Name: induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)
Uploaded: 2016-03-25T13:00:00.000+00:00
Duration: 7 min 13 s
Description: Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

ברצוננו לכבד את פול ה פטרסון המנוח ד&quot;ר על תרומתו התקדמות המודל MIA, אוטיזם, סכיזופרניה ומחקר. אנו מכירים סרקיס ק Mazmanian עבור אהדתו הגדולה על פרוטוקול זה; רובן מ באיון, איווט גרסיה-פלורס, קארן ג Lencioni, ולסלי א נוימן לסיוע מינהלי; עלי Khoshnan ויאן ג Ko על הסיוע על הצילומים; איליין י סיאו ונטליה Malkova עבור עצתם על אינדוקציה MIA; ג&#39;פרי ס Cochrane, חואקין גוטיירז, קוואן פ לי, חיימה רודריגז, לורנה ג סנדובל, ונטלי א Verduzco לגידול צאן המומחה שלהם. עבודה זו נתמכה על ידי פרס מרכז NIH קונטה (NIH 5P50MH086383-04, לפול ח פטרסון); Autism Speaks (# 7670, לפול ח פטרסון); סימונס קרן (# 322,839, כדי סרקיס ק Mazmanian); אימון NIH גרנט (NIH / NRSA T32GM07616 כדי ק-HC); מלגת מחקר לתואר ראשון קיץ Caltech (SURF) (כדי ZY); Amgen חוקרים תוכנית בקלטק (כדי ZY); ו fr אחוות דוקטוריםאום הלאומית למדע המועצה, טייוואן (המל&quot;ל 101-2917-I-564-039, לו&#39;-LW).

<ol>
	<li>Brown, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiologic+studies+of+exposure+to+prenatal+infection+and+risk+of+schizophrenia+and+autism.">Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism.</a> Dev Neurobiol. 72 (10), 1272-1276 (2012).</li><li>Fatemi, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+viral+theory+of+schizophrenia+revisited:+abnormal+placental+gene+expression+and+structural+changes+with+lack+of+evidence+for+H1N1+viral+presence+in+placentae+of+infected+mice+or+brains+of+exposed+offspring.">The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring.</a> Neuropharmacology. 62 (3), 1290-1298 (2012).</li><li>Shi, L., Tu, N., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+influenza+infection+is+likely+to+alter+fetal+brain+development+indirectly:+the+virus+is+not+detected+in+the+fetus.">Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus.</a> Int J Dev Neurosci. 23 (2-3), 299-305 (2005).</li><li>Knuesel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+abnormal+brain+development+across+CNS+disorders.">Maternal immune activation and abnormal brain development across CNS disorders.</a> Nat Rev Neurol. 10 (11), 643-660 (2014).</li><li>Meyer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+poly(i:C)+exposure+and+other+developmental+immune+activation+models+in+rodent+systems.">Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems.</a> Biol Psychiatry. 75 (4), 307-315 (2014).</li><li>Meyer, U., Feldon, J., Yee, B. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+the+fetal+brain+cytokine+imbalance+hypothesis+of+schizophrenia.">A review of the fetal brain cytokine imbalance hypothesis of schizophrenia.</a> Schizophr Bull. 35 (5), 959-972 (2009).</li><li>Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+prenatal+infection+on+brain+development+and+behavior:+a+review+of+findings+from+animal+models.">Effects of prenatal infection on brain development and behavior: a review of findings from animal models.</a> Brain Behav Immun. 24 (6), 881-897 (2010).</li><li>Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+an+autism+risk+factor+in+mice+leads+to+permanent+immune+dysregulation.">Modeling an autism risk factor in mice leads to permanent immune dysregulation.</a> Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).</li><li>Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+nonspatial+information+processing+in+the+hippocampus+of+the+adult+offspring.">Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring.</a> Brain Behav Immun. 24 (6), 930-941 (2010).</li><li>Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+fetal+brain+development+through+interleukin-6.">Maternal immune activation alters fetal brain development through interleukin-6.</a> J Neurosci. 27 (40), 10695-10702 (2007).</li><li>Shi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+alters+cerebellar+development+in+the+offspring.">Activation of the maternal immune system alters cerebellar development in the offspring.</a> Brain Behav Immun. 23 (1), 116-123 (2009).</li><li>Hsiao, E. Y., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+induces+endocrine+changes+in+the+placenta+via+IL-6.">Activation of the maternal immune system induces endocrine changes in the placenta via IL-6.</a> Brain Behav Immun. 25 (4), 604-615 (2011).</li><li>Wu, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+interaction+between+maternal+immune+activation+and+alpha+7+nicotinic+acetylcholine+receptor+in+regulating+behaviors+in+the+offspring.">The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring.</a> Brain Behav Immun. , (2015).</li><li>Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+causes+age-+and+region-specific+changes+in+brain+cytokines+in+offspring+throughout+development.">Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development.</a> Brain Behav Immun. 31, 54-68 (2013).</li><li>Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+maternal+immune+activation+on+gene+expression+patterns+in+the+fetal+brain.">Effects of maternal immune activation on gene expression patterns in the fetal brain.</a> Transl Psychiatry. 2, e98 (2012).</li><li>Hsiao, E. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbiota+modulate+behavioral+and+physiological+abnormalities+associated+with+neurodevelopmental+disorders.">Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders.</a> Cell. 155 (7), 1451-1463 (2013).</li><li>Naviaux, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antipurinergic+therapy+corrects+the+autism-like+features+in+the+poly(IC)+mouse+model.">Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model.</a> PLoS One. 8 (3), e57380 (2013).</li><li>Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+inflammation+promotes+fetal+microglial+activation+and+increased+cholinergic+expression+in+the+fetal+basal+forebrain:+role+of+interleukin-6.">Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6.</a> Pediatr Res. 74 (4), 393-401 (2013).</li><li>Schwartzer, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+strain+specific+interactions+in+the+development+of+autism-like+behaviors+in+mice.">Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice.</a> Transl Psychiatry. 3, e240 (2013).</li><li>Khan, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+effects+of+maternal+immune+activation+on+depression-like+behavior+in+the+mouse.">Long-term effects of maternal immune activation on depression-like behavior in the mouse.</a> Transl Psychiatry. 4, e363 (2014).</li><li>Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+transformations+of+neurodevelopmental+sequences+across+mammalian+species.">Modeling transformations of neurodevelopmental sequences across mammalian species.</a> J Neurosci. 33 (17), 7368-7383 (2013).</li><li>Abazyan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+interaction+of+mutant+DISC1+and+immune+activation+produces+adult+psychopathology.">Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology.</a> Biol Psychiatry. 68 (12), 1172-1181 (2010).</li><li>Meyer, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adult+behavioral+and+pharmacological+dysfunctions+following+disruption+of+the+fetal+brain+balance+between+pro-inflammatory+and+IL-10-mediated+anti-inflammatory+signaling.">Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling.</a> Mol Psychiatry. 13 (2), 208-221 (2008).</li><li>Vuillermot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+immune+activation+interacts+with+genetic+Nurr1+deficiency+in+the+development+of+attentional+impairments.">Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments.</a> J Neurosci. 32 (2), 436-451 (2012).</li><li>Bechard, A., Nicholson, A., Mason, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Litter+size+predicts+adult+stereotypic+behavior+in+female+laboratory+mice.">Litter size predicts adult stereotypic behavior in female laboratory mice.</a> J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).</li><li>Harvey, L., Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stereological+comparison+of+GAD67+and+reelin+expression+in+the+hippocampal+stratum+oriens+of+offspring+from+two+mouse+models+of+maternal+inflammation+during+pregnancy.">A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy.</a> Neuropharmacology. 62 (4), 1767-1776 (2012).</li></ol>

