This work was supported by grants from CONACyT-SEP (SEP-2008-84582; CB-2011-01-168497) and Promep-SEP for R.A.G.; P.H. received a scholarship from CONACyT (447442).

תרבית תאי 1. HFF ומודעות-זיהום <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הפץ וירוס Ad5 WT בmonolayers של HEK-293 תאים וכיילו כיחידות ניאון יוצרים (FFU) בתאי HFF כפי שתואר לעיל 8. </li><li style=";text-align:right;direction:rtl"> לגדול fibroblasts העורלה האדם (HFF) ב 10 מיליליטר של DMEM 10% שור עוברי סרום (FBS) במנות מ&quot;מ סטרילי תרבות 100 על 37 מעלות צלזיוס, 5% CO / 2 בחממה humidified. לקבוע את המספר הסלולרי באמצעות תא נויבאואר על ידי ספירת תאים בארבעת סטים של 16 מ&quot;ר. מספר התאים למ&quot;ל מתקבל על ידי חישוב מספר התאים הממוצע בארבעת סטים של 16 מ&quot;ר והכפלת מספר זה ב -10 4. עבור כל זיהום שלאחר זמן הכלול בשלב 1.3, להשתמש 1 x 10 7 תאי HFF. </li><li style=";text-align:right;direction:rtl"> מוק להדביק או להדביק תאי HFF עם סוג אדנווירוס 5 (Ad5) wild-type (WT) (H5pg4100 8) במנות בתרבית רקמת 100 מ&quot;מ באמצעות 1 מיליליטר של Ad5 בDMEM לכל צלחת במשרד פנים של 30 פוקוס יצירת יחידה, או FFU , לכל תא. דגירה עבור שעה 2 באהחממת umidified תרבית תאים על 37 מעלות צלזיוס, 5% CO 2, נדנדה בזהירות את המנות בכל 15 דקות על מנת להבטיח הפצה הומוגנית של הבידוד הווירוס על התאים. לאחר פרק זמן זה, להסיר את המדיום ולהוסיף DMEM הטרי בתוספת 10% FBS ו דגירה של 16, 24 או 36 שעות בתרבית תאי חממת humidified על 37 מעלות צלזיוס, 5% CO 2. המשך לשלב 2.1. </li></ol> 2. הכנת שברים תת-גרעיניים מועשר בAdenovirus RC <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> נגוע Ad5 הקציר או תאי HFF נגועים מדומים עם scrapper תא ולאסוף את התאים בצינורות צנטריפוגות סטרילי. לקבוע את המספר הסלולרי כמו בשלב 1.2. להשתמש 1 x 10 7 תאים לכל זיהום שלאחר זמן מסוים בשלב 1.3. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה התאים ב 220 XG, 4 מעלות צלזיוס למשך 5 דקות. </li><li style=";text-align:right;direction:rtl"> Resuspend התא גלולה בPBS קר כקרח (137 מ&quot;מ NaCl, 2.7 מ&quot;מ KCl, 10 מ&quot;מ Na 2 4 HPO ו -1.8 מ&quot;מ KH 2 PO 4). תא גלולה לשטוףשל 3 פעמים באמצעות 5 מיליליטר של PBS קר כקרח לכל לשטוף. לצורך כך, צנטריפוגה התאים ב 220 XG, 4 מעלות צלזיוס למשך 5 דקות, למזוג וזורקים supernatant (SN), וresuspend התא גלולה על ידי pipetting העדין. </li><li style=";text-align:right;direction:rtl"> לשבש את קרום הפלזמה, resuspend התא גלולה ב700 μ l של חיץ hypotonic קר כקרח (10 מ&quot;מ HEPES pH 7.9, 10 מ&quot;מ KCl, 1.5 מ&quot;מ MgCl 2, 0.5 מ&quot;מ DTT, 20 μ g / ml phenylmethylsulfonyl פלואוריד (PMSF) , תערובת של ציסטאין, סרין, תראונין מעכבי פרוטאז וaspartyl כולל 10 גרם / מיליליטר מעכבי טריפסין לבלב שור, 10 גר &#39;/ מיליליטר pepstatin μ μ ו -10 גר&#39; / מיליליטר -acetyl-L-leucyl-L-leucyl-L N μ -argininal) ולתת לתאים להתנפח על קרח 3 שעות. </li><li style=";text-align:right;direction:rtl"> Lyse התאים באמצעות homogenizer עם העלי טפלון סוג רפוי. בצע 80 dounce שבץ ודגימות צג כל 20 משיכות על ידי מיקרוסקופ שדה הבהיר כדי להבטיח שכל התאים כבר lysed, אבל שיש לי הגרעינים nםוריה נפגע או מקרע. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה homogenate התא ב 300 XG, 4 מעלות צלזיוס למשך 5 דקות. אחסן את SN כחלק cytoplasmic ב -20 מעלות צלזיוס בצינור צנטריפוגות. </li><li style=";text-align:right;direction:rtl"> כדי להסיר סלולרית פסולת מגרעינים, resuspend גלולה ב750 μ l של פתרון 1 (S1) (0.25 מ &#39;סוכרוז, 10 מ&quot;מ MgCl 2 20 μ g מעכבים / מיליליטר PMSF, תערובת של ציסטאין, סרין, תראונין ופרוטאז aspartyl כולל 10 μ g / ml מעכב שור לבלב טריפסין, 10 μ g מיליליטר pepstatin / 10 וμ g / ml N -acetyl-L-leucyl-L-leucyl-L-argininal) ושכבה מעל נפח שווה של פתרון 2 (S2) (0.35 מ &#39;סוכרוז, 0.5 מ&quot;מ MgCl 2, 20 μ g / ml PMSF, תערובת של ציסטאין, סרין, תראונין מעכבי פרוטאז וaspartyl כוללים 10 μ g / מיליליטר מעכבי טריפסין לבלב שור, 10 μ g / ml pepstatin ו -10 μ g / ml N -acetyl-L-leucyl-L-leucyl-L-argininal). Centrifuge ב1,400 XG, 4 מעלות צלזיוס למשך 5 דקות. </li><li style=";text-align:right;direction:rtl"> מחק את SN באמצעות micropipette. הימנע להפריע גלולה. </li><li style=";text-align:right;direction:rtl"> Resuspend גלולה המכילה גרעינים מבודדים ב750 μ l של S2. </li><li style=";text-align:right;direction:rtl"> כדי לבודד שברים subnuclear מועשרים באדנווירוס RC (RCF), sonicate resuspended גרעינים עם אמבטיה קולית, באמצעות שתי פעימות 5 דקות, או עד שכל הגרעינים lysed כפי שנצפו על ידי מיקרוסקופ שדה הבהיר. השתמש בקרח באמבטיה קולית לפי צורך כדי לשמור על דגימות באו מתחת ל -4 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> שכבת גרעיני sonicated על נפח שווה של פתרון 3 (S3) (0.88 M סוכרוז, 0.5 מ&quot;מ MgCl 2) ו צנטריפוגות ב3,000 XG, 4 מעלות צלזיוס במשך 10 דקות. אחסן את supernatant 1.5 מיליליטר כחלק nucleoplasmic (NPL) ב -70 מעלות צלזיוס. Resuspend גלולה ב700 μ l של S2 וחנות כRCF ב -70 מעלות צלזיוס. </li></ol> 3. ניתוח המערבי כתם של RCF הערה: לניתוח המערבי כתם של שברים של NPL וRCFet הצידה 640 μ l לNPL ו -300 μ l לRCF מהנפח הכולל שהושג בשלב 2.11. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מערבבים 15 μ l של כל חלק subnuclear ב2x Laemmli חיץ (4% SDS, גליצרול 20%, 10% 2-mercaptoethanol, bromophenol 0.004% כחולים, 0.125 M טריס HCl pH 6.8) ורתיחה ב 95 מעלות צלזיוס למשך 5 דקות. טען את הדגימות באלקטרופורזה נתרן 10% dodecyl סולפט-polyacrylamide ג&#39;ל (SDS-PAGE) denaturing ג&#39;ל וחלבונים נפרדים עבור 1.5 שעות, בטמפרטורה של 20 milliamperes (MA). </li><li style=";text-align:right;direction:rtl"> העבר את החלבונים על ידי electroblotting תמורת 1.5 שעות ב 400 מילי-אמפר על difluoride polyvinylidene ממברנות (PVDF). </li><li style=";text-align:right;direction:rtl"> לחסום קרום לשעה 2 ב RT באמצעות חלב יבש ללא שומן 3% ב- PBS. </li><li style=";text-align:right;direction:rtl"> דגירה O / N במעלות צלזיוס 4 עם נוגדן ראשוני נגד חלבון נגיפי E2A מחייב DNA (B6-8 9) בדילול 1: 500 בחלב ללא שומן יבש / 0.3% PBS. </li><li style=";text-align:right;direction:rtl"> קרום לשטוף 3 פעמים עם PBS / 0.1% Tween 20 במשך 10 דקות. </li><li style=";text-align:right;direction:rtl"> דגירה הממברנה עם IgG נגד עכבר המשניtibody מצמידים peroxidase סוס-צנון (HRP) בדילול 1: 10,000 ב PBS עבור שעה 2 ב RT. </li><li style=";text-align:right;direction:rtl"> שטוף את הקרום 3 פעמים עם PBS / 0.1% Tween 20 במשך 10 דקות. </li><li style=";text-align:right;direction:rtl"> לפתח הקרום באמצעות chemiluminescence משופרת וצילומי רנטגן. </li></ol> 4. ויראלי DNA איתור בRCF הערה: לבידוד DNA משני השברים NPL וRCF, להשתמש 210 μ l לNPL וμ 100 ליטר לRCF מהנפח הכולל שהושג בשלב 2.11. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> דגירה שברים תת-גרעיניים עבור שעה 1 ב 55 מעלות צלזיוס עם 1 מ&quot;ג / מיליליטר של proteinase K ו 0.5% Tween 20. </li><li style=";text-align:right;direction:rtl"> להשבית K proteinase ידי דוגרים הדגימות במשך 10 דקות על 95 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה דגימות ב20,000 XG, ב RT למשך 2 דקות. </li><li style=";text-align:right;direction:rtl"> לאסוף SN. להאיץ את ה- DNA עם 1/10 נפח של נתרן אצטט 3M ונפח אחד של isopropanol, O / N ב 4 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה דגימות ב20,000 XG, ב RT במשך 10 דקות. </li><li style=";text-align:right;direction:rtl"> מחק את u SNלשיר micropipette. שטוף את הכדור עם 70% אתנול ו צנטריפוגות ב 20,000 XG, 4 מעלות צלזיוס למשך 5 דקות. </li><li style=";text-align:right;direction:rtl"> Resuspend DNA ב 10 μ l 10 מ&quot;מ טריס-HCl pH 7.4 </li><li style=";text-align:right;direction:rtl"> לכמת DNA באמצעות ספקטרופוטומטר על ידי מדידת הצפיפות האופטית (OD) ב 260 ננומטר. </li><li style=";text-align:right;direction:rtl"> כדי להגביר DNA הנגיפי, להשתמש של DNA 100 ng כל חלק מן subnuclear בתגובת PCR סטנדרטית באמצעות פולימראז תקי DNA ב -25 μ l של נפח תגובה עם פריימרים המאפשרים ההגברה של אזור בתוך יחידת השעתוק המאוחר סרן, מנוקלאוטיד 7273 ל נוקלאוטיד 7353 (81 נ&quot;ב) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). השתמש בתנאים הבאים המחזור: denaturation הראשוני 3 דקות ב 95 מעלות צלזיוס, ואחריו 20 מחזורים של הגברה (1 דקות ב 95 מעלות צלזיוס, חישול 1 דקות במעלות צלזיוס 62 והארכה למשך 30 שניות על 72 מעלות צלזיוס) וצעד ארכה סופי ל 3 דקות ב 72 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> הפעל את מוצר ה- PCR בג&#39;ל agarose 2%, ב -90 V. כתם עם ethidiumרומיד ברמה של 0.5 μ / מיליליטר ריכוז סופי גרם ולדמיין DNA כדי לאשש העשרת ה- DNA נגיפית בRCF. ידית ברומיד בזהירות רבה ותמיד לוודא ללבוש כפפות, כמתחם הזה הוא mutagen חזק. השלך ברומיד על פי הנחיות מוסדיות. </li></ol> 5. ויראלי המאוחר mRNA איתור בRCF הערה: לבידוד RNA משני השברים NPL וRCF, להשתמש 640 μ l לNPL ו -300 μ l לRCF מהנפח הכולל שהושג בשלב 2.11. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לבודד RNA משברי subnuclear באמצעות Trizol פי עם הוראות היצרן. Resuspend RNA ב -50 μ l של DEPC מים -treated (diethilpyrocarbonate). </li><li style=";text-align:right;direction:rtl"> לכמת את RNA באמצעות ספקטרופוטומטר למדוד את OD ב 260 ננומטר (ז כ 3 μ מתקבל). אחסן את RNA ב -50 ng / μ aliquots l ב -70 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> בדוק RNA המטוהרעל היעדריו של זיהום הדנ&quot;א על ​​ידי ביצוע תגובת PCR שליטה בהעדר טרנסקריפטאז (RT), באמצעות 5 ננוגרם של רנ&quot;א הכל ותנאי המחזור מתואר בשלב 4.9. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> אם זיהום הדנ&quot;א נעדר צריך להיות מיוצר לא amplicon. אם זיהום הדנ&quot;א הוא הווה, דגירה הדגימות עם 10 U DNase אני, 10 U של מעכב RNase, 0.1 מ &#39;טריס-HCl pH 8.3, 0.5 M KCl ו -15 מ&quot;מ MgCl 2 למשך 30 דקות ב 37 מעלות צלזיוס. המשך מחדש לבודד RNA כמו בשלב 5.1. </li></ol></li><li style=";text-align:right;direction:rtl"> כדי לנתח mRNA ויראלי הקשורים לRCF, להגביר של RNA 100 ng כל חלק מן subnuclear על ידי RT-PCR באמצעות פריימרים נועדו לזהות mRNA מאוחר adenoviral ממשפחות גנים שונים (טבלה 1). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לשעתוק לאחור (RT), להשתמש של RNA 100 ng, מכל חלק subnuclear בתגובת RT סטנדרטי באמצעות אנזים M-MuLV RT 20 μ l של נפח תגובה עבור שעה 1 ב 42 מעלות צלזיוס ו -10 דקות ב -70 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> להגברה, להשתמש 1l μ של cDNA בPCR תגובות, כמו בשלב 4.9. השתמש בתנאים הבאים המחזור: denaturation הראשוני 3 דקות ב 95 מעלות צלזיוס, ואחריו 25 מחזורים של הגברה (1 דקות ב 95 מעלות צלזיוס, חישול 1 דקות בטמפרטורה שצוינה בטבלה 1 והארכה למשך 30 שניות על 72 מעלות צלזיוס) ו צעד ארכה סופי 3 דקות ב 72 מעלות צלזיוס. </li></ol></li><li style=";text-align:right;direction:rtl"> הפעל את מוצרי RT-PCR בג&#39;ל agarose 2%, ב 90 ג &#39;ו&#39; כתם עם ברומיד ברמה של 0.5 μ / מיליליטר ריכוז סופי גרם ולדמיין לאשש עמותת mRNA מאוחר נגיפית לRCF. ידית ברומיד כפי שצוין בשלב 4.10. </li></ol> 6. ויזואליזציה Immunofluorescence של RCF הערה: לעסוק בהליך זה תחת הזרימה למינרית כדי למנוע זיהום של הדגימות עם כל חלקיקי אבק, ולסנן את כל הפתרונות לפני השימוש. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מקום 5 μ l של חלק RCF שהושג בשלב 2.10 חמוריםctly בשקופית מצופה silane. </li><li style=";text-align:right;direction:rtl"> בואו יבש מקום לכ -5 דקות ב RT. </li><li style=";text-align:right;direction:rtl"> Re-מימה ידי לאט ובעקיפין pipetting 500 ליטר μ של PBS בירידה ליד מקום RCF ולתת לה לזרום על ידי הטיית השקופיות. מסננים את PBS העודף מהצד. </li><li style=";text-align:right;direction:rtl"> בלוק על ידי כיסוי המדגם עם 500 μ l של / 5% אלבומין בסרום שור PBS (BSA) לשעה 2 ב RT. </li><li style=";text-align:right;direction:rtl"> לשטוף את השקופית 3 פעמים על ידי בעדינות ובעקיפין pipetting 500 ליטר μ של PBS על המדגם. הטה את השקופית כדי לנקז את PBS העודף. </li><li style=";text-align:right;direction:rtl"> דגירה המדגם עם נוגדן ראשוני נגד החלבון הנגיפי E2A מחייב DNA (B6-8 9) בדילול 1: 500 ב PBS עבור שעה 2 ב RT. מכסה את המדגם הבחין עם 20 μ l של פתרון נוגדן דגירה בתא לח כדי למנוע התייבשות. </li><li style=";text-align:right;direction:rtl"> לשטוף את המדגם 3 פעמים עם PBS Tween / 0.02% 20 על ידי בעדינות ובעקיפין pipetting 500 μ l של PBS על המדגם. הטה את השקופית כדי לנקז את לשעברפתרון לשטוף סס. </li><li style=";text-align:right;direction:rtl"> דגירה הדגימות עם נוגדן אנטי עכבר IgG המשני מצמידים את fluorophore שהלהיב ב 488 ננומטר בדילול 1: 2,000 ב PBS, עבור שעה 1 ב 4 מעלות צלזיוס. מכסה את המדגם הבחין עם 20 μ l של פתרון נוגדן דגירה בתא לח כדי למנוע התייבשות. </li><li style=";text-align:right;direction:rtl"> לשטוף את המדגם 3 פעמים עם PBS Tween / 0.02% 20 על ידי בעדינות ובעקיפין pipetting 500 μ l של PBS על המדגם. הטה את השקופית כדי לנקז את הפתרון לשטוף העודף. </li><li style=";text-align:right;direction:rtl"> מכסה את המדגם הבחין בשקופית עם coverslip באמצעות 2 μ l גליצרול / 10% PBS כהרכבה בינונית. חותם עם לק ברור וחנות אל -20 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> ניתוח הדגימות באמצעות מיקרוסקופ פלואורסצנטי, עם מטרת 63x ומספרי צמצם 1.4 (NA) באורך גל של 488 ננומטר. </li></ol>

