Name: studying dna looping by single-molecule fret
Uploaded: 2014-06-28T15:00:00.000+00:00
Duration: 11 min 27 s
Description: Watch this Scientific Journal Video about Studying DNA Looping by Single-Molecule FRET at JoVE.com

אנו מודים לג&#39;יימס ווטרס, גייבל Wadsworth ובי Broadwater לקריאה ביקורתי של כתב היד. אנו מודים גם לארבעה מבקרים האנונימיים על מתן הערות מועילות. אנו מכירים תמיכה כספית מהמכון הטכנולוגי של ג&#39;ורג&#39;יה, פרס הקריירה בורוז Wellcome הקרן בממשק המדעי, ומענק רשת מחקר הסטודנט מNSF הפיזיקה של מערכות חיים.

1. לדוגמא הכנה dsDNA <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> עיצוב DNAs מעוקל ברחבי העולם על ידי חזרה על רצף 10-Mer. לדוגמא, 5&#39;-GTGCCAGCAACAGATAGC - (TTTATCATCCTTTATCATCC X) 7 - TTTCATTCGAGCTCGTTGTTG-3 &quot;הוא ה-DNA 186-bp מעוקלת כאשר X הוא בסיס נוסף אקראי ורצף איגוף רצף 10-mer החוזר הם רצפי מתאם. הערה:. בדוגמא זו שני 10 מרס עם העדפות הפוכות להיווצרות הנוקלאוזום מבוססות על מחקר תפוסת הנוקלאוזום בקנה מידה גדולה על ידי קפלן ואח&#39; 15 נבחרו. מאז חוזר הסליל של dsDNA הוא קרוב ל10 נ&quot;ב, כל סטיה נקי של ציר הסליל של 10-mer תצטבר לייצר צורה כמו קשת עגולה (איור 3 א). מאחר שתקופת הסליל היא קרובה יותר ל10.5 נ&quot;ב, בסיס נוסף מוכנס אחרי כל שתי חזרות כדי לשמור על המבנה המעוגל כמישוריים ככל האפשר. ניתן להזמין ברצפים אלה קצרים יותר מאשר 200 נ&quot;ב מcompanieים ששירות סינתזת גן ההצעה. זה נוח לאגף רצפים אלה עם רצפי מתאם משותפים לשלבים הבאים. הליך schematized באיור 3. </li><li style=";text-align:right;direction:rtl"> לבצע PCR עם 1 פריימר (GTGCCAGCAACAGATAGC) ופריימר 2 (/ 5Cy3/TAAATTCCTACAACAACGAGCTCGAATG). הערה: פריימר 2 מתויג עם Cy3 תורם סריג בסוף &quot;5. מתכון PCR טיפוסי ופרוטוקול רכיבה על אופניים מוצגים בלוחות 1 ו -2. </li><li style=";text-align:right;direction:rtl"> לבצע PCR עם פריימר 3 (/ 5BioTEG/GAAACATAG/iCy5/GAATTTACCGTGCCAGCAACAGATAGC) ו -4 פריימר (CAACAACGAGCTCGAATG). הערה: פריימר 3 מתויג עם Cy5 acceptor סריג דרך עמוד השדרה וביוטין-מקשר בסוף &quot;5. מתכון PCR ופרוטוקול רכיבה על אופניים הם כאמור לעיל. </li><li style=";text-align:right;direction:rtl"> לטהר את מוצרי ה-PCR באמצעות ערכת ניקוי ה-PCR. </li><li style=";text-align:right;direction:rtl"> מערבבים את המוצר שכותרתו Cy3 ומוצר שכותרתו Cy5 בחיץ להחלפת גדיל (100 mM NaCl, 10 מ&quot;מ טריס-HCl pH 7.0, 1 mM EDTA) בריכוזים סופיים של 0.4 &amp;181 #; M ו0.1 מיקרומטר, בהתאמה. הערה: Cy3-DNA העודף מגביר את הריכוז של דופלקס ביצוע שני Cy3 וCy5 כתוצאה מחילופי גדיל. </li><li style=";text-align:right;direction:rtl"> קווצות שערי על ידי דוגרים על 98.5 מעלות צלזיוס למשך 2 דקות, קירור בהדרגה עד 5 מעלות צלזיוס עם שיעור רמפה של 0.1 ° C / sec, ודוגר על 5 &#160; ° C למשך 2 שעות. </li></ol> 2. ג&#39;ל אלקטרופורזה לזיהוי dsDNA עקמומיות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> יוצקים את הג&#39;ל polyacrylamide 16,17 על ידי ערבוב acrylamide ופתרונות bis-acrylamide ב29.2:0.8 יחס, 5% (w / v) במאגר 1X טריס / Borate / EDTA (TBE) ב-pH 8.0. הערה: 10 מיליליטר של תמיסת ג&#39;ל מכיל: 1.217 acrylamide מיליליטר 40%, 0.667 מיליליטר 2% bis-acrylamide, 1 מיליליטר TBE 10X, 100 persulfate אמוניום L (APS) 10%, 10 L TEMED, וכל השאר הוא DH 2 O. התמצקות מלאה של הג&#39;ל לוקחת בערך 30 דקות. </li><li style=";text-align:right;direction:rtl"> טען את ג&#39;ל polyacrylamide עם דגימות DNA וסולם ה-DNA בחיץ טעינת 1X (5% גליצרול, 0.03% (w / v bl bromophenol)UE) ולהפעיל את הג&#39;ל על 5-8 V / סנטימטר ב-C ° 4 דקות 45 או עד שצבען הקדמי מתקרב לסוף של הג&#39;ל. </li><li style=";text-align:right;direction:rtl"> כתם ג&#39;ל באמצעות חיץ 1X TBE המכיל 0.5 גר &#39;/ מיליליטר ethidium ברומיד ל30 דקות. זהה את להקות ה-DNA תחת תאורת UV. שקלו את עמדות להקה עם סמן הגודל (100 סולם DNA נ&quot;ב) כדי לחשב את הגדלים, לכאורה, של מולקולות ה-DNA. הערה: DNAs המעוקל בדרך כלל איטי יותר מאשר להעביר DNAs הישר. </li></ol> 3. זרימת הכנת תא <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מקדחה 6-7 זוגות של חורים בשני קצוות מנוגדים של שקופיות זכוכית (3&#39;&#39; x 1&#39;&#39;) באמצעות מקדחה ומקדחי יהלום. לאחר קידוח, לשפשף את השקופית במים זורמים כדי להסיר אבקת זכוכית גלויה. הערה: החורים משמשים כפתחי כניסת זלוף ושקעים. במהלך קידוח, קירור השקופית עם מים חשוב כדי למנוע פיצוח. </li><li style=";text-align:right;direction:rtl"> מניחים את השקופיות זקופות בצנצנת זכוכית ולמלא אותו במים. Sonicate במשך 15 דקות ולהעביר אותם לעוד דה צנצנת זכוכיתdicated לניקוי אצטון. מלא אותו עם אצטון sonicate במשך 15 דקות. יש לשטוף את השקופיות עם אתנול באמצעות בקבוק תרסיס ולאחר מכן עם מים. למקם אותם בצנצנת פוליפרופילן, למלא אותו עם 5 הידרוקסיד M אשלגן, sonicate במשך 15 דקות. לבסוף, sonicate השקופיות במים במשך 15 דקות. נקה את coverslips (מס &#39;1, 24 x 40 מ&quot;מ) משתמש באותו פרוטוקול. הערה: שקופיות וcoverslips ניקה יכולים להיות מאוחסנים ב DH 2 O לשימוש לטווח ארוך. </li><li style=";text-align:right;direction:rtl"> מערבבים 1 מ&quot;ג של ביוטין-PEG-silane (MW 3400) עם 80 מ&quot;ג של MPEG-silane (MW 2000) ב340 L של 0.1 פתרון ביקרבונט M נתרן. מערבבים היטב וצנטריפוגות התערובת בקצרה להיפטר מבועות. הערה: functionalization של פני השטח עם פוליאתילן גליקול (PEG) מסייע להפחית ספציפי מחייב של הדנ&quot;א אל פני השטח. </li><li style=";text-align:right;direction:rtl"> שים 80 L של פתרון PEG בכל שקופית ועדינות להוריד את coverslip על זה. חכה 45 דקות. הפרד את coverslip מהשקופית עם פינצטה, לשטוף אותם עם כמות העצומה של DH 2 O ולתת tיבש מכפלת באוויר פתוח. </li><li style=";text-align:right;direction:rtl"> מניחים רצועות דקות של קלטת דו מקל על פני השקופית כדי ליצור ערוצים. יישר coverslip על זה ולחץ בחוזקה נגד coverslip לשקופית כדי ליצור ערוצים נוזל הדוקה. השתמש אפוקסי 5 דקות כדי לאטום את הקצוות של הערוצים. </li></ol> 4. הכנת Trolox הפתרון <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> שים ~ 30 מ&quot;ג Trolox ו10 מיליליטר DH 2 O בבקבוק ולהשתמש בבר ומערבב מגנט לעורר את הפתרון באוויר פתוח במשך 18 שעה. </li><li style=";text-align:right;direction:rtl"> סנן את הפתרון באמצעות מסנן 0.2 מיקרומטר ולהתאים את ה-pH ל 7 על ידי הוספה ~ 6 μl של 1 בסיס M טריס (pH 11). הערה: Trolox הוא מגיב אנטי מהבהב המשמש בדרך כלל במולקולה בודדת לומד 18. פעולת antifading של Trolox מגיעה מנגזרת חמצון שלה, אשר נמצא בפתרון Trolox המושפל באופן חלקי 19. מהירות המסת Trolox במתנול או פתרון ה-pH טריס גבוה יש להימנע בגלל חמצון יעיל. </li></ol> 5. Single-molהדמיה ecule <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הזרק 15 μl של פתרון NeutrAvidin (0.5 מ&quot;ג / מיליליטר) לתוך הערוץ ולחכות 2 דקות לפני השטיפה עם של חיץ T50 100 μl (10 מ&quot;מ טריס-HCl, 50 mM NaCl, pH 7.0). </li><li style=";text-align:right;direction:rtl"> הזרק 50 μl של דגימת DNA (50-100 PM) לתוך התעלה. מתן 5 דקות ולשטוף את ה-DNA מאוגד משם עם של חיץ T50 100 L. הערה: מולקולות דנ&quot;א ספציפיות תהיה לאגד את פני השטח באמצעות האינטראקציה NeutrAvidin-ביוטין. </li><li style=";text-align:right;direction:rtl"> מלא ערוץ עם חיץ ההדמיה המכיל מערכת הדחה חמצן 20 (100 מ&quot;מ PCD, 5 מ&quot;מ PCA, 1 מ&quot;מ Trolox, ו500 מ&quot;מ NaCl). </li><li style=";text-align:right;direction:rtl"> הגדר את EMCCD במצב מסגרת העברה להזרים 2 x 2 תמונות זרקת לפח (256 x 256) למחשב ב25 מסגרות לשנייה. </li><li style=";text-align:right;direction:rtl"> שים שמן טבילה במטרת מיקרוסקופ, ולתקן את תא הזרימה על הבמה מיקרוסקופ באמצעות קליפים דגימה. גס להתאים את הפוקוס ע&quot;י הסתכלות בדפוס השתקפות לייזר על הקיר. עדין להתאים את הפוקוס באמצעות התצוגה החיה של im הקרינהגילים על המסך. </li><li style=";text-align:right;direction:rtl"> בגין רכישת נתונים עם לייזר 532 ננומטר ב. בדוק את התצוגה החיה ולהתאים את הפוקוס במידת צורך. תפסיק רכישת נתונים כאשר רוב המולקולות photobleached. הערה: במתקן זה, משמשת תכנית C-נכתב מעבדה כדי לשלוט במיקרוסקופ ולהציג תמונות חיות על המסך כפי שהם נשמרים לדיסק הקשיח. </li></ol> 6. עיבוד תמונה וניתוח נתונים הערה: סדרת זמן של 256 x 256 תמונות מעובדות על ידי קוד MATLAB ליצור עקבות זמן מולקולה בודדת של עוצמות Cy3 וCy5. כדי לשייך פיקסלים בין ערוץ התורם וערוץ acceptor של התמונה מפוצלת נוף, 6-7 זוגות של כתמי Cy3 וCy5, כל זוג מאותו המולקולה המפוזרת באופן שווה על פני שדה הראייה, הם הרימו ידני, ושינוי affine מחושב באמצעות הקואורדינטות של נקודות אלה כנקודות עיגון. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> באמצעות תסריט MATLAB, להסתכל דרך כל זמן המולקולה בודדת עקבות tמעברים מרובים מופע כובע בין אותות סריג נמוכים וגבוהים. זהה את מדינות כרך וunlooped. הערה: אות סריג מוגדרת כעוצמת Cy5 (אני), מחולק בסכום של עוצמות Cy3 וCy5 (אני + אני D). יש מדינה בלולאה ערך סריג גבוה תוך מדינת unlooped יש ערך סריג נמוך. היסטוגרמה של אותות סריג ממולקולה בודדת מופצת bimodally בגלל לולאות וunlooping הפיכים. </li><li style=";text-align:right;direction:rtl"> מצא את הסף המפריד בין שתי הפצות על ידי קביעת הצומת שבין שתי עקומות גאוס מצוידים. </li><li style=";text-align:right;direction:rtl"> לחשב את יעילות סריג כמו <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq7.jpg" /> ולהקצות את המדינות בלולאה עם ערכים גבוה סריג ומדינות unlooped עם ערכי סריג נמוכים. </li><li style=";text-align:right;direction:rtl"> באמצעות תסריט MATLAB, לנתח את המספר המצטבר של מולקולות (N (t)) שכרך (אוהגיע למצב סריג הגבוה) בפערי זמן שונים מאז תחילת רכישת נתונים. הערה: מאחר שמולקולת dsDNA יכולה להתחיל בכל קונפורמציה של מדינת unlooped בתחילת רכישת נתונים, שיעור הגידול באוכלוסיית הכרך משקף את שיעור הלולאה הממוצע בממוצע לכל תצורות ראשוניות. לחלץ את k שיעור לולאת לולאה על ידי התאמת N (t) עם פונקציה מעריכית: <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq1.jpg" /> אם עליות biphasically, זה יכול להיות מצויד עם פונקציה כפולה מעריכי: <img fo:content-width="2.2in" src="/files/ftp_upload/51667/eq2.jpg" /> במקרה זה, k לולאה מתקבלת: <img fo:content-width="1.7in" src="/files/ftp_upload/51667/eq3.jpg" /> הערה: באופן תיאורטי, את הסתברות ההישרדות שפולימר לא בלולאה בזמן t היא לא פונקציה מעריכית יחידה או כפולה 12. Fitt מעריכיing משמש כאמצעים מעשיים כדי לחלץ את זמן לולאות הממוצע. </li></ol> 7. קביעת פקטור J הערה: גורם J מייצג איך מרוכז קצה אחד של dsDNA הוא מעבר לקצה השני. זה יכול להיקבע על ידי ביון הריכוז של קטע קצה אחד של ה-DNA שמייצר את אותו קצב התגובה עם מגזר הקצה השני כשיעור לולאות שנמדד. בניסוי, קטע קצה אחד הוא משותק על פני השטח, ומגזר הקצה השני הוא הציג בריכוז ג מסוים. אם שיעור חישול נמדד בין שני הקצוות הוא לחשל k, אז גורם J 21 ניתן על ידי <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq4.jpg" /> . השיעור הקבוע חישול (לחשל k = לחשל k / C) אינו תלוי בריכוז הבדיקה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לזרום 20 μl של אוליגו ביוטין-Cy5 30-50 PM (פריימר 3) in כדי ערוץ מצופה NeutrAvidin. יש לשטוף את הערוץ עם 100 T50 μl לשטוף oligos מאוגד. </li><li style=";text-align:right;direction:rtl"> הכן את חיץ ההדמיה כפי שמתואר בחלק 5 עם התוספת של אוליגו Cy3 (פריימר 2) בריכוז סופי של 50 ננומטר. לזרום חיץ הדמיה זו לתוך התעלה. </li><li style=";text-align:right;direction:rtl"> תוך שמירה על לייזר 532 ננומטר ב, פונה בקצרה לייזר 640 ננומטר למקומות של oligos Cy5 מאוגד משטח לזהות. כבה את לייזר 640 ננומטר ולהתחיל ניטור אות סריג. הערה: עם הכלאה של אוליגו Cy3 לאוליגו Cy5 מאוגד פני השטח, הקרינה Cy5 תנבע מסריג. </li><li style=";text-align:right;direction:rtl"> באמצעות תסריט MATLAB, לנתח את מספר המולקולות שתתחלנה במדינה מאוגדת (עוצמת Cy5 נמוכה), אך מאוחר יותר יהפכו למדינה (בעצימות גבוהה Cy5) annealed כפונקציה של זמן מעקבות עוצמת Cy5. </li><li style=";text-align:right;direction:rtl"> מגרש מספר זה של מולקולות לעומת זמן annealed. להתאים עקומה זו עם פונקציה מעריכית יחידה ( <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq5.jpg"/&gt;) כדי להשיג את שיעור חישול (לחשל k). </li><li style=";text-align:right;direction:rtl"> חזור על הניסוי הזה בריכוזים שונים Cy3 אוליגו (60, 100, ו180 ננומטר) כדי לאשר את הליניאריות בין שיעור חישול והריכוז מגיב. חלץ את שיעור קבוע חישול מסדר השנייה (לחשל k ) מהמדרון. </li><li style=";text-align:right;direction:rtl"> חשב את גורם J מ <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq6.jpg" /> , כאשר k לולאה היא שיעור הלולאות שנמדד באותו מצב החיץ. </li></ol>

<ol>
	<li>Garcia, H. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+consequences+of+tightly+bent+DNA:+The+other+life+of+a+macromolecular+celebrity.">Biological consequences of tightly bent DNA: The other life of a macromolecular celebrity.</a> Biopolymers. 85, 115-130 (2007).</li><li>Wiggins, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+flexibility+of+DNA+on+short+length+scales+probed+by+atomic+force+microscopy.">High flexibility of DNA on short length scales probed by atomic force microscopy.</a> Nature Nanotechnology. 1, (2006).</li><li>Lionberger, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperative+kinking+at+distant+sites+in+mechanically+stressed+DNA.">Cooperative kinking at distant sites in mechanically stressed DNA.</a> Nucleic Acids Research. 41, 6785-6792 (2011).</li><li>Shore, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+flexibility+studied+by+covalent+closure+of+short+fragments+into+circles.">DNA flexibility studied by covalent closure of short fragments into circles.</a> Proc Natl Acad Sci U S A. 78, 4833-4837 (1981).</li><li>Geggier, S., Vologodskii, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+dependence+of+DNA+bending+rigidity.">Sequence dependence of DNA bending rigidity.</a> Proc Nat Acad Sci U S A. 107, 15421-15426 (1992).</li><li>Smith, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+mechanical+measurements+of+the+elasticity+of+single+DNA+molecules+by+using+magnetic+beads.">Direct mechanical measurements of the elasticity of single DNA molecules by using magnetic beads.</a> Science. 258, 1122-1126 (1992).</li><li>Peters, J. P., Maher, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+curvature+and+flexibility+in+vitro+and+in+vivo.">DNA curvature and flexibility in vitro and in vivo.</a> Quarterly Reviews of Biophysics. 43, 23-63 (2010).</li><li>Cloutier, T. E., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+sharp+bending+of+double-stranded+DNA.">Spontaneous sharp bending of double-stranded DNA.</a> Molecular Cell. 14, 355-362 (2004).</li><li>Du, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclization+of+short+DNA+fragments+and+bending+fluctuations+of+the+double+helix.">Cyclization of short DNA fragments and bending fluctuations of the double helix.</a> Proc Natl Acad Sci U S A. 102, 5397-5402 (2005).</li><li>Yuan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T4+DNA+ligase+is+more+than+an+effective+trap+of+cyclized+dsDNA.">T4 DNA ligase is more than an effective trap of cyclized dsDNA.</a> Nucl. Acids Res. 35, 5294-5302 (2007).</li><li>Manzo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+nonspecific+binding+of+lambda+repressor+on+DNA+looping+dynamics.">The effect of nonspecific binding of lambda repressor on DNA looping dynamics.</a> Biophysical Journal. 103, 1753-1761 (2012).</li><li>Le, T. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+shape-dependent+looping+probability+of+DNA.">Measuring shape-dependent looping probability of DNA.</a> Biophys. J. 104, 2068-2076 (2013).</li><li>Vafabakhsh, R., Ha, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extreme+bendability+of+DNA+less+than+100+base+pairs+long+revealed+by+single-molecule+cyclization.">Extreme bendability of DNA less than 100 base pairs long revealed by single-molecule cyclization.</a> Science. 337, 1097-1101 (2012).</li><li>Friedman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viewing+dynamic+assembly+of+molecular+complexes+by+multi-wavelength+single-molecule+fluorescence.">Viewing dynamic assembly of molecular complexes by multi-wavelength single-molecule fluorescence.</a> Biophysical Journal. 91, 1023-1031 (2006).</li><li>Kaplan, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA-encoded+nucleosome+organization+of+a+eukaryotic+genome.">The DNA-encoded nucleosome organization of a eukaryotic genome.</a> Nature. 458, 362-366 (2009).</li><li>Koo, H. S., Crothers, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+of+DNA+curvature+and+a+unified+description+of+sequence-directed+bending.">Calibration of DNA curvature and a unified description of sequence-directed bending.</a> Proc Nat Acad Sci U S A. 85, 1763-1767 (1988).</li><li>Prosseda, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+temperature-induced+narrow+DNA+curvature+range+sustains+the+maximum+activity+of+a+bacterial+promoter+in+vitro.">A temperature-induced narrow DNA curvature range sustains the maximum activity of a bacterial promoter in vitro.</a> Biochemistry. 49, 2778-2785 (2010).</li><li>Rasnik, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonblinking+and+long-lasting+single-molecule+fluorescence+imaging.">Nonblinking and long-lasting single-molecule fluorescence imaging.</a> Nature Methods. 3, 891-893 (2006).</li><li>Cordes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+mechanism+of+Trolox+as+antiblinking+and+antibleaching+reagent.">On the mechanism of Trolox as antiblinking and antibleaching reagent.</a> J. Am. Chem. Soc. 131, 5018-5019 (2009).</li><li>Aitken, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+oxygen+scavenging+system+for+improvement+of+dye+stability+in+single-molecule+fluorescence+experiments.">An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments.</a> Biophys J. 94, 1826-1835 (2008).</li><li>Taylor, W. H., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+method+of+phage+T4+DNA+ligase-catalyzed+ring-closure+to+the+study+of+DNA+structure:+II.+NaCl-dependence+of+DNA+flexibility+and+helical+repeat.">Application of the method of phage T4 DNA ligase-catalyzed ring-closure to the study of DNA structure: II. NaCl-dependence of DNA flexibility and helical repeat.</a> Journal of Molecular Biology. 212, 363-376 (1990).</li><li>Bolshoy, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Curved+DNA+without+A-A:+experimental+estimation+of+all+16+DNA+wedge+angles.">Curved DNA without A-A: experimental estimation of all 16 DNA wedge angles.</a> Proc Natl Acad Sci U S A. 88, 2312-2316 (1991).</li><li>Gibson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+DNA+fragments+in+yeast+by+one-step+assembly+of+overlapping+oligonucleotides.">Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides.</a> Nucl. Acids Res. 37, 6984-6990 (2009).</li><li>Vologodskii, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bending+of+short+DNA+helices.">Bending of short DNA helices.</a> Artif DNA PNA XNA. 4, (2013).</li><li>Hoover, D. M., Lubkowski, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAWorks:+an+automated+method+for+designing+oligonucleotides+for+PCR-based+gene+synthesis.">DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis.</a> Nucl. Acids Res. 30, (2002).</li><li>Waters, J. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Equilibrium+Statistics+of+a+Surface-Pinned+Semiflexible+Polymer.">Equilibrium Statistics of a Surface-Pinned Semiflexible Polymer.</a> Macromolecules. 46, 6659-6666 (2013).</li><li>Mills, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+evidence+that+single-stranded+regions+of+1+or+more+nucleotides+dramatically+increase+the+flexibility+of+DNA.">Electrophoretic evidence that single-stranded regions of 1 or more nucleotides dramatically increase the flexibility of DNA.</a> Biochemistry. 33, 1797-1803 (1994).</li></ol>

המחברים מצהירים שום ניגוד עניינים.

Assay מולקולה בודדת פשוט המבוסס על סריג שימש ללמוד קינטיקה לולאות של DNAs של צורות פנימיות שונות. ניתן להכין DNAs מעוקל על ידי חזרה על רצף 10-mer בשלב עם תקופת הסליל של 10.5 נ&quot;ב, וניתן להעריך עקמומיות שלהם באמצעות עמוד. dsDNAs אלה נועדו עם קצוות דביקים על מנת לאפשר ייצוב לולאה חולף...

הבנת התכונות מכאניות של dsDNA היא בעל חשיבות עליונה במדעים בסיסיים ויישומים הנדסיים. המבנה של dsDNA הוא מסובך יותר מאשר סולם סליל ישר בגלל זוויות גלגול, הטיה ופיתול בין זוגות בסיסים רצופים יכולות להשתנות עם רצף. תנודות תרמיות יכולות לגרום dsDNA לעבור מצבים שונים של תנודות קונפורמציה כגון כיפוף, פיתול ומתיחות. מעברים כגון היתוך ומסתלסל יכולים להתרחש גם בתנאים קיצוניים. בין תנועות אלה, יש כיפוף dsDNA ההשפעה הביולוגית הבולטת ביותר 1. כיפוף dsDNA קשור לדיכוי גן או הפעלה על ידי הבאת שני אתרים מרוחקים קרובים אחד לשני. זה גם משחק תפקיד חשוב באריזת ה-DNA בתוך גרעין התא או הקופסית נגיפית. עיוות כיפוף של dsDNA ניתן דמיינו באופן ניסיוני על ידי מיקרוסקופ ברזולוציה גבוהה (AFM 2 וTEM 3), וthermodynamics וקינטיקה ניתן ללמוד על ידי מבחני לולאות, אשר כימי קישור אתרים זה לצד זה של dsDNA. assay אחד כזה הוא cyclization האנזים תלוי 4. ב assay זה, מולקולות dsDNA עם קצוות &quot;דביקים&quot; (מגובש) הן circularized או dimerized ידי האנזים ה-DNA. על ידי השוואת המחירים של המעגל והיווצרות דימר, ניתן לקבל ריכוז טוחנת יעיל של קצה אחד של ה-DNA בקרבת הקצה השני, אשר ידוע כגורם J. גורם J זה ממדי שווה לצפיפות הסתברות למציאת קצה אחד של ה-DNA במרחק קצר מהקצה השני, ובכך משקף את הגמישות של ה-DNA. מדידת גורם J כפונקציה של אורך ה-DNA מגלה מאפיינים רבים על מכניקת DNA כולל 4,5 אורך ההתמדה. השרשרת דמוית תולעת המודל (WLC) כבר נחשב למודל הפולימר הקנונית למכניקת dsDNA מבוססת על הצלחתה בexplaining עקומות כוח ההארכה שהושגו ב-DNA מושך ניסויי 6, ובצורה נכונה לניבוי גורמי J של dsDNAs זמן רב יותר מאשר 200 נ&quot;ב 7. עם זאת, באמצעות assay cyclization על מולקולות dsDNA קצרות ככל 100 נ&quot;ב, קלוטייה וWidom מדדו את גורמי J להיות בכמה סדרי גודל גבוהים יותר מהתחזית של מודל WLC 8. שנה לאחר מכן, דו et al. מיוצר גורמי J בהסכם עם מודל WLC באמצעות assay cyclization עם ריכוזים נמוכים יותר של האנזים וייחס את התוצאה החריגה מקבוצת Widom לריכוזי האנזים גבוהים בשימוש 9. מחלוקת זו מדגימה את ההשפעה הבלתי נמנעת של האנזים ה-DNA על קינטיקה cyclization בעת שימוש assay הקונבנציונלי 9. יתר על כן, האנזים DNA יכול להשפיע גם על מבנה ה-DNA ונוקשות דרך 10,11 מחייב ספציפי. כדי למנוע חששות הטכניים של מבחני לולאות חלבון תלוי, לאחרונה הפגינו protassay לולאות עין בחינם מבוסס על פלואורסצנטי התהודה העברת אנרגיה (סריג) 12. בשיטה זו, תצורות כרך מזוהות על ידי סריג בין תורם acceptor המצורף ליד הקצוות הדביקים של מולקולת ה-DNA. מיקרוסקופ אובייקטיבי מסוג הקרינה השתקפות הכל הפנימית (TIRFM) משמש להקלטת מסלולים של לולאות הפיכים ואירועי unlooping ממולקולות דנ&quot;א חד משותק פני השטח לתקופה ממושכת של זמן. שיטה זו כוללת הרכבה של מולקולות ה-DNA המבוססת על ה-PCR לייצור מולקולות ה-DNA ללא חוסר התאמה, שהוא שיפור מכריע על שיטה דומה על ידי Vafabakhsh ו13 הא. היבט המולקולה בודדת של פרוטוקול זה מאפשר מדידה של הפצות בנוסף לאנסמבל ממוצע ואילו היבט סריג מאפשר למדוד דינמיקת לולאות DNA שוב ושוב מאותה המולקולה, גם במצבים שעלולים לפגוע בפעילות האנזים. התקנת TIRFM מוצגת באיור 1. מותאמת אישיתשלב דגימה מעוצבת ממוקם מעל גוף מיקרוסקופ אולימפוס IX61. 532 ננומטר ו640 לייזרי ננומטר הם הציגו מהצד ובאים לידי הביטוי במראות סגלגלות זעירות 14 למטרת NA הגבוהה כדי להשיג זווית קריטית של שכיחות בממשק coverslip המים. נציין כי נפוץ יותר TIR דרך אובייקטיבי באמצעות מראות dichroic או setups TIR מבוסס פריזמה יכול לשמש גם עבור יישום סריג הזה. תמונת הקרינה שהוקמה על ידי מיקרוסקופ מחולקת לתמונות תורם acceptor ידי מראה dichroic. הם לאחר מכן מחדש הדמיה על שני חצאים של EMCCD. מסנני פליטה ארוך לעבור נוספים נמצאים בשימוש כדי להפחית את אות רקע. בקרת טמפרטורה היא חיונית לרכישת נתונים הקינטית לשחזור. לבקרת טמפרטורה, המטרה היא להפריד את מזנקים של גוף מיקרוסקופ כדי למזער העברת חום, ומים מנשלט ילר / תנור בטמפרטורה מופצת דרך צווארון פליז שחוזקה התקפיםסביב מתכת הפנים מתחת למעייל האובייקטיבי. התקנה זו היא מסוגלת להשיג שליטה בטמפרטורה יציבה על פני השטח coverslip בין 15 50 ° C (איור 2). בעבודה זו, מדגם הטמפרטורה נשמרה ב24 ° C. הפרוטוקול שלהלן מציג את הליך צעד אחר צעד לבניית ה-DNA, הערכה של צורת ה-DNA, ניסוי מולקולה בודדת, ונחישות גורם J.

<table><tbody><tr><td>Small DNA FRAG Extract Kit-100PR</td><td>VWR</td><td>97060-558</td><td></td></tr><tr><td>Acrylamide 40% solution 500 ml</td><td>VWR</td><td>97064-522</td><td></td></tr><tr><td>Bis-acrylamide 2% (w/v) solution 500 ml</td><td>VWR</td><td>97063-948</td><td></td></tr><tr><td>GeneRuler 100 bp DNA Ladder, 100-1,000 bp</td><td>Fermentas</td><td>SM0241</td><td></td></tr><tr><td>Mini Vertical PAGE System</td><td>VWR</td><td>89032-300</td><td></td></tr><tr><td>Syringe filter 0.2 &amp;mu;m CS50</td><td>VWR</td><td>A2666</td><td></td></tr><tr><td>Trolox</td><td>Sigma-Aldrich</td><td>238813-1G</td><td>triplet state quencher</td></tr><tr><td>Protocatechuic acid (PCA)</td><td>Sigma-Aldrich</td><td>08992-50MG</td><td>oxygen scavenging system</td></tr><tr><td>Protocatechuate 3,4-Dioxygenase (PCD)</td><td>Sigma-Aldrich</td><td>P8279-25UN</td><td>oxygen scavenging system</td></tr><tr><td>mPEG-silane, MW 2,000 1 g</td><td>Laysan Bio</td><td>MPEG-SIL-2000-1g</td><td></td></tr><tr><td>Biotin-PEG-Silane, MW 3,400</td><td>Laysan Bio</td><td>Biotin-PEG-SIL-3400-1g</td><td></td></tr><tr><td>Avidin, NeutrAvidin Biotin-binding Protein</td><td>Invitrogen</td><td>A2666</td><td></td></tr><tr><td>Phusion Hot Start High-Fidelity DNA Polymerase</td><td>New England Biolabs</td><td>F-540L</td><td></td></tr><tr><td>Gel/PCR DNA Fragments Extraction Kit</td><td>IBI Scientific</td><td>IB47020</td><td></td></tr><tr><td>Premium plain glass microscope slides</td><td>Fisher Scientific</td><td>12-544-1</td><td></td></tr><tr><td>VWR micro cover glass, rectangular, no. 1</td><td>VWR</td><td>48404-456</td><td></td></tr><tr><td>Fisher Scientific Isotemp 1006S Recirculating Chiller/Heater</td><td>Fisher Scientific</td><td></td><td>temperature control</td></tr><tr><td>Objective Cooling Collar</td><td>Bioptechs</td><td>150303</td><td>temperature control</td></tr><tr><td>KMI53 Biological Micrometer Measuring Stage</td><td>Semprex</td><td>KMI53</td><td></td></tr><tr><td>High Performance DPSS Laser 532 nm 50 mW</td><td>Edmund optics</td><td>NT66-968</td><td>Cy3 excitation</td></tr><tr><td>CUBE Fiber Pigtailed 640 nm, 30 mW, Fiber, FC/APC Connector</td><td>Coherent</td><td>1139604</td><td>Cy5 excitation</td></tr><tr><td>650 nm BrightLine Dichroic Beamsplitter</td><td>Semrock</td><td>FF650-Di01-25x36</td><td>splitting dichroic</td></tr><tr><td>LaserMUX Beam Combiner, reflects 514.5, 532, &amp;amp; 543.5 nm lasers, 25 mm</td><td>Semrock</td><td>LM01-552-25</td><td>combining dichroic</td></tr><tr><td>Brightline Fluorescence Filter 593/40</td><td>Semrock</td><td>FF01-593/40-25</td><td>Cy3 emission filter</td></tr><tr><td>635 nm EdgeBasic LWP longpass Filter, 25 mm</td><td>Semrock</td><td>BLP01-635R-25</td><td>Cy5 emission filter</td></tr><tr><td>EMCCD iXon+</td><td>Andor Technology</td><td>DU-897E-CS0-#BV</td><td></td></tr><tr><td>IX51 inverted microscope frame</td><td>Olympus</td><td></td><td></td></tr><tr><td>Objective UApo N 100X/1.49 Oil TIRF</td><td>Olympus</td><td></td><td></td></tr><tr><td>Immersion oil type-F for fluorescence microscopy</td><td>Olympus</td><td>IMMOIL-F30CC</td><td></td></tr><tr><td>2 mm Diameter 45&amp;deg; Rod Lens Aluminum Coated&amp;nbsp;</td><td>Edmund optics</td><td>54-092</td><td>miniature mirror</td></tr><tr><td>1/4&quot; Travel Single-Axis Translation Stage</td><td>Thorlabs</td><td>MS-1</td><td>translation of miniature mirror</td></tr><tr><td>&amp;Oslash;1&quot; Achromatic Doublet, ARC: 400-700 nm, f=200 mm</td><td>Thorlabs</td><td>AC254-200-A</td><td>focusing lens</td></tr><tr><td>Adjustable Mechanical Slit</td><td>Thorlabs</td><td>VA100</td><td></td></tr><tr><td>Dielectric Mirror</td><td>Thorlabs</td><td>BB1-E02</td><td></td></tr><tr><td>&amp;Oslash;1&quot; Achromatic Doublet, f = 100 mm</td><td>Thorlabs</td><td>AC254-100-A</td><td>relay lens</td></tr><tr><td>Lens Mount for &amp;Oslash;1&quot; Optics</td><td>Thorlabs</td><td>LMR1</td><td></td></tr><tr><td>Dichroic Filter Mount</td><td>Thorlabs</td><td>FFM1</td><td></td></tr><tr><td>Fixed Cage Cube Platform</td><td>Thorlabs</td><td>B3C</td><td></td></tr><tr><td>Kinematic Mount for &amp;Oslash;1&quot; Optics</td><td>Thorlabs</td><td>KM100</td><td></td></tr><tr><td>N-BK7 Plano-Convex Lens, &amp;Oslash;1&quot;, f = 40 mm</td><td>Thorlabs</td><td>LA1422-A</td><td>collimating lens</td></tr><tr><td>N-BK7 Plano-Convex Lense, &amp;Oslash;6.0 mm, f = 15 mm</td><td>Thorlabs</td><td>LA1222-A</td><td>telescope lens</td></tr><tr><td>N-BK7 Plano-Convex Lense, &amp;Oslash;6.0 mm, f = 150 mm</td><td>Thorlabs</td><td>LA1433-A</td><td>telescope lens</td></tr></tbody></table>

studying dna looping by single-molecule fret

כיפוף של גדילי הדנ&quot;א כפול (dsDNA) קשור עם הרבה תהליכים ביולוגיים חשובים כגון זיהוי חלבון דנ&quot;א ואריזת ה-DNA לתוך nucleosomes. תרמודינמיקה של כיפוף dsDNA נחקרה על ידי cyclization שיטה הנקראת אשר מסתמך על האנזים DNA להצטרף קוולנטית קצוות דביקים קצרים של dsDNA. עם זאת, יעילות קשירה יכולה להיות מושפעת מגורמים רבים שאינם קשורים לdsDNA לולאה כגון מבנה ה-DNA המקיף את הקצוות הדביקים הצטרפו, ואנזים יכול להשפיע גם על שיעור לולאות לכאורה באמצעות מנגנונים כגון ספציפי מחייב. כאן, אנו מראים כיצד למדוד קינטיקה לולאות dsDNA ללא האנזים על ידי איתור היווצרות ה-DNA לולאה חולפת ידי סריג (פלואורסצנטי התהודה העברת אנרגיה). מולקולות dsDNA נבנות באמצעות פרוטוקול המבוסס על ה-PCR פשוט עם זוג סריג ומקשר ביוטין. צפיפות הסתברות הלולאה הידועה כגורם J מופק שיעור לולאות ושיעור חישול בין שתי disconnecקצוות דביקים טד. על ידי בדיקת שתי dsDNAs עם עקמומיות פנימית שונה, אנו מראים כי גורם J הוא רגיש לצורה הפנימית של dsDNA.

מולקולות ה-DNA משמשות למחקר הלולאה מורכבת של אזור דופלקס של רצף משתנה ובאורך וסככות חד גדילים שהם משלימים אחד את השני. הסככות, שהן ארוכות 7 בסיס, יכולות לחשל זה לזה כדי ללכוד את מצב הכרך. כל הסככה מכילה גם Cy3 או Cy5 כי הוא מקושר בעמוד שדרת ה-DNA באמצעות הכימיה amidite. Cy5-הסככה קשו...

Watch this Scientific Journal Video about Studying DNA Looping by Single-Molecule FRET at JoVE.com

Studying DNA Looping by Single-Molecule FRET

מחקר זה מציג הליך ניסיון מפורט כדי למדוד דינמיקת לולאות של גדילי הדנ&quot;א כפול באמצעות פלואורסצנטי התהודה העברת אנרגיה מולקולה בודדת (סריג). הפרוטוקול מתאר גם כיצד לחלץ את צפיפות הסתברות הלולאה נקראת גורם J.

לימוד ה-DNA Looping ידי סריג Single-מולקולה

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into ...

studying-dna-looping-by-single-molecule-fret

Research

JoVE Journal

Biology

15.3K Views.  Georgia Institute of Technology.  מחקר זה מציג הליך ניסיון מפורט כדי למדוד דינמיקת לולאות של גדילי הדנ"א כפול באמצעות פלואורסצנטי התהודה העברת אנרגיה מולקולה בודדת (סריג). הפרוטוקול מתאר גם כיצד לחלץ את צפיפות הסתברות הלולאה נקראת גורם J. 

Video: Studying DNA Looping by Single-Molecule FRET

A Simple, Robust, and High Throughput Single Molecule Flow Stretching Assay Implementation for Studying Transport of Molecules Along DNA

We describe a simple, robust and high throughput single molecule flow-stretching assay for studying 1D diffusion of molecules along DNA. In this assay, glass coverslips are functionalized in a one-step reaction with silane-PEG-biotin. Flow cells are constructed by sandwiching an adhesive tape with pre-cut channels between a functionalized coverslip and a PDMS slab containing inlet and outlet holes. Multiple channels are integrated into one flow cell and the flow of reagents into each channel can be fully automated, which significantly increases the assay throughput and reduces hands-on time per assay. Inside each channel, biotin-&#955;-DNAs are immobilized on the surface and a laminar flow is applied to flow-stretch the DNAs. The DNA molecules are stretched to &#62;80% of their contour length and serve as spatially extended templates for studying the binding and transport activity of fluorescently labeled molecules. The trajectories of single molecules are tracked by time-lapse Total Internal Reflection Fluorescence (TIRF) imaging. Raw images are analyzed using streamlined custom single particle tracking software to automatically identify trajectories of single molecules diffusing along DNA and estimate their 1D diffusion constants.

This protocol demonstrates a simple, robust and high throughput single molecule flow-stretching assay for studying one-dimensional (1D) diffusion of molecules along DNA.

מולקולה בודדת פשוטה, חסון וגבוה התפוקה זרימה מתיחה Assay יישום לימוד התחבורה של מולקולות לאורך הדנ א

We describe a simple, robust and high throughput single molecule flow-stretching assay for studying 1D diffusion of molecules along DNA. In this assay, ...

Biochemistry

Dual DNA Rulers to Study the Mechanism of Ribosome Translocation with Single-Nucleotide Resolution

The ribosome translocation refers to the ribosomal movement on the mRNA by exactly three nucleotides (nt), which is the central step in protein synthesis. To investigate its mechanism, there are two essential technical requirements. First is single-nt resolution that can resolve normal translocation from frameshifting, during which the ribosome moves by other than 3 nt. The second is the capability to probe both the entrance and exit sides of mRNA in order to elucidate the whole picture of translocation. We report the dual DNA ruler assay that is based on the critical dissociation forces of DNA-mRNA duplexes, obtained by force-induced remnant magnetization spectroscopy (FIRMS).&#160; With 2-4 pN force resolution, the dual ruler assay is sufficient to distinguish different translocation steps. By implementing a long linker on the probing DNAs, they can reach the mRNA on the opposite side of the ribosome, so that the mRNA position can be determined for both sides. Therefore, the dual ruler assay is uniquely suited to investigate the ribosome translocation, and nucleic acid motion in general. We show representative results which indicated a looped mRNA conformation and resolved normal translocation from frameshifting.

Dual DNA ruler assay is developed to determine the mRNA position during ribosome translocation, which relies on the dissociation forces of the formed DNA-mRNA duplexes. With single-nucleotide resolution and capability of reaching both ends of mRNA, it can provide mechanistic insights for ribosome translocation and probe other nucleic acid displacements.

שליטי ה-DNA כפול ללמוד את המנגנון של טרנסלוקציה הריבוכמה עם פתרון יחיד נוקלאוטיד

The ribosome translocation refers to the ribosomal movement on the mRNA by exactly three nucleotides (nt), which is the central step in protein synthesis. ...

R-Loop Analysis by Dot-Blot

The three-stranded nucleic acid structure, R-loop, is increasingly recognized for its role in gene regulation. Initially, R-loops were thought to be the by-products of transcription; but recent findings of fewer R-loops in diseased cells made it clear that R-loops have functional roles in a variety of human cells. Next, it is critical to understand the roles of R-loops and how cells balance their abundance. A challenge in the field is the quantitation of R-loops since much of the work relies on the S9.6 monoclonal antibody whose specificity for RNA-DNA hybrids has been questioned. Here, we use dot-blots with the S9.6 antibody to quantify R-loops and show the sensitivity and specificity of this assay with RNase H, RNase T1, and RNase III that cleave RNA-DNA hybrids, single-stranded RNA, and double-stranded RNA, respectively. This method is highly reproducible, uses general laboratory equipment and reagents, and provides results within two days. This assay can be used in research and clinical settings to quantify R-loops and assess the effect of mutations in genes such as senataxin on R-loop abundance.

This protocol details a simple method that quantifies R-loop, a three-stranded nucleic acid structure that comprises of an RNA-DNA hybrid and a displaced DNA strand.

The three-stranded nucleic acid structure, R-loop, is increasingly recognized for its role in gene regulation. Initially, R-loops were thought to be the ...

Genetics

Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides (Figure 1). The growing product double-strand DNA (dsDNA) is extended with laminar flow and visualized by using an intercalating dye. Measuring the position of the growing DNA end in real time allows precise determination of replication rate (Figure 2). Furthermore, the length of completed DNA products reports on the processivity of replication. This experiment can be performed very easily and rapidly and requires only a fluorescence microscope with a reasonably sensitive camera.


This protocol demonstrates a simple single-molecule fluorescence microscopy technique for visualizing DNA replication by individual replisomes in real time.

חזותי יחיד מולקולת הדנ&quot;א שכפול עם מיקרוסקופ פלואורסצנטי

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA ...

Single-Molecule Dwell-Time Analysis of Restriction Endonuclease-Mediated DNA Cleavage

This novel total internal reflection fluorescence microscopy-based assay facilitates the simultaneous measurement of the length of the catalytic cycle for hundreds of individual restriction endonuclease (REase) molecules in one experiment. This assay does not require protein labeling and can be carried out with a single imaging channel. In addition, the results of multiple individual experiments can be pooled to generate well-populated dwell-time distributions. Analysis of the resulting dwell-time distributions can help elucidate the DNA cleavage mechanism by revealing the presence of kinetic steps that cannot be directly observed. Example data collected using this assay with the well-studied REase, EcoRV - a dimeric Type IIP restriction endonuclease that cleaves the palindromic sequence GAT&#8595;ATC (where &#8595; is the cut site) - are in agreement with prior studies. These results suggest that there are at least three steps in the pathway to DNA cleavage that is initiated by introducing magnesium after EcoRV binds DNA in its absence, with an average rate of 0.17 s-1 for each step.

Using quantum-dot-labeled DNA and total internal reflection fluorescence microscopy, we can investigate the reaction mechanism of restriction endonucleases while using unlabeled protein. This single-molecule technique allows for massively multiplexed observation of individual protein-DNA interactions, and data can be pooled to generate well-populated dwell-time distributions.

ניתוח זמן שהייה של מולקולה בודדת של מחשוף DNA בתיווך אנדונוקלאז הגבלה

This novel total internal reflection fluorescence microscopy-based assay facilitates the simultaneous measurement of the length of the catalytic cycle for ...

Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. Linearized &lambda; DNA is modified to have a biotin on the end of one strand, and a digoxigenin moiety on the other end of the same strand. The biotinylated end is attached to a functionalized glass coverslip and the digoxigeninated end to a small bead. The assembly of these DNA-bead tethers on the surface of a flow cell allows a laminar flow to be applied to exert a drag force on the bead. As a result, the DNA is stretched close to and parallel to the surface of the coverslip at a force that is determined by the flow rate (Figure 1). The length of the DNA is measured by monitoring the position of the bead. Length differences between single- and double-stranded DNA are utilized to obtain real-time information on the activity of the replication proteins at the fork. Measuring the position of the bead allows precise determination of the rates and processivities of DNA unwinding and polymerization (Figure 2).

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system.

תצפית ישירה של ה-DNA אנזימים שכפול באמצעות DNA מולקולה בודדת מתיחה Assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. ...

Single-Molecule Imaging of EWS-FLI1 Condensates Assembling on DNA

The fusion genes resulting from chromosomal translocation have been found in many solid tumors or leukemia. EWS-FLI1, which belongs to the FUS/EWS/TAF15 (FET) family of fusion oncoproteins, is one of the most frequently involved fusion genes in Ewing sarcoma. These FET family fusion proteins typically harbor a low-complexity domain (LCD) of FET protein at their N-terminus and a DNA-binding domain (DBD) at their C-terminus. EWS-FLI1 has been confirmed to form biomolecular condensates at its target binding loci due to LCD-LCD and LCD-DBD interactions, and these condensates can recruit RNA polymerase II to enhance gene transcription. However, how these condensates are assembled at their binding sites remains unclear. Recently, a single-molecule biophysics method-DNA Curtains-was applied to visualize these assembling processes of EWS-FLI1 condensates. Here, the detailed experimental protocol and data analysis approaches are discussed for the application of DNA Curtains in studying the biomolecular condensates assembling on target DNA.

Here, we describe the use of the single-molecule imaging method, DNA Curtains, to study the biophysical mechanism of EWS-FLI1 condensates assembling on DNA.

הדמיה של מולקולה בודדת של עיבוי EWS-FLI1 המורכב על DNA

The fusion genes resulting from chromosomal translocation have been found in many solid tumors or leukemia. EWS-FLI1, which belongs to the FUS/EWS/TAF15 ...

<meta charset="utf8"></head><body>In Situ Nucleosome Reconstitution for Single-Molecule Studies

In Situ Nucleosome Assembly for Single-Molecule Correlative Force and Fluorescence Microscopy

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding their biophysical properties and interactions with chromatin-binding proteins. Nucleosome reconstitution on DNA for these studies typically involves a salt dialysis procedure that provides precise control over the placement and number of nucleosomes formed along a DNA tether. However, this protocol is time-consuming and requires a substantial amount of DNA and histone octamers as inputs. To offer an alternative strategy, an in situ nucleosome reconstitution method for single-molecule force and fluorescence microscopy that utilizes the histone chaperone Nap1 is described. This method enables users to assemble nucleosomes on any DNA template without the need for strong nucleosome positioning sequences, adjust nucleosome density on demand, and use fewer reagents. In situ nucleosome formation occurs within seconds, offering a simpler experimental workflow and a convenient transition into single-molecule measurements. Examples of two downstream assays for probing nucleosome mechanics and visualizing the behavior of individual proteins on chromatin are further described.

<meta charset="utf8"></head><body>מחבר זרקור: הרכבה מחדש יעילה של נוקלאוזומים עבור טכניקות של מולקולה בודדת

This article presents a detailed experimental procedure for reconstituting nucleosome-containing DNA tethers for single-molecule correlative force and fluorescence microscopy. It further describes several downstream experiments that can be conducted to visualize the binding behavior of chromatin-interacting proteins and analyze changes in the physical properties of nucleosomes.

מכלול נוקלאוזומים באתרו עבור כוח מתאם של מולקולה בודדת ומיקרוסקופ פלואורסצנטי

Nucleosomes constitute the primary unit of eukaryotic chromatin and have been the focus of numerous informative single-molecule investigations regarding ...

לימוד ה-DNA Looping ידי סריג Single-מולקולה

Summary

Explore More Videos

Chapters in this video

מולקולה בודדת פשוטה, חסון וגבוה התפוקה זרימה מתיחה Assay יישום לימוד התחבורה של מולקולות לאורך הדנ א

שליטי ה-DNA כפול ללמוד את המנגנון של טרנסלוקציה הריבוכמה עם פתרון יחיד נוקלאוטיד

R-Loop Analysis by Dot-Blot

חזותי יחיד מולקולת הדנ"א שכפול עם מיקרוסקופ פלואורסצנטי

ניתוח זמן שהייה של מולקולה בודדת של מחשוף DNA בתיווך אנדונוקלאז הגבלה

תצפית ישירה של ה-DNA אנזימים שכפול באמצעות DNA מולקולה בודדת מתיחה Assay

הדמיה של מולקולה בודדת של עיבוי EWS-FLI1 המורכב על DNA

מכלול נוקלאוזומים באתרו עבור כוח מתאם של מולקולה בודדת ומיקרוסקופ פלואורסצנטי

מכלול נוקלאוזומים באתרו עבור כוח מתאם של מולקולה בודדת ומיקרוסקופ פלואורסצנטי

מכלול נוקלאוזומים באתרו עבור כוח מתאם של מולקולה בודדת ומיקרוסקופ פלואורסצנטי