The authors have nothing to disclose.

MIA אינדוקציה בחלונות זמן שונים מדאיגה אירועי התפתחות המוח שונים במכרסמים, וכתוצאה מכך מובילה ליקויי neuropathologies התנהגותיים שונים אצל צאצאיהם. כאן, אנו תארנו פרוטוקול לגרום MIA בעכברים עם פולי (אני: C) הזרקה ב E12.5. שיטה זו של אינדוקצית MIA מובילה התנהגותי, נוירולוגיות, אימונו?...

הרעיון של הפעלת החיסון האמהית (MIA) מקורו מחקרים באפידמיולוגיה על הקשר בין זיהום אימהי עם אוטיזם וסכיזופרניה 1. בשל העדר של פתוגנים ויראליים שכפול לגילוי בשליה או במוח העוברי לאחר זיהום ויראלי אימהי 2,3, השפעת הזיהום על הצאצאים משערת להיגרם על ידי הפעלת המערכת האימהית החיסון ולא פתוגנים עצמם . כדי להבהיר את היחס אפקט-ו-הגורם בין MIA והפרעות פסיכיאטריות, הזרקת מסונתז כימית, polyinosinic גדילי RNA כפול ויראלי לחקות: חומצה polycytidylic (פולי (אני: C)) לתוך מכרסמים בהריון כבר בשימוש נרחב כמו במודל חיה עבור MIA 4,5. פולי (אני: C) הוא מוכר על ידי קולטן לחיוג כמו 3 (TLR3), ומנהל מערכתי של פולי (אני: C) גורם לתגובה דלקתית חריפה ויראלי דמוי. אחד המנגנונים שבאמצעותם פולי (אני: C) יחסי ציבורליקויי neuropathologies התנהגותי oduces אצל צאצאיהם הם לגרום לחוסר איזון של ציטוקינים דלקתיים פרו ואנטי בציר האימהי-שליה-העוברי 6. כמה קבוצות אימצו את המודל MIA להבין את האטיולוגיה של הפרעות פסיכיאטריות 7, ובשל אינטרסים מגוונים בקרב קבוצות מחקר, בנקודות זמן שונות של הפעלה חיסונית שימשו להשיג הפרעות שונות על התפתחות המוח והתנהגויות 7. המעבדה פול ה פטרסון במכון הטכנולוגי של קליפורניה מאמצת את האסטרטגיה של הזרקת פולי (אני: C) לעכברים בהריון עובריים 12.5 ימים (E12.5), אשר הוכיחה בהצלחה כי MIA הוא מסוגל גרימת התנהגותי, נוירולוגