcellular structures. Second, most of the cell populations of the salivary glands are accessible from the surface of the organ. This permits the use of confocal microscopy that has a higher spatial resolution than other techniques that have been used for in vivo imaging, such as two-photon microscopy. Finally, salivary glands can be easily manipulated pharmacologically and genetically, thus providing a robust system to investigate biological processes at a molecular level.
In this study we focus on a protocol designed to follow the kinetics of the exocytosis of secretory granules in acinar cells and the dynamics of the apical plasma membrane where the secretory granules fuse upon stimulation of the beta-adrenergic receptors. Specifically, we used a transgenic mouse that co-expresses cytosolic GFP and a membrane-targeted peptide fused with the fluorescent protein tandem-Tomato. However, the procedures that we used to stabilize and image the salivary glands can be extended to other mouse models and coupled to other approaches to label in vivo cellular components, enabling the visualization of various subcellular structures, such as endosomes, lysosomes, mitochondria, and the actin cytoskeleton.

Intravital microscopy is a powerful tool that enables imaging various biological processes in live animals. In this article, we present a detailed method for imaging the dynamics of subcellular structures, such as the secretory granules, in the salivary glands of live mice.

Here we describe a procedure to image subcellular structures in live rodents that is based on the use of confocal intravital microscopy. As a model organ, ...

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for expressing proteins and genetic circuits in a controlled manner as well as for providing a prototyping environment for synthetic biology.2,3 To achieve the latter goal, cell-free expression systems that preserve endogenous Escherichia coli transcription-translation mechanisms are able to more accurately reflect in vivo cellular dynamics than those based on T7 RNA polymerase transcription. We describe the preparation and execution of an efficient endogenous E. coli based transcription-translation (TX-TL) cell-free expression system that can produce equivalent amounts of protein as T7-based systems at a 98% cost reduction to similar commercial systems.4,5 The preparation of buffers and crude cell extract are described, as well as the execution of a three tube TX-TL reaction. The entire protocol takes five days to prepare and yields enough material for up to 3000 single reactions in one preparation. Once prepared, each reaction takes under 8 hr from setup to data collection and analysis. Mechanisms of regulation and transcription exogenous to E. coli, such as lac/tet repressors and T7 RNA polymerase, can be supplemented.6 Endogenous properties, such as mRNA and DNA degradation rates, can also be adjusted.7 The TX-TL cell-free expression system has been demonstrated for large-scale circuit assembly, exploring biological phenomena, and expression of proteins under both T7- and endogenous promoters.6,8 Accompanying mathematical models are available.9,10 The resulting system has unique applications in synthetic biology as a prototyping environment, or "TX-TL biomolecular breadboard."

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

This five-day protocol outlines all steps, equipment, and supplemental software necessary for creating and running an efficient endogenous Escherichia coli based TX-TL cell-free expression system from scratch. With reagents, the protocol takes 8 hours or less to setup a reaction, collect, and process data.

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...

High Throughput Quantitative Expression Screening and Purification Applied to Recombinant Disulfide-rich Venom Proteins Produced in E. coli

Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. However, purifying proteins is sometimes challenging since many proteins are expressed in an insoluble form. When working with difficult or multiple targets it is therefore recommended to use high throughput (HTP) protein expression screening on a small scale (1-4&#160;ml cultures) to quickly identify conditions for soluble expression. To cope with the various structural genomics programs of the lab, a quantitative (within a range of 0.1-100 mg/L culture of recombinant protein) and HTP protein expression screening protocol was implemented and validated on thousands of proteins. The protocols were automated with the use of a liquid handling robot but can also be performed manually without specialized equipment.
Disulfide-rich venom proteins are gaining increasing recognition for their potential as therapeutic drug leads. They can be highly potent and selective, but their complex disulfide bond networks make them challenging to produce. As a member of the FP7 European Venomics project (<a href="http://www.venomics.eu">www.venomics.eu</a>), our challenge is to develop successful production strategies with the aim of producing thousands of novel venom proteins for functional characterization. Aided by the redox properties of disulfide bond isomerase DsbC, we adapted our HTP production pipeline for the expression of oxidized, functional venom peptides in the E. coli cytoplasm. The protocols are also applicable to the production of diverse disulfide-rich proteins. Here we demonstrate our pipeline applied to the production of animal venom proteins. With the protocols described herein it is likely that soluble disulfide-rich proteins will be obtained in as little as a week. Even from a small scale, there is the potential to use the purified proteins for validating the oxidation state by mass spectrometry, for characterization in pilot studies, or for sensitive micro-assays.

High Throughput Quantitative Expression Screening and Purification Applied to Recombinant Disulfide-rich Venom Proteins Produced in E. coli

A protocol for the quantitative, high throughput expression screening and analytical purification of fusion proteins from small-scale Escherichia coli cultures is described and applied to the expression of disulfide-rich animal venom protein targets.

Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. ...

Non-chromatographic Purification of Recombinant Elastin-like Polypeptides and their Fusions with Peptides and Proteins from Escherichia coli

Elastin-like polypeptides are repetitive biopolymers that exhibit a lower critical solution temperature phase transition behavior, existing as soluble unimers below a characteristic transition temperature and aggregating into micron-scale coacervates above their transition temperature. The design of elastin-like polypeptides at the genetic level permits precise control of their sequence and length, which dictates their thermal properties. Elastin-like polypeptides are used in a variety of applications including biosensing, tissue engineering, and drug delivery, where the transition temperature and biopolymer architecture of the ELP can be tuned for the specific application of interest. Furthermore, the lower critical solution temperature phase transition behavior of elastin-like polypeptides allows their purification by their thermal response, such that their selective coacervation and resolubilization allows the removal of both soluble and insoluble contaminants following expression in Escherichia coli. This approach can be used for the purification of elastin-like polypeptides alone or as a purification tool for peptide or protein fusions where recombinant peptides or proteins genetically appended to elastin-like polypeptide tags can be purified without chromatography. This protocol describes the purification of elastin-like polypeptides and their peptide or protein fusions and discusses basic characterization techniques to assess the thermal behavior of pure elastin-like polypeptide products.

Non-chromatographic Purification of Recombinant Elastin-like Polypeptides and their Fusions with Peptides and Proteins from Escherichia coli

Elastin-like polypeptides are stimulus-responsive biopolymers with applications ranging from recombinant protein purification to drug delivery. This protocol describes the purification and characterization of elastin-like polypeptides and their peptide or protein fusions from Escherichia coli using their lower critical solution temperature phase transition behavior as a simple alternative to chromatography.

Elastin-like polypeptides are repetitive biopolymers that exhibit a lower critical solution temperature phase transition behavior, existing as soluble ...

The Multifaceted Benefits of Protein Co-expression in Escherichia coli

We report here that the expression of protein complexes in vivo in Escherichia coli can be more convenient than traditional reconstitution experiments in vitro. In particular, we show that the poor solubility of Escherichia coli DNA polymerase III &#949; subunit (featuring 3&#8217;-5&#8217; exonuclease activity) is highly improved when the same protein is co-expressed with the &#945; and &#952; subunits (featuring DNA polymerase activity and stabilizing &#949;, respectively). We also show that protein co-expression in E. coli can be used to efficiently test the competence of subunits from different bacterial species to associate in a functional protein complex. We indeed show that the &#945; subunit of Deinococcus radiodurans DNA polymerase III can be co-expressed in vivo with the &#949; subunit of E. coli. In addition, we report on the use of protein co-expression to modulate mutation frequency in E. coli. By expressing the wild-type &#949; subunit under the control of the araBAD promoter (arabinose-inducible), and co-expressing the mutagenic D12A variant of the same protein, under the control of the lac promoter (inducible by isopropyl-thio-&#946;-D-galactopyranoside, IPTG), we were able to alter the E. coli mutation frequency using appropriate concentrations of the inducers arabinose and IPTG. Finally, we discuss recent advances and future challenges of protein co-expression in E. coli.

The Multifaceted Benefits of Protein Co-expression in Escherichia coli

Protein co-expression is a powerful alternative to the reconstitution in vitro of protein complexes, and is of help in performing biochemical and genetic tests in vivo. Here we report on the use of protein co-expression in Escherichia coli to obtain protein complexes, and to tune the mutation frequency of cells.

We report here that the expression of protein complexes in vivo in Escherichia coli can be more convenient than traditional reconstitution experiments in ...