<ol>
	<li>Doucas, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+replication+is+coupled+with+the+dynamic+properties+of+the+PML+nuclear+structure.">Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure.</a> Genes &#38; Dev. 10, 196-207 (1996).</li><li>Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+virus+replication+compartments.">DNA virus replication compartments.</a> J. Virol. 88, 1404-1420 (2014).</li><li>Boon, J. A., Diaz, A., Ahlquist, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+viral+replication+complexes.">Cytoplasmic viral replication complexes.</a> Cell host microbe. 8, 77-85 (2010).</li><li>Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphological+and+biochemical+characterization+of+the+membranous+hepatitis+C+virus+replication+compartment.">Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment.</a> J. Virol. 87, 10612-10627 (2013).</li><li>Busch, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+Nucleoli.">Isolation of Nucleoli.</a> Exp Cell Res. 24, 150-163 (1963).</li><li>Lam, Y. W., Lyon, C. E., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+isolation+of+Cajal+bodies+from+HeLa+cells.">Large-scale isolation of Cajal bodies from HeLa cells.</a> Mol. Biol. Cell. 13, 2461-2473 (2002).</li><li>Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+nucleolus.">The nucleolus.</a> J Cell Sci. 118, 1335-1337 (2005).</li><li>Groitl, P., Dobner, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+adenovirus+type+5+early+region+1+and+4+virus+mutants.">Construction of adenovirus type 5 early region 1 and 4 virus mutants.</a> Methods Mol Med. 130, 29-39 (2007).</li><li>Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibodies+which+recognize+native+and+denatured+forms+of+the+adenovirus+DNA-binding+protein.">Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein.</a> Virology. 128, 480-484 (1983).</li><li>Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+effects+on+adenovirus+late+gene+expression+of+deleting+the+E1b+55K+protein.">Selective effects on adenovirus late gene expression of deleting the E1b 55K protein.</a> J Gen Virol. 74 (Pt 4), 575-582 (1993).</li><li>Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+E1B+55-kilodalton+protein+is+required+for+both+regulation+of+mRNA+export+and+efficient+entry+into+the+late+phase+of+infection+in+normal+human+fibroblasts.">Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts.</a> J. Virol. 80, 964-974 (2006).</li><li>Castillo-Villanueva, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Mre11+Cellular+Protein+Is+Modified+by+Conjugation+of+Both+SUMO-1+and+SUMO-2/3+during+Adenovirus+Infection.">The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection.</a> ISRN Virology. 2014, 14 (2014).</li><li>Morris, S. J., Scott, G. E., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+late-phase+infection+is+controlled+by+a+novel+L4+promoter.">Adenovirus late-phase infection is controlled by a novel L4 promoter.</a> J. Virol. 84, 7096-7104 (2010).</li><li>Wright, J., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+adenovirus+5+L4+promoter+is+activated+by+cellular+stress+response+protein+p53.">The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53.</a> J. Virol. 87, 11617-11625 (2013).</li></ol>

The authors have nothing to disclose.

In order to elucidate the molecular mechanisms that govern regulation of cellular activities by viral infection understanding the composition and activities associated with RC would be instrumental. Therefore, to make a detailed analysis of RC, we established a cell-free system that takes advantage of the size and biochemical composition of these virus-induced structures, to isolate subnuclear fractions enriched with RC using a simple procedure that relies on velocity gradients with sucrose cushions. Critical steps of the procedure that require standardization depending on the cell type used are: i) standardization of the times used for cell swelling to avoid disruption of nuclei; ii) formation of the sucrose gradients so that fractions can be properly separated; iii) constant monitoring of the samples throughout the procedure by bright field microscopy; iv) sonication time and intensity to ensure that all nuclei are lysed but RC are not disrupted; v) all fractionation steps should be carried out on ice to avoid disruption of nuclear structures. 
Limitations of the technique that can be encountered or can be anticipated are: i) that nucleoli and perhaps other subnuclear structures or domains that share similar dimensions and biochemical composition are coisolated in the RC fraction, making the relative abundance of replication compartments versus other similar nuclear bodies variable depending on the virus, cell type and time post-infection used for their isolation; ii) it is possible that just as the size and composition of RC changes as the replication cycle of the virus progresses, the compactness of the RC particles may also change, making it necessary to perform experiments designed to determine detailed ultrastructural changes of the RC particles at different times post-infection to evaluate not only changes in the particles composition and activities, but whether their stability may vary. While these issues may limit the characterization of RC composition and activities at various different times post-infection, as less stable RC obtained by this procedure may not recapitulate their counterpart in the infected cell nucleus, such limitations may be overcome by using higher multiplicities of infection or by determining the times post-infection at which viral RC have attained a minimum size and abundance in the infected cell nucleus. These potential limitations notwithstanding, the technique reported here provides several advantages over the analysis that has hitherto solely relied on microscopy; namely that the precise biochemical and functional analysis of RC can be performed using this novel approach. 
We show here that the RC-fractions (RCf) obtained are enriched with bona fide RC markers, such as the viral E2-72K DBP protein, viral DNA and RNA. Using biochemical analysis by immunoblotting and PCR, we have confirmed that this approach facilitates the detailed analysis of components and activities associated to RC and should help unravel molecular mechanisms that regulate virus-host cell interactions in the infected-cell nucleus. 
It is well established that DNA replication, transcription and post-transcriptional processing of viral late mRNA are closely associated to viral replication compartments, events that lead to viral progeny production2,11,12. In adenovirus-infected cells the onset of viral DNA replication marks the transition to the late phase of infection and results in the activation of the Major Late promoter, which directs the production of high quantities of viral late transcripts. However, the L4 genes are expressed through a novel promoter (L4P) that is independent from the MLP13,14. Besides this complex program of late promoter activation, the selection of 3&#8217; splice sites for longer introns is progressively favored as the late phase proceeds. In addition, production of these transcripts is regulated by their selective release from the site of synthesis and by selective export to the cytoplasm. 
However, regulation of the late promoters and molecular events that lead to the selective production of viral late mRNA is incompletely understood. Therefore, as a proof of concept for the procedure reported here, we demonstrate that viral DNA and viral late mRNA can be isolated in RCf, suggesting that these subnuclear fractions can be used to determine the pattern of synthesis and partitioning of different species of viral late mRNA, hence allowing the use of quantitative techniques and potentially advancing the detailed study of the complex pattern of viral late mRNA biogenesis. 
Furthermore, this technique can be used to study the molecular mechanisms that are responsible for the efficient replication of the viral genome, regulation of the complex program of viral gene transcription and cellular factors that are co-opted in RC, as well as morphological and ultrastructural studies of these viral induced structures. Moreover this system should be easily adapted to isolate RC from other nuclear replicating viruses, and should help unravel viral mechanisms that govern virus-cell interactions.

Adenoviruses מכיל הגנום גדילי דנ&quot;א כפול שמשכפל בגרעין התא הנגוע. כאשר ה- DNA הנגיפי נכנס לגרעין, זה localizes סמוך לגופים גרעיניים PML 1. בעקבות ביטוי גנים נגיפי מוקדם, הארכיטקטורה הגרעינית היא מחדש באופן דרמטי, וישכנע היווצרות של מייקרו-סביבות נגיפיות, המכונה תאים לנגיפיים שכפול (RC) 2. מאז אדנווירוס RC (מודעות) הם אתרים שבם שכפול הגנום נגיפי וביטוי של גנים נגיפיים מאוחר יתקיימו, הם מספקים סביבה לגיוס של כל הגורמים הנגיפיים וסלולריים הצורך המשתתפים בתהליכים אלה. מעניין, מגוון רחב של חלבונים תאיים אחראים לתגובה אנטי הסלולרית, כגון תגובת הנזק לדנ&quot;א, התגובה החיסונית המולדת ודיכוי גידול הם לאתרים הנגיפיים אלה 2 נבחרים. רכזות רגולציה מכאן, יכול להיחשב מודעות RC המקדמות שכפול נגיפי יעיל תוך הסדרה במקבילתגובה תאית אנטי, מצביעה על כך שהמבנים אלה הם מפתח להבנת אינטראקציות תא-מארח וירוס. עם זאת, המנגנונים המולקולריים של היווצרות RC, הרכבם והפעילויות נלוות הם הבינו היטב. Adenoviral RC, כמו גם RC מוירוסים DNA אחרים שלשכפל בגרעין אינם קשור לקרומים, בניגוד לRC cytoplasmic 3. יתר על כן, מבנים מושרה וירוס אלה עשויים להיות מורכבים כולו מחלבונים וחומצות גרעין. RC נוצר בתאים נגועים בווירוסי RNA (בדרך כלל מכונה מפעלים נגיפיים) היה מבודד, מנצל הלוקליזציה שלהם cytoplasmic ומעמד קרום הנכנס, אשר הקלה המורפולוגיות מפורטות שלהם, אפיון פונקציונלי ויוכימיים 4. למיטב ידיעתנו, RC הנגיפי גרעיני לא היה מבודד, אולי בשל המורכבות של הארכיטקטורה והיעדר הגרעיניים של מטר intranuclearembranes שיאפשר בידודם. מחקרם הסתמך במקום על מיקרוסקופיה immunofluorescence, דגים ומיקרוסקופים אלקטרונים הילוכים. עם זאת, למרות סיבוכים הגלומים לבידוד מבני subnuclear, תחומים גרעיניים אחרים כגון nucleoli וגופים קחל היו מבודדים לפני 5,6. מאז nucleoli וRC שניהם מורכבים מחלבונים וחומצות גרעין, ויש קוטר בין 0.5-5 מיקרומטר, שערנו כי RC צריך להיות גם נוח לבידוד. לכן, על מנת לאפיין את ההרכב המולקולרי ופונקציות הקשורות לRC מדויק יותר, הקמנו שיטה חדשה לבודד את השברים subnuclear מועשרים בRC. לשם כך, אנחנו מוכנים שברים תת-גרעיני באמצעות הדרגתיים מהירות וכריות סוכרוז דומה לנהלים המשמשים לבודד nucleoli 7 או תחומים גרעיניים אחרים 6 והקמנו מערכת תא ללא שמאפשרת הלימוד של ההרכב המולקולרי ופעילויות הקשורות לRC. טכניקה זו ולכן צריכה לקדם את ההבנה של אינטראקציות תא-מארח וירוס ומהווה כלי רב עוצמה שצריכה גם להקל על הניתוח מפורט של RC מוירוסים אחרים שלשכפל בגרעין ולגרום להיווצרות של תאי שכפול של ממדים דומים לאלה שנוצרו בadenovirus- נגועים בתאים, כגון, herpesviruses, papillomaviruses או polyomaviruses.

<table><tbody><tr><td>DMEM</td><td>Gibco</td><td>12100-046</td><td>Warm in 37 &amp;ordm;C water bath before use</td></tr><tr><td>Fetal Bovine Serum</td><td>Gibco</td><td>12484-028</td><td></td></tr><tr><td>Sucrose, Ultra Pure</td><td>Research Organics</td><td>0928S</td><td>Prepare a 2.55 M stock solution and store at 4 &amp;ordm;C</td></tr><tr><td>Dounce homogenizer</td><td>Kontess Glass Company</td><td>884900-0000</td><td></td></tr><tr><td>Branson 1800 Ultrasonic Bath</td><td>Branson</td><td>Z769533&amp;nbsp;SIGMA</td><td>Turn on 15 min before use.</td></tr><tr><td>Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate</td><td>Life Technologies</td><td>A-21121</td><td>Use at a 1:2,000 dilution in PBS</td></tr><tr><td>Silane-Prep Slides</td><td>Sigma</td><td>S4651-72EA</td><td>Open in a laminar flow cabinet</td></tr><tr><td>SuperSignal West Pico Chemiluminescent Substrate</td><td>Pierce ThermoScientific</td><td>34080</td><td></td></tr></tbody></table>

isolation of viral replication compartment-enriched sub-nuclear fractions from adenovirus-infected normal human cells

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments through the recruitment of viral and cellular proteins to sites occupied by the viral genome. These sites, called replication compartments (RC), can be considered viral-induced nuclear domains where the viral genome is localized and viral and cellular proteins that participate in replication, transcription and post-transcriptional processing are recruited. Moreover, cellular proteins involved in the antiviral response, such as tumor suppressor proteins, DNA damage response (DDR) components and innate immune response factors are also co-opted to RC. Although RC seem to play a crucial role to promote an efficient and productive replication cycle, a detailed analysis of their composition and associated activities has not been made. To facilitate the study of adenoviral RC and potentially those from other DNA viruses that replicate in the cell nucleus, we adapted a simple procedure based on velocity gradients to isolate Ad RC and established a cell-free system amenable to conduct morphological, functional and compositional studies of these virus-induced subnuclear structures, as well as to study their impact on host-cell interactions.

מאז תאים נגיפיים שכפול (RC) הם מבנים הנוצרים על-נגיפיים subnuclear המורכב מחלבונים וחומצות גרעין, בדומה לתחומים אחרים גרעיניים, הם הוכיחו שניתנים לבידוד על ידי מילויים מהירות המבוססים על תכונות ביוכימיות. צעדים קריטיים בפרוטוקול חלוקה הם באיור 1. בכל שלב הדגימות צריכים להיות במעקב על ידי מיקרוסקופ שדה הבהיר כדי להבטיח את השלמות של שברי משנה הסלולר השונים. לדוגמא, כאשר נפיחות התאים, זמן דגירה במאגר hypotonic צריך להיות אחיד כדי להתנפח ציטופלסמה הימנעות נזק לגרעינים. לאחר הומוגניזציה תא, גרעינים שלמים, ללא רכיבים cytoplasmic כוללים ממברנות reticulum endoplasmic, צריך לקבל. כמו כן, זמן sonication צריך להיות אחיד כדי לקרוע את קרום הגרעין של כל התאים מבלי לשבש RC. לאחר קבלת השברים תת-גרעיניים, מפתחבקרות צריכה להיכלל כדי לקבוע את העמותה והעשרה של סמני RC בתום לב בRCF. Adenoviral RC הם דמיינו נפוצים בתאים נגועים על ידי immunofluorescence באמצעות נוגדנים נגד החלבון הנגיפי E2A-72K (DBP). DBP הוא חלבון נגיפי המשתתף ישירות בשכפול הגנום נגיפי; לכן, הנוכחות של DBP בחלקיקים המועשר בRCF מדגימה עמותה הישירה של חלבון נגיפי זה עם החלקיקים הבודדים, כפי שמוצגת באיור 1. יתר על כן, זיהוי של DBP בRCF ידי מערבי כתם מאשר את העמותה של חלבון זה לבודד RC. באיור 2 הוא הראה כי על ידי פעמים מאוחר לאחר זיהום (36 HPI), DBP מועשר בRCF לעומת חלק nucleoplasmic (NPL), הוכחה כי RC שהושג עם הליך זה בזמנים שונים לאחר ההדבקה משקפת צפויה זמנית דפוס של עמותת DBP לRC. מרכיב ויראלי חיוני של RC הוא itse DNA הנגיפיLF. בניסויים כמו שמוצגים באיור 3 אנו מראים כי כמויות גדלות והולכות של חבר ה- DNA הנגיפי עם RCF כמחזור השכפול של הנגיף מתקדם, המצביעים על כך, כפי שלDBP, הדפוס הזמני של שכפול הדנ&quot;א שבברים אלה יכולים להיות גם למד. חוץ מזה המכיל חלבונים נגיפיים והגנום הנגיפי, RC גם אתרים של ביטוי גנים נגיפי מאוחר. באיור 4 אנו מציגים תוצאות נציג של ניסויים שנועדו למדוד על ידי RT-PCR הרמה של מינים שונים של mRNA מאוחר הנגיפי וההפרדה ביניהם RCF וNPL ב 36 HPI. mRNA ויראלי מאוחר מסונתז בRC ועיבוד postranscriptional יוזם באתרים אלה; מאוחר יותר אלה mRNA ויראלי לנתק מRC, משוחררים לnucleoplasm, ולאחר מכן ייצא לציטופלסמה. הבריכה הכוללת של mRNA מאוחר הנגיפי הבוגר (ML mRNA) נמדדה באמצעות פריימרים שלהגביר צומת אקסון של המנהיג המשולש,רצף שמהווה 5 &#39;של כל mRNA מאוחר adenoviral (איור 4 א). צמתים אקסון בmRNA של תמלילים בוגרים ספציפיים של L2, משפחות L4 וL5 נמדדו גם. זה כבר נקבע כי כשלב המאוחר של מחזור השכפול הנגיפי מתקדם, כמויות גדלות והולכות של mRNA מאוחר הנגיפי מיוצאות לציטופלסמה; עם זאת, על ידי ייצור פעמים המאוחר של מיני L5 mRNA מגביר עוד יותר בהשוואה למשפחות mRNA מאוחר האחרות. בתוצאות הנציג נזרעו באיור 4 הבדל כ 2.5 פי בML mRNA הוא ציין בNPL לעומת RCF, כצפוי. מעניין כאשר אנו משווים mRNA ממשפחות ספציפיות, מופיעים שני L2 וL4 mRNA להיות מופצים ברמות דומות בין שני השברים subnuclear (איור 4 ו- C, בהתאמה), ואילו בניגוד לכך, ה- mRNA L5 הראה עלייה כמעט פי 2 בNPL בהשוואה לRCF. תוצאות אלו מצביעות על תבנית ההפרש בסאים<html> nthesis ושחרור של מיני mRNA מאוחר נגיפיים השונים מRC adenoviral (כפי שכבר הציע לפני 10). באופן משמעותי, תוצאות אלה גם מראים כי מדידות מדויקות של השלבים השונים בbiogenesis של mRNA ויראלי יכולות להתבצע באמצעות RC המבודד עם הליך הרומן הזה. <img alt="איור 1" src="/files/ftp_upload/53296/53296fig1.jpg" /> איור 1. מואר שדה מיקרוסקופית של שלבים שונים במהלך הליך הפלזמה. במהלך הבידוד של RC, הדגימות צריכים להיות במעקב על ידי מיקרוסקופ אופטי כדי להבטיח את השלמות של שברי משנה הסלולר. איור מציג את השלבים המשמשים בהליך לקבלת RCF, מהנפיחות של תאי HFF, להפרדת גרעינים ובידוד של RCF באמצעות כריות סוכרוז. 40x micrographs: סרגל קנה מידה 50 μ מ &#39;; 63x micrographs: סרגל קנה מידה 5 μ מ &#39;; DBP מוצג בירוק.תב&quot;ע: &quot;target =&quot; _ //www.jove.com/files/ftp_upload/53296/53296fig1large.jpg blank &quot;&gt; לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו. <img alt="איור 2" src="/files/ftp_upload/53296/53296fig2.jpg" /> איור 2. מערבי כתם נגד DBP. הדגימות מנותחות על ידי SDS-PAGE ומעובד לכתם מערבי נגד DBP, סמן תום לב של RC ויראלי. כדי לקבוע את ההעשרה של החלבון בRCF, כדאי להשוות את הנוכחות ושפע יחסי של DBP בשני RCF וNPL בזמנים שונים לאחר הדבקה. בתאי HFF 16 HPI מייצג את הזמן מוקדם במהלך מחזור שכפול adenoviral; 24 HPI מסמן את המעבר לשלב המאוחר של זיהום כסינתזת ה- DNA נגיפי מתחילה; 36 HPI מייצג לאחר זיהום מאוחר זמן. המסה המולקולרית הצפויה של DBP מוצגת. <a href="https://www.jove.com/files/ftp_upload/53296/53296fig2large.jpg" target="_blank">אנא Clic</a>k כאן כדי לצפות בגרסה גדולה יותר של דמות זו. <img alt="איור 3" src="/files/ftp_upload/53296/53296fig3.jpg" /> איור 3. PCR Assay לזיהוי נגיפי DNA (vDNA) בRCF. DNA היה מטוהר מRCF וNPL ב 24 ו -36 HPI. ה- DNA הנגיפי היה מוגבר על ידי PCR באמצעות פריימרים ספציפיים להגנום הנגיפי. הגרף מראה את ההעשרה של ה- DNA הנגיפי בRCF ב 36 HPI. <a href="https://www.jove.com/files/ftp_upload/53296/53296fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 4" src="/files/ftp_upload/53296/53296fig4.jpg" /> .. איור 4. ניתוח של נגיפי RNA המאוחר mRNA היה מבודד מRCF וNPL ונותח על ידי RT-PCR לגילוי mRNA מאוחר נגיפי הספציפי () סה&quot;כ ויראלי המאוחר mRNA (ML: רס&quot;ן המאוחר); (ב) mRNA מL2 משפחה; (ג) mRNA ממשפחת L4; (ד) mRNA ממשפחת L5. ערכים מייצגים ממוצע ± סטיית תקן של דגימות בשלושה עותקים. <a href="https://www.jove.com/files/ftp_upload/53296/53296fig4large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <table border="0" fo:keep-together.within-page="1" style=";text-align:right;direction:rtl"><tbody><tr><td> שֵׁם </td><td> רצף קדימה פריימר (5&#39;-3 &quot;) </td><td> רצף הפוך פריימר (5&#39;-3 &quot;) </td><td> טמפרטורת חישול </td></tr><tr><td> ML mRNA </td><td> GCCTCCGAACGGTACTCCGCC </td><td> CGCCACGGTGCTCAGCCTACC </td><td> 60 מעלות צלזיוס </td></tr><tr><td> L2 mRNA </td><td> GTCACAGTCGCAAGATGTCCAAGC </td><td> GCAACGCCAGCATGTCCTTATGC </td><td> 58 מעלות צלזיוס </td></tr><tr><td> L4 mRNA </td><td> CCTCCGAACGGTACTCCGC </td><td> CCTTGCTCATCTTGCGACTGTG </td><td> 58 מעלות צלזיוס </td></tr><tr><td> L5 mRNA </td><td> GTCACAGTCGCAAGATGAAGCG </td><td> GGTAACTAGAGGTTCGGATAGGCG </td><td> 60 מעלות צלזיוס </td></tr></tbody></table> . טבלת 1. Primers משמש לויראלי המאוחר mRNA הגברה ML mRNA: פריימרים אלה מאפשרים ההגברה של אזור בתוך המנהיג המשולש, הרצף 5 &#39;שמשותף לכל mRNA מאוחר הנגיפי; פריימרים L2 mRNA מאפשרים ההגברה של אזור מסוים בתוך mRNA PV; פריימרים L4 mRNA מאפשרים ההגברה של אזור מסוים בתוך 100 K mRNA; L5 mRNA מאפשר ההגברה של אזור בתוך mRNA הסיבים. טמפרטורות הרצף וחישול עבור כל חסודאה מוצגים.

Watch this Scientific Journal Video about Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells at JoVE.com

Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC.

בידוד של שברים תת-גרעיניים מועשרים-תא ויראלי שכפול מתאים נורמלים אדם נגוע Adenovirus

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments ...

isolation-viral-replication-compartment-enriched-sub-nuclear

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

8.7K Views.  Universidad Autónoma del Estado de Morelos. We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC. 

Video: Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

Preparation of Viral DNA from Nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. Several downstream applications require large quantities of pure viral DNA, which is provided by this protocol. These applications include viral genome sequencing, where the removal of host DNA is crucial to optimize data output for viral sequences, and the production of new viral recombinant strains, where co-transfection of purified plasmid and linear viral DNA facilitates recombination.1,2,3 
This procedure utilizes a combination of extractions and density-based centrifugation to isolate purified linear herpesvirus nucleocapsid DNA from infected cells.4,5 The initial purification steps aim to isolate purified viral capsids, which contain and protect the viral DNA during the extractions and centrifugation steps that remove cellular proteins and DNA. Lysis of nucleocapsids then releases viral DNA, and two final phenol-chloroform steps remove remaining proteins. The final DNA captured from solution is highly concentrated and pure, with an average OD260/280 of 1.90. Depending on the quantity of infected cells used, yields of viral DNA range from 150-800 &mu;g or more. The purity of this DNA makes it stable during long-term storage at 4C. This DNA is thus ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections. 
Prior to beginning the protocol, it is important to know the average number of cells per dish (e.g. an average of 8 x 106 PK-15 cells in a confluent 15 cm dish), and the titer of the viral stock to be used (e.g. 1 x 108 plaque-forming units per ml). These are necessary to calculate the appropriate multiplicity of infection (MOI) for the protocol.6 For instance, to infect one 15 cm dish of PK-15 cells with the above viral stock, at an MOI of 5, you would use 400 &mu;l of viral stock and dilute it with 3.6 ml of medium (total inoculation volume of 4 ml for one 15 cm plate).
Multiple viral DNA preparations can be prepared at the same time. The number of simultaneous preparations is limited only by the number of tubes held by the ultracentrifuge rotor (one per virus; see step 3.9 below). Here we describe the procedure as though being done for one virus.

We describe the process of isolating high purity herpesvirus nucleocapsid DNA from infected cells. The final DNA captured from solution is of high concentration and purity, making it ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections to produce new viral recombinants.

ההכנה של ה-DNA ויראלי של Nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. ...

Efficient Recombinant Parvovirus Production with the Help of Adenovirus-derived Systems

Rodent parvoviruses (PV) such as rat H-1PV and MVM, are small icosahedral, single stranded, DNA viruses. Their genome includes two promoters P4 and P38 which regulate the expression of non-structural (NS1 and NS2) and capsid proteins (VP1 and VP2) respectively1. They attract high interest as anticancer agents for their oncolytic and oncosuppressive abilities while being non-pathogenic for humans2. NS1 is the major effector of viral cytotoxicity3. In order to further enhance their natural antineoplastic activities, derivatives from these vectors have been generated by replacing the gene encoding for the capsid proteins with a therapeutic transgene (e.g. a cytotoxic polypeptide, cytokine, chemokine, tumour suppressor gene etc.)4. The recombinant parvoviruses (recPVs) vector retains the NS1/2 coding sequences and the PV genome telomeres which are necessary for viral DNA amplification and packaging. Production of recPVs occurs only in the producer cells (generally HEK293T), by co-transfecting the cells with a second vector (pCMV-VP) expressing the gene encoding for the VP proteins (Fig. 1)4. The recPV vectors generated in this way are replication defective. Although recPVs proved to possess enhanced oncotoxic activities with respect to the parental viruses from which they have been generated, their production remains a major challenge and strongly hampers the use of these agents in anti-cancer clinical applications.
We found that introduction of an Ad-5 derived vector containing the E2a, E4(orf6) and the VA RNA genes (e.g. pXX6 plasmid) into HEK293T improved the production of recPVs by more than 10 fold in comparison to other protocols in use. Based on this finding, we have constructed a novel Ad-VP-helper that contains the genomic adenoviral elements necessary to enhance recPVs production as well as the parvovirus VP gene unit5. The use of Ad-VP-helper, allows production of rec-PVs using a protocol that relies entirely on viral infection steps (as opposed to plasmid transfection), making possible the use of cell lines that are difficult to transfect (e.g. NB324K) (Fig. 2). We present a method that greatly improves the amount of recombinant virus produced, reducing both the production time and costs, without affecting the quality of the final product5. In addition, large scale production of recPV (in suspension cells and bioreactors) is now conceivable.

Here we describe a protocol based only on cell infection, which improves the efficiency of recombinant parvovirus production by more than 100 fold in comparison to other protocols in use. This protocol relies on the use of a novel adenovirus 5-based helper containing the parvovirus VP transcription unit (Ad-VP).

ייצור יעיל Parvovirus רקומביננטי בעזרת adenovirus הנגזרות מערכות

Rodent parvoviruses (PV) such as rat H-1PV and MVM, are small icosahedral, single stranded, DNA viruses. Their genome includes two promoters P4 and P38 ...

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the single-stranded genome is encapsidated by the nucleoprotein (NP), and associated with the trimeric polymerase complex consisting of the PA, PB1, and PB2 subunits. However, in contrast to most RNA viruses, influenza viruses perform viral RNA synthesis in the nuclei of infected cells. Interestingly, viral mRNA synthesis uses cellular pre-mRNAs as primers, and it has been proposed that this process takes place on chromatin1. Interactions between the viral polymerase and the host RNA polymerase II, as well as between NP and host nucleosomes have also been characterized1,2.
Recently, the generation of recombinant influenza viruses encoding a One-Strep-Tag genetically fused to the C-terminus of the PB2 subunit of the viral polymerase (rWSN-PB2-Strep3) has been described. These recombinant viruses allow the purification of PB2-containing complexes, including vRNPs, from infected cells. To obtain purified vRNPs, cell cultures are infected, and vRNPs are affinity purified from lysates derived from these cells. However, the lysis procedures used to date have been based on one-step detergent lysis, which, despite the presence of a general nuclease, often extract chromatin-bound material only inefficiently. 
Our preliminary work suggested that a large portion of nuclear vRNPs were not extracted during traditional cell lysis, and therefore could not be affinity purified. To increase this extraction efficiency, and to separate chromatin-bound from non-chromatin-bound nuclear vRNPs, we adapted a step-wise subcellular extraction protocol to influenza virus-infected cells. Briefly, this procedure first separates the nuclei from the cell and then extracts soluble nuclear proteins (here termed the "nucleoplasmic" fraction). The remaining insoluble nuclear material is then digested with Benzonase, an unspecific DNA/RNA nuclease, followed by two salt extraction steps: first using 150 mM NaCl (termed "ch150"), then 500 mM NaCl ("ch500") (Fig. 1). These salt extraction steps were chosen based on our observation that 500 mM NaCl was sufficient to solubilize over 85% of nuclear vRNPs yet still allow binding of tagged vRNPs to the affinity matrix.
After subcellular fractionation of infected cells, it is possible to affinity purify PB2-tagged vRNPs from each individual fraction and analyze their protein and RNA components using Western Blot and primer extension, respectively. Recently, we utilized this method to discover that vRNP export complexes form during late points after infection on the chromatin fraction extracted with 500 mM NaCl (ch500)3.

Influenza viruses replicate their RNA genome in association with host-cell chromatin. Here, we present a method to purify intact viral ribonucleoprotein complexes from the chromatin of infected cells. Purified viral complexes can be analyzed by both Western blot and primer extension of protein and RNA content, respectively.

זיקה טיהור של נגיף השפעת תסביכים Ribonucleoprotein של הכרומטין של תאים נגועים

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification and Visualization of Influenza A Viral Ribonucleoprotein Complexes

The influenza A viral genome consists of eight negative-sense, single stranded RNA molecules, individually packed with multiple copies of the influenza A nucleoprotein (NP) into viral ribonulceoprotein particles (vRNPs). The influenza vRNPs are enclosed within the viral envelope. During cell entry, however, these vRNP complexes are released into the cytoplasm, where they gain access to the host nuclear transport machinery. In order to study the nuclear import of influenza vRNPs and the replication of the influenza genome, it is useful to work with isolated vRNPs so that other components of the virus do not interfere with these processes. Here, we describe a procedure to purify these vRNPs from the influenza A virus. The procedure starts with the disruption of the influenza A virion with detergents in order to release the vRNP complexes from the enveloped virion. The vRNPs are then separated from the other components of the influenza A virion on a 33-70% discontinuous glycerol gradient by velocity sedimentation. The fractions obtained from the glycerol gradient are then analyzed on via SDS-PAGE after staining with Coomassie blue. The peak fractions containing NP are then pooled together and concentrated by centrifugation. After concentration, the integrity of the vRNPs is verified by visualization of the vRNPs by transmission electron microscopy after negative staining. The glycerol gradient purification is a modification of that from Kemler et al. (1994)1, and the negative staining has been performed by Wu et al. (2007).2

The genome of the influenza A virus consists of eight separate complexes of RNA and proteins, termed viral ribonucleoprotein complexes (vRNPs). This paper describes the glycerol gradient purification and transmission electron microscopy visualization of influenza A vRNPs.

טיהור ויזואליזציה של שפעת מכלולים Ribonucleoprotein ויראלי

The influenza A viral genome consists of eight negative-sense, single stranded RNA molecules, individually packed with multiple copies of the influenza A ...

Biology

Adenoviral Transduction of Naive CD4 T Cells to Study Treg Differentiation

Regulatory T cells (Tregs) are essential to provide immune tolerance to self as well as to certain foreign antigens. Tregs can be generated from naive CD4 T cells in vitro with TCR- and co-stimulation in the presence of TGF&beta; and IL-2. This bears enormous potential for future therapies, however, the molecules and signaling pathways that control differentiation are largely unknown.
Primary T cells can be manipulated through ectopic gene expression, but common methods fail to target the most important naive state of the T cell prior to primary antigen recognition. Here, we provide a protocol to express ectopic genes in naive CD4 T cells in vitro before inducing Treg differentiation. It applies transduction with the replication-deficient adenovirus and explains its generation and production. The adenovirus can take up large inserts (up to 7 kb) and can be equipped with promoters to achieve high and transient overexpression in T cells. It effectively transduces naive mouse T cells if they express a transgenic Coxsackie adenovirus receptor (CAR). Importantly, after infection the T cells remain naive (CD44low, CD62Lhigh) and resting (CD25-, CD69-) and can be activated and differentiated into Tregs similar to non-infected cells. Thus, this method enables manipulation of CD4 T cell differentiation from its very beginning. It ensures that ectopic gene expression is already in place when early signaling events of the initial TCR stimulation induces cellular changes that eventually lead into Treg differentiation.

Adenoviral gene transfer into naive CD4 T cells with transgenic expression of the Coxsackie adenovirus receptor enables the molecular analysis of regulatory T cell differentiation in vitro.

התמרה adenoviral של CD4 תמימים תאי T ללמוד בידול Treg

Regulatory T cells (Tregs) are essential to provide immune tolerance to self as well as to certain foreign antigens. Tregs can be generated from naive CD4 ...

Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging

Cardiac myocytes isolated from adult hearts are widely accepted as a model somewhere half way between embryonic and neonatal muscle cells on one side and a working heart on the other. Thus, cardiomyocytes serve as good models for cardiac cellular physiology and pathophysiology, for pharmaceutical investigations as well as for the exploration of transgenic animal models. Here we describe a method of isolating the cells from the heart. Furthermore we show how a genetic manipulation on cardiac myocytes can be performed without breeding a transgenic animal: This is the combination of long term culture (1 week) and adenoviral gene transfer. The latter one is described from the construction of the virus to the transduction of the cells. It can be used for the expression of genetically encoded biosensors (GEBs), fluorescent fusion proteins, but also for protein over expression and down regulation, e.g. using RNAi. Here we provide an example for the expression of a fusion protein staining a subcellular structure (Golgi). Such protein expression can be visualized by confocal imaging of z-stacks for a 3D-reconstruction of subcellular structures. The protocol comprises state-of-the-art in cell culture, molecular biology and biophysics and thus provides an approach for exploring new horizons in cellular cardiology.

Adult cardiac myocytes are primary cells that can be isolated from animal hearts and cultured for several days. Within this culture period adenoviral gene transfer can be used to express genetically encoded biosensors (GEBs) or fluorescent fusion proteins. Both approaches allow cellular investigations by means of confocal microscopy.

בידוד מניפולציה גנטית של Myocytes לב למבוגרים הדמיה confocal

Cardiac myocytes isolated from adult hearts are widely accepted as a model somewhere half way between embryonic and neonatal muscle cells on one side and ...

An Efficient Method for Adenovirus Production

Adenoviral transduction has the advantage of a strong and transient induction of the expression of the gene of interest into a broad variety of cell types and organs. However, recombinant adenoviral technology is laborious, time-consuming, and expensive. Here, we present an improved protocol using the pAdEasy system to obtain purified adenoviral particles that can induce a strong green fluorescent protein (GFP) expression in transduced cells. The advantages of this improved method are faster preparation and decreased production cost compared to the original method developed by Bert Vogelstein. The main steps of the adenoviral technology are: (1) the recombination of pAdTrack-GFP with the pAdEasy-1 plasmid in BJ5183 bacteria; (2) the packaging of the adenoviral particles; (3) the amplification of the adenovirus in AD293 cells; (4) the purification of the adenoviral particles from cell lysate and culture medium; and (5) the viral titration and functional testing of the adenovirus. The improvements to the original method consist of (i) the recombination in BJ5183-containing pAdEasy-1 by chemical transformation of bacteria; (ii) the selection of recombinant clones by &#8220;negative&#8221; and &#8220;positive&#8221; PCR; (iii) the transfection of AD293 cells using the K2 transfection system for adenoviral packaging; (iv) the precipitation with ammonium sulfate of the viral particles released by AD293 cells in cell culture medium; and (v) the purification of the virus by one-step cesium chloride discontinuous gradient ultracentrifugation. A strong expression of the gene of interest (in this case, GFP) was obtained in different types of transduced cells (such as hepatocytes, endothelial cells) from various sources (human, bovine, murine). Adenoviral-mediated gene transfer represents one of the main tools for developing modern gene therapies.

Here, we present a protocol for adenovirus production using the pAdEasy system. The technology includes the recombination of the pAdTrack and pAdEasy-1 plasmids, the adenovirus packaging and amplification, the purification of the adenoviral particles from cell lysate and culture medium, the viral titration, and the functional testing of the adenovirus.

שיטה יעילה לייצור אדנווירוס

Adenoviral transduction has the advantage of a strong and transient induction of the expression of the gene of interest into a broad variety of cell types ...

Bioengineering

Construction of Adenoviral Vectors using DNA Assembly Technology

Adenoviral vectors have been used as a gene transfer tool in gene therapy for more than three decades. Here, we introduce a protocol to construct an adenoviral vector by manipulating the genomic DNA of wild-type HAdV-7 by using a DNA assembly method. First, an infectious clone of HAdV-7, pKan-Ad7, was generated by fusing the viral genomic DNA with a PCR product from plasmid backbone, comprising of the kanamycin-resistant gene and the origin of replication (Kan-Ori), through DNA assembly. This was done by designing a pair of PCR primers, that contained ~25 nucleotides of the terminal sequence of HAdV-7 inverted terminal repeat (ITR) at the 5' end, a non-cutter restriction enzyme site for HAdV-7 genome in the middle, and a template-specific sequence for PCR priming at the 3' end. Second, an intermediate plasmid-based strategy was employed to replace the E3 region with transgene-expressing elements in the infectious clone to generate an adenoviral vector. Briefly, pKan-Ad7 was digested with dual-cutter restriction enzyme Hpa I, and the fragment containing the E3 region was ligated to another PCR product of plasmid backbone by Gibson assembly to construct an intermediate plasmid pKan-Ad7HpaI. For convenience, restriction-assembly was used to designate the plasmid cloning method of combined restriction digestion and assembly. Using restriction-assembly, the E3 genes in pKan-Ad7HpaI was replaced with a green fluorescent protein (GFP) expression cassette, and the modified E3 region was released from the intermediate plasmid and restored to the infectious clone to generate an adenoviral plasmid pKAd7-E3GFP. Finally, pKAd7-E3GFP was linearized by Pme I digestion and used to transfect HEK293 packaging cells to rescue recombinant HAdV-7 virus. To conclude, a DNA assembly-based strategy was introduced here for constructing adenoviral vectors in general laboratories of molecular biology without the need of specialized materials and instruments.

<meta charset="utf8"></head><body>בניית וקטורים אדנו-ויראליים בטכנולוגיית הרכבת DNA

In this study, an infectious clone of human adenovirus type 7 (HAdV-7) was constructed, and an E3-deleted HAdV-7 vector system was established by modifying the infectious clone. This strategy used here can be generalized to make gene transfer vectors from other wild-type adenoviruses.

בניית וקטורים אדנו-ויראליים בטכנולוגיית הרכבת DNA

Adenoviral vectors have been used as a gene transfer tool in gene therapy for more than three decades. Here, we introduce a protocol to construct an ...

טיהור וקטורי AAV על ידי כרומטוגרפיית זיקה הפרין חד-שלבית

Isolation of Adeno-Associated Viral Vectors Through a Single-Step and Semi-Automated Heparin Affinity Chromatography Protocol

Adeno-associated virus (AAV) has become an increasingly valuable vector for in vivo gene delivery and is currently undergoing human clinical trials. However, the commonly used methods to purify AAVs make use of cesium chloride or iodixanol density gradient ultracentrifugation. Despite their advantages, these methods are time-consuming, have limited scalability, and often result in vectors with low purity. To overcome these constraints, researchers are turning their attention to chromatography techniques. Here, we present an optimized heparin-based affinity chromatography protocol that serves as a universal capture step for the purification of AAVs.
This method relies on the intrinsic affinity of AAV serotype 2 (AAV2) for heparan sulfate proteoglycans. Specifically, the protocol entails the co-transfection of plasmids encoding the desired AAV capsid proteins with those of AAV2, yielding mosaic AAV vectors that combine the properties of both parental serotypes. Briefly, after the lysis of producer cells, a mixture containing AAV particles is directly purified following an optimized single-step heparin affinity chromatography protocol using a standard fast protein liquid chromatography (FPLC) system. Purified AAV particles are subsequently concentrated and subjected to comprehensive characterization in terms of purity and biological activity. This protocol offers a simplified and scalable approach that can be performed without the need for ultracentrifugation and gradients, yielding clean and high viral titers.

Author Spotlight: שיטה משופרת לייצור וטיהור של וקטורים נגיפיים הקשורים לאדנו

This manuscript describes a detailed protocol for the generation and purification of adeno-associated viral vectors using an optimized heparin-based affinity chromatography method. It presents a simple, scalable, and cost-effective approach, eliminating the need for ultracentrifugation. The resulting vectors exhibit high purity and biological activity, proving their value in preclinical studies.

בידוד של וקטורים נגיפיים הקשורים לאדנו באמצעות פרוטוקול כרומטוגרפיית זיקה הפרין חד-שלבי וחצי אוטומטי

Adeno-associated virus (AAV) has become an increasingly valuable vector for in vivo gene delivery and is currently undergoing human clinical trials. ...

בידוד של שברים תת-גרעיניים מועשרים-תא ויראלי שכפול מתאים נורמלים אדם נגוע Adenovirus

Summary

Explore More Videos

Chapters in this video

ההכנה של ה-DNA ויראלי של Nucleocapsids

ייצור יעיל Parvovirus רקומביננטי בעזרת adenovirus הנגזרות מערכות

זיקה טיהור של נגיף השפעת תסביכים Ribonucleoprotein של הכרומטין של תאים נגועים

טיהור ויזואליזציה של שפעת מכלולים Ribonucleoprotein ויראלי

התמרה adenoviral של CD4 תמימים תאי T ללמוד בידול Treg

בידוד מניפולציה גנטית של Myocytes לב למבוגרים הדמיה confocal

שיטה יעילה לייצור אדנווירוס

בניית וקטורים אדנו-ויראליים בטכנולוגיית הרכבת DNA

בניית וקטורים אדנו-ויראליים בטכנולוגיית הרכבת DNA

בידוד של וקטורים נגיפיים הקשורים לאדנו באמצעות פרוטוקול כרומטוגרפיית זיקה הפרין חד-שלבי וחצי אוטומטי