This work was supported by the NIH grant GM120209 (GS). The authors thank the OSUCCC Genomics Shared Resources Core for their services (CCC Support Grant NCI P30 CA16058).

1. Establishment of Stable HEK293 Cell Lines Expressing Tetracycline-inducible FLAG-tagged Protein of Interest (POI)
<ol>
	<li>Seed HEK293 cells with a stably integrated Flp recombination target (FRT) site at a density of 10 x 104 cells/mL in growth medium (Dulbecco&#39;s modified Eagle&#39;s medium [DMEM] + 10% fetal bovine serum [FBS] + 1% penicillin-streptomycin [penn/strep]) in 6-well plates. Allow cells to grow overnight in a humidified incubator at 37 &#176;C and 5% CO2 (standard growth cond...

<ol>
	<li>Karousis, E. D., Nasif, S., M&#252;hlemann, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonsense-mediated+mRNA+decay:+novel+mechanistic+insights+and+biological+impact.">Nonsense-mediated mRNA decay: novel mechanistic insights and biological impact.</a> Wiley Interdisciplinary Reviews: RNA. 7 (5), 661-682 (2016).</li><li>Ivanov, P. V., Gehring, N. H., Kunz, J. B., Hentze, M. W., Kulozik, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+between+UPF1,+eRFs,+PABP+and+the+exon+junction+complex+suggest+an+integrated+model+for+mammalian+NMD+pathways.">Interactions between UPF1, eRFs, PABP and the exon junction complex suggest an integrated model for mammalian NMD pathways.</a> The EMBO Journal. 27 (5), 736-747 (2008).</li><li>Papasaikas, P., Valc&#225;rcel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Spliceosome:+The+Ultimate+RNA+Chaperone+and+Sculptor.">The Spliceosome: The Ultimate RNA Chaperone and Sculptor.</a> Trends in Biochemical Sciences. 41 (1), 33-45 (2016).</li><li>Jensen, K. B., Darnell, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CLIP:+Crosslinking+and+ImmunoPrecipitation+of+In+Vivo+RNA+Targets+of+RNA-Binding+Proteins.">CLIP: Crosslinking and ImmunoPrecipitation of In Vivo RNA Targets of RNA-Binding Proteins.</a> Methods in Molecular Biology. 488, 85-98 (2008).</li><li>Garzia, A., Morozov, P., Sajek, M., Meyer, C., Tuschl, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PAR-CLIP+for+Discovering+Target+Sites+of+RNA-Binding+Proteins.">PAR-CLIP for Discovering Target Sites of RNA-Binding Proteins.</a> mRNA Decay: Methods and Protocols. 1720, 55-75 (2018).</li><li>Konig, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=iCLIP+-+Transcriptome-wide+Mapping+of+Protein-RNA+Interactions+with+Individual+Nucleotide+Resolution.">iCLIP - Transcriptome-wide Mapping of Protein-RNA Interactions with Individual Nucleotide Resolution.</a> Journal of Visualized Experiments. (50), e2638 (2011).</li><li>Sibley, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Individual+Nucleotide+Resolution+UV+Cross-Linking+and+Immunoprecipitation+(iCLIP)+to+Determine+Protein-RNA+Interactions.">Individual Nucleotide Resolution UV Cross-Linking and Immunoprecipitation (iCLIP) to Determine Protein-RNA Interactions.</a> RNA Detection: Methods and Protocols. 1649, 427-454 (2018).</li><li>Wheeler, E. C., Van Nostrand, E. L., Yeo, G. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+and+challenges+in+the+detection+of+transcriptome&#8208;wide+protein-RNA+interactions.">Advances and challenges in the detection of transcriptome&#8208;wide protein-RNA interactions.</a> Wiley Interdisciplinary Reviews: RNA. 9 (1), (2018).</li><li>Singh, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Cellular+EJC+Interactome+Reveals+Higher-Order+mRNP+Structure+and+an+EJC-SR+Protein+Nexus.">The Cellular EJC Interactome Reveals Higher-Order mRNP Structure and an EJC-SR Protein Nexus.</a> Cell. 151, 750-764 (2012).</li><li>Singh, G., Ricci, E. P., Moore, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIPiT-Seq:+A+high-throughput+approach+for+footprinting+RNA:protein+complexes.">RIPiT-Seq: A high-throughput approach for footprinting RNA:protein complexes.</a> Methods. 65, 320-332 (2014).</li><li>Mabin, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Exon+Junction+Complex+Undergoes+a+Compositional+Switch+that+Alters+mRNP+Structure+and+Nonsense-Mediated+mRNA+Decay+Activity.">The Exon Junction Complex Undergoes a Compositional Switch that Alters mRNP Structure and Nonsense-Mediated mRNA Decay Activity.</a> Cell Reports. 25 (9), 2431-2446 (2018).</li><li>Gehring, N. H., Lamprinaki, S., Kulozik, A. E., Hentze, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disassembly+of+Exon+Junction+Complexes+by+PYM.">Disassembly of Exon Junction Complexes by PYM.</a> Cell. 137 (3), 536-548 (2009).</li><li>Dostie, J., Dreyfuss, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translation+Is+Required+to+Remove+Y14+from+mRNAs+in+the+Cytoplasm.">Translation Is Required to Remove Y14 from mRNAs in the Cytoplasm.</a> Current Biology. 12 (13), 1060-1067 (2002).</li><li>Z&#252;nd, D., Gruber, A. R., Zavolan, M., M&#252;hlemann, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translation-dependent+displacement+of+UPF1+from+coding+sequences+causes+its+enrichment+in+3'+UTRs.">Translation-dependent displacement of UPF1 from coding sequences causes its enrichment in 3' UTRs.</a> Nature Structural &amp; Molecular Biology. 20 (8), 936-943 (2013).</li><li>Gangras, P., Dayeh, D. M., Mabin, J. W., Nakanishi, K., Singh, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+Identification+of+Recombinant+Argonaute-Bound+Small+RNAs+Using+Next-Generation+Sequencing.">Cloning and Identification of Recombinant Argonaute-Bound Small RNAs Using Next-Generation Sequencing.</a> Argonaute Proteins: Methods and Protocols. 1680, 1-28 (2018).</li><li>Heyer, E. E., Ozadam, H., Ricci, E. P., Cenik, C., Moore, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+optimized+kit-free+method+for+making+strand-specific+deep+sequencing+libraries+from+RNA+fragments.">An optimized kit-free method for making strand-specific deep sequencing libraries from RNA fragments.</a> Nucleic Acids Research. 43 (1), 2 (2015).</li><li>Cameron, V., Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3'-Phosphatase+activity+in+T4+polynucleotide+kinase.">3'-Phosphatase activity in T4 polynucleotide kinase.</a> Biochemistry. 16 (23), 5120-5126 (1977).</li><li>Ricci, E. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Staufen1+senses+overall+transcript+secondary+structure+to+regulate+translation.">Staufen1 senses overall transcript secondary structure to regulate translation.</a> Nature Structural &amp; Molecular Biology. 21 (1), 26-35 (2014).</li><li>Lackner, D. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+generic+strategy+for+CRISPR-Cas9-mediated+gene+tagging.">A generic strategy for CRISPR-Cas9-mediated gene tagging.</a> Nature Communications. 6, 10237 (2015).</li><li>Metkar, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Higher-Order+Organization+Principles+of+Pre-translational+mRNPs.">Higher-Order Organization Principles of Pre-translational mRNPs.</a> Molecular Cell. 72 (4), 715-726 (2018).</li><li>Giudice, G., S&#225;nchez-Cabo, F., Torroja, C., Lara-Pezzi, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATtRACT-a+database+of+RNA-binding+proteins+and+associated+motifs.">ATtRACT-a database of RNA-binding proteins and associated motifs.</a> Database: The Journal of Biological Databases and Curation. 2016, (2016).</li><li>Paz, I., Kosti, I., Ares, M., Cline, M., Mandel-Gutfreund, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RBPmap:+a+web+server+for+mapping+binding+sites+of+RNA-binding+proteins.">RBPmap: a web server for mapping binding sites of RNA-binding proteins.</a> Nucleic Acids Research. 42, 361-367 (2014).</li><li>Sundararaman, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resources+for+the+Comprehensive+Discovery+of+Functional+RNA+Elements.">Resources for the Comprehensive Discovery of Functional RNA Elements.</a> Molecular Cell. 61 (6), 903-913 (2016).</li></ol>

The authors have nothing to disclose.

We discuss here some key considerations to successfully perform RIPiT. Foremost, individual IPs must be optimized to achieve highest possible efficiency at each step. The amount of FLAG agarose beads for the input number of cells described here has proven to be robust for a wide range of proteins we have tested. As only a small fraction of partner proteins is co-immunoprecipitated with the FLAG protein, the amount of antibody needed for efficient second IP is usually low (less than 10 &#181;g). Small-scale RIPiT (from on...

Within cells, RNA exists in complex with proteins to form RNA:protein complexes (RNPs). RNPs are assembled around RNA binding proteins (RBPs, those that directly bind RNA) but also comprise of non-RBPs (those that bind RBPs but not RNA), and are often dynamic in nature. RBPs and their cofactors function collectively within RNPs to execute regulatory functions. For example, in the nonsense-mediated mRNA decay (NMD) pathway, the UPF proteins (UPF1, UPF2, and UPF3b) recognize the prematurely terminated ribosome. Each of the UPF proteins can bind to RNA, but it is only when they assemble together that an active NMD complex begins to form. Within this complex, UPF1 is further activated by phosphorylation by a non-RBP SMG1, and such UPF1 activation eventually leads to recruitment of mRNA decay inducing factors1,2. In this example, RBPs require non-RBP cofactors for recruitment and activation of the RNP complex that triggers NMD. Yet another property of RNPs is their compositional heterogeneity. Consider the spliceosome, which exists in distinct E, A, B or C complexes. Different spliceosome complexes have overlapping and distinct proteins3. To study RNP functions, it is important to elucidate which RNAs are bound by an RBP and its associated proteins. Many methods exist to accomplish this, with each approach having its distinct advantages and disadvantages4,5,6,7.
The widely popular methods to identify RBP binding sites &#8212; crosslinking followed by immunoprecipitation (CLIP) and its various variations -&#160;rely on ultraviolet (UV) light to crosslink an RBP to RNA8. However, this is not an effective approach for non-RBPs within RNPs, which do not contact the RNA directly. Here, we describe an alternative approach that is applicable to RBPs and non-RBPs alike, to isolate and identify their RNA binding sites. This approach termed RNA immunoprecipitation in tandem (RIPiT) consists of two immunoprecipitation steps, which help achieve higher specificity as compared to a single purification (Figure 1)9,10. As the individual immunoprecipitation (IP) steps can be carried out at a lower stringency as compared to CLIP, RIPiT does not depend on availability of antibodies that can withstand presence of strong detergents during immunoprecipitation. The most unique advantage of RIPiT is the ability to target two different proteins in two purification steps; this provides a powerful way to enrich a compositionally distinct RNP complex from other similar complexes11.
Small variations to the RIPiT procedure can further enhance RNP enrichment. For instance, some RNA-protein or protein-protein interactions within RNPs are transient and it may be difficult to efficiently purify footprints of such complexes. To stabilize such interactions, RNPs can be crosslinked within cells with formaldehyde prior to cell lysis and RIPiT. For example, we have observed that a weak interaction between the exon junction complex (EJC) core factor, EIF4AIII and the EJC disassembly factor, PYM12&#160;can be stabilized with formaldehyde treatment such that more RNA footprints are enriched (data not shown). Prior to cell harvesting and RIPiT, cells can also be treated with drugs to stabilize or enrich RNPs in a particular state. For example, when studying proteins that are removed from mRNA during translation (e.g., the EJC13, UPF114), treatment with translation inhibitors such as puromycin, cycloheximide or harringtonine can lead to increased occupancy of proteins on RNAs.
The amount of RNA recovered from RIPiT is usually low (0.5-10 pmoles, i.e., 10-250 ng RNA considering an average RNA length of 75 nt). The primary reason for this is that only a small fraction of a given protein is present in complex with other proteins within RNPs (any &#34;free&#34;&#160;protein IP&#39;ed in the first step is lost during the second IP). To generate RNA-Seq libraries from this RNA, we also outline here an adaptation of previously published protocol suitable for such low RNA inputs15,16&#160;(Figure 2), which yields high-throughput sequencing ready samples in 3 days.

<table border="0" cellpadding="0" cellspacing="0" style="width:1167px;" width="1166">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Anti-FLAG Affinity Gel</td>
			<td style="width:112px;">Sigma</td>
			<td style="width:101px;">A2220</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">ATP, [&#947;-32P]- 3000Ci/mmol 10mCi/ml EasyTide, 250&#181;Ci</td>
			<td style="width:112px;">PerkinElmer</td>
			<td style="width:101px;">BLU502A250UC</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">BD Disposable Syringes with Luer-Lok Tips (200)</td>
			<td style="width:112px;">Fisher</td>
			<td>14-823-435</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Betaine 5M</td>
			<td style="width:112px;">Sigma</td>
			<td style="width:101px;">B0300</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">biotin-dATP</td>
			<td style="width:112px;">TriLink</td>
			<td style="width:101px;">N-5002</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">biotin-dCTP</td>
			<td style="width:112px;">Perkin Elmer</td>
			<td style="width:101px;">NEL540001EA</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Branson Sonifier, Model SSE-1</td>
			<td style="width:112px;">Branson</td>
			<td style="width:101px;"></td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">CircLigase I</td>
			<td style="width:112px;">VWR</td>
			<td style="width:101px;">76081-606</td>
			<td style="width:591px;">ssDNA ligase I</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">DMEM, High Glucose</td>
			<td style="width:112px;">ThermoFisher</td>
			<td style="width:101px;">11995-065</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">DNA load buffer NEB</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;"></td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Dynabeads Protein A</td>
			<td style="width:112px;">LifeTech</td>
			<td style="width:101px;">10002D</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Flp-In-T-REx 293 Cell Line</td>
			<td style="width:112px;">ThermoFisher</td>
			<td style="width:101px;">R78007</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">GeneRuler Low Range DNA Ladder</td>
			<td style="width:112px;">ThermoScientific</td>
			<td style="width:101px;">FERSM1203</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Hygromycin B</td>
			<td style="width:112px;">ThermoFisher</td>
			<td align="right" style="width:101px;">10687010</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Mini-PROTEAN TBE Gel 10 well</td>
			<td style="width:112px;">Bio-Rad</td>
			<td align="right" style="width:101px;">4565013</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">Mini-PROTEAN TBE-Urea Gel</td>
			<td style="width:112px;">Bio-Rad</td>
			<td align="right" style="width:101px;">4566033</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">miRCAT-33 adapter 5&#8242;-TGGAATTCTCGGGTGCCAAGGddC-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Mirus transIT-X2 transfection reagent</td>
			<td style="width:112px;">Mirus</td>
			<td style="width:101px;">MIR 6004</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Mth RNA ligase</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">E2610S</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PE1.0 5&#8242;-AATGATACGGCGACCACCGAGATCTACACT 
			CTTTCCCTACACGACGCTCTTCCGATC*T-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PE2.0 5&#8242;-CAAGCAGAAGACGGCATACGAGATCGGTCTC 
			GGCATTCCTGCTGAACCGCTCTTCCGATC*T-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">Phenol/Chloroform/Isoamyl Alcohol (25:24:1, pH 6.7, 100ml)</td>
			<td style="width:112px;">Fisher</td>
			<td style="width:101px;">BP1752I-100</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Purple Gel Loading Dye (6x)</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">NEB #7025</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Q5 DNA Polymerase</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">M0491S/L</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:363px;">RNase I, E. coli, 1000 units</td>
			<td style="width:112px;">Eppicenter</td>
			<td style="width:101px;">N6901K</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">SPIN-X column</td>
			<td style="width:112px;">Corning</td>
			<td style="width:101px;">CLS8160-24EA</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">Streptavidin beads</td>
			<td style="width:112px;">ThermoFisher</td>
			<td style="width:101px;">60210</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">Superscript III (SSIII)</td>
			<td style="width:112px;">ThermoScientific</td>
			<td align="right" style="width:101px;">18080044</td>
			<td style="width:591px;">reverse transcriptase enzyme</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">SybrGold</td>
			<td style="width:112px;">ThermoFisher</td>
			<td style="width:101px;">S11494</td>
			<td style="width:591px;">gold nucleic acid gel stain</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:363px;">T4 Polynucleotide Kinase-2500U</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">M0201L</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">T4RNL2 Tr. K227Q</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">M0351S</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Tetracycline</td>
			<td style="width:112px;">Sigma</td>
			<td align="right" style="width:101px;">87128</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Thermostable 5&#180; App DNA/RNA Ligase</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">M0319S</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE1 5&#8242;-pGGCACTANNNNNAGATCGGAAGA 
			GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE10 5&#8242;-pGGTGTTCNNNNNAGATCGGAAG 
			AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT 
			CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE11 5&#8242;-pGGTAAGTNNNNNAGATCGGAA 
			GAGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE12 5&#8242;-pGGAGATGNNNNNAGATCGGAAGA 
			GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE2 5&#8242;-pGGGTAGCNNNNNAGATCGGAAGAG 
			CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT 
			CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE35&#8242;-pGGTCGATNNNNNAGATCGGAAG 
			AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT 
			CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE4 5&#8242;-pGGCCTCGNNNNNAGATCGGAAGA 
			GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE5 5&#8242;-pGGTGACANNNNNAGATCGGAAGA 
			GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE6 5&#8242;-pGGTAGACNNNNNAGATCGGAAGAG 
			CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTTC 
			CGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE7 5&#8242;-pGGGCCCTNNNNNAGATCGGAAG 
			AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCT 
			TCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE8 5&#8242;-pGGATCGGNNNNNAGATCGGAAGAG 
			CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTT 
			CCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE9 5&#8242;-pGGACTGANNNNNAGATCGGAAGAG 
			CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTTC 
			CGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">Typhoon 5 Bimolecular Imager</td>
			<td style="width:112px;">GE Healthcare Life Science</td>
			<td align="right" style="width:101px;">29187191</td>
			<td style="width:591px;"></td>
		</tr>
	</tbody>
</table>

identification of footprints of rna:protein complexes via rna immunoprecipitation in tandem followed by sequencing (ripit-seq)

RNA immunoprecipitation in tandem (RIPiT) is a method for enriching RNA footprints of a pair of proteins within an RNA:protein (RNP) complex. RIPiT employs two purification steps. First, immunoprecipitation of a tagged RNP subunit is followed by mild RNase digestion and subsequent non-denaturing affinity elution. A second immunoprecipitation of another RNP subunit allows for enrichment of a defined complex. Following a denaturing elution of RNAs and proteins, the RNA footprints are converted into high-throughput DNA sequencing libraries. Unlike the more popular ultraviolet (UV) crosslinking followed by immunoprecipitation (CLIP) approach to enrich RBP binding sites, RIPiT is UV-crosslinking independent. Hence RIPiT can be applied to numerous proteins present in the RNA interactome and beyond that are essential to RNA regulation but do not directly contact the RNA or UV-crosslink poorly to RNA. The two purification steps in RIPiT provide an additional advantage of identifying binding sites where a protein of interest acts in partnership with another cofactor. The double purification strategy also serves to enhance signal by limiting background. Here, we provide a step-wise procedure to perform RIPiT and to generate high-throughput sequencing libraries from isolated RNA footprints. We also outline RIPiT&#39;s advantages and applications and discuss some of its limitations.

A successful RIPiT will result in the immunoprecipitation of both proteins of interest and other known interacting proteins, and the absence of non-interacting proteins. As seen in Figure 3A, both Magoh and EIF4AIII were detected in the RIPiT elution, but HNRNPA1 was not (lane 6). In parallel, RNA footprints that have co-purified with the RNP complexes was detected via autoradiography (Figure 3B) or bioanalyzer (<strong class="x...

Watch this Scientific Journal Video about Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing RIPiT-Seq at JoVE.com

Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing RIPiT-Seq

Here, we present a protocol to enrich endogenous RNA binding sites or &#34;footprints&#34;&#160;of RNA:protein (RNP) complexes from mammalian cells. This approach involves two immunoprecipitations of RNP subunits and is therefore dubbed RNA immunoprecipitation in tandem (RIPiT).

Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing (RIPiT-Seq)

RNA immunoprecipitation in tandem (RIPiT) is a method for enriching RNA footprints of a pair of proteins within an RNA:protein (RNP) complex. RIPiT ...

RNA immunoprecipitation in tandem followed by sequencing, or RIPiT-Seq, is a method for identifying what regions of RNA are bound by a particular pair of RNA binding proteins. The most unique advantage of RIPiT is its ability to target two different proteins in two purifications. This provides a powerful way to enrich for a compositionally distinct RNA protein complex from other complexes.Also, RIPiT-Seq is UV-crosslinking independent, and can be applied to many proteins that act on RNA without directly binding it. While this method does not directly extend towards therapy or diagnosis, RNA binding proteins and RNA processing have been associated with several diseases like neuropathies and cancer. RIPiT-Seq provides a tool for studying functions of disease-linked RNA binding proteins.RIPiT-Seq requires a system where an epitope-tagged protein can be expressed. It has only been tested in HEK293 cells, and is most amenable to cell culture. However, now with our ability to tag proteins using CRISPR, RIPiT-Seq can be applicable to diverse modern systems.The success of RIPiT depends upon two efficient immunoprecipitations, so it will be critical to optimize immunoprecipitation conditions for the antibody being used. Also, working with RNA requires proper precautions, so RNase-free reagents should be used during and after RNA extraction. Demonstrating the procedure will be Lauren Woodward, a graduate student in my lab.Start by washing monolayer cells gently with 15 milliliters of chilled PBS per 15 centimeter plate. Then scrape off cells into 30 milliliters of PBS and collect them in a 50 milliliter conical tube. Pellet the cells by centrifuging at 400 g for 10 minutes at 4 degrees Celsius, and discard the supernatant.Add four milliliters of ice cold hypotonic lysis buffer and use a P1000 pipette to re-suspend the cells. Transfer the lysate to a five milliliter tube and incubate on ice for 10 minutes. Place the lysate in an ice bath and sonicate according to manuscript directions.Then add 108 microliters of five molar sodium chloride to adjust the salt concentration to 150 millimolar. Then, centrifuge the lysate at 12, 000 g for 10 minutes at four degrees Celsius, and collect 20 microliters of the supernatant for western blot analysis. Pre-wash FLAG agarose beads according to manuscript directions and apply remaining supernatant to 750 microliters of beads in a five milliliter tube.Incubate the FLAG agarose beads with the cell extract for one to three hours at four degrees Celsius with gentle mixing. After incubation, pellet the beads by centrifugation at 400 g for one minute at four degrees Celsius, and collect 20 microliters of the supernatant for western blot analysis. Discard the remaining supernatant and wash the beads by resuspending them in four milliliters of iso wash buffer.Pellet the beads again and remove the supernatant. Dilute RNase I in 750 microliters of iso wash buffer according to manuscript directions, and add it to the FLAG agarose beads. Incubate the mixture at four degrees Celsius with gentle mixing, and then pellet the beads by centrifugation.Collect 20 microliters of supernatant for western blot analysis, and discard the rest. Then, wash the beads with iso wash buffer as previously described. Next, perform affinity elution by adding 375 microliters of elution buffer to the beads, and shaking the mixture gently at four degrees Celsius for one to two hours.After incubation, pellet the beads and collect a 15 microliter aliquot of the elution for western blot analysis. While affinity elution is underway, perform magnetic bead antibody conjugation. Begin by washing 50 microliters of magnetic beads in one milliliter of iso wash buffer.Resuspend the beads in 100 microliters of conjugation buffer and add the appropriate amount of antibody. Then, incubate the beads for at least 10 minutes at room temperature. Wash the magnetic beads twice with conjugation buffer and resuspend the beads in 375 microliters of RIPiT dilution buffer.Store the beads on ice until immunoprecipitation. Apply the FLAG affinity elution to the antibody-coupled magnetic beads and incubate with gentle mixing for one to two hours at four degrees Celsius. Capture the magnetic beads with a magnet and collect 15 microliters of supernatant for western blot analysis.Then, wash the beads seven times with iso wash buffer. Proceed with denaturing elution by resuspending magnetic beads in 100 microliters of clear sample buffer and incubating the suspension on ice for 10 minutes. During incubation, periodically flick the beads to resuspend them.Capture the magnetic beads on a magnet and collect 15 microliters of elution for western blot analysis. Transfer the remaining elution to a new 1.5 milliliter tube. To extract the RNA, add 320 microliters of RNase-free water and 400 microliters of phenol-chloroform isoamyl alcohol to the RIPiT elution.Vortex the mixture and then centrifuge it at 12, 000 g for five minutes. Collect 350 microliters of the aqueous phase into a separate tube. Add sodium acetate, magnesium chloride, glycogen, and ethanol to the collected sample and incubate the mixture overnight at negative 20 degrees Celsius.On the next day, pellet the RNA by centrifugation at 12, 000 g for 30 minutes at four degrees Celsius and wash it in 70%ethanol. After the ethanol wash, treat the RNA with T4 polynucleotide kinase, or PNK, without any ATP, and perform phenol-chloroform purification according to manuscript directions. Resuspend the clean RNA in 4.5 microliters of RNase-free water.To quantify RNA yield, radiolabel the RNA with PNK and 32P labeled ATPs according to manuscript directions. Use a low range DNA ladder and a 20 to 40 nucleotide synthetic oligo for size and quantity standards. Resolve the labeled RNA on a 26%urea-polyacrylamide gel.Dry the gel according to the manuscript directions and expose the gel to a phosphoscreen until adequate signal is detected. This technique has been used to investigate the interactions of the exon junction complex or EJC. Western blot analysis of proteins purified from each major step in the RIPiT procedure show that purified EJC contains both EIF4A3 and MAGOH.The negative control, HNRNPA1, is not detected in the elution. The strength of the RNA footprint signal correlates with the amount of RNA protein interaction. A stronger footprint is observed when RIPiT was performed on cells treated with puromycin, which increases EJC occupancy on RNA.To ensure that the RIPiT has been effective, it's important to test the efficiency of the IP by western blot. It's also important to assess the amount and the quality of the RNA prior to proceeding with deep sequencing. In 2018, the Singh lab successfully used this technique to purify two compositionally distinct variations of the exon junction complex and identify RNA binding patterns.If researchers choose to detect RNA footprints with autoradiography, all proper radiation safety procedures and protocols should be followed.

identification-footprints-rnaprotein-complexes-via-rna

Research

JoVE Journal

Genetics

10.2K vues.  The Ohio State University. L’immunoprécipitation de l’ARN en tandem suivie du séquençage, ou RIPiT-Seq, est une méthode pour identifier quelles régions de l’ARN sont liées par une paire particulière de protéines liant l’ARN. L’avantage le plus unique de RIPiT est sa capacité à cibler deux protéines différentes en deux purifications. Cela fournit un moyen puissant d’enrichir pour un complexe de protéines ARN distincte sur le plan de la composition d’autres complexes.En outre, RIPiT-Seq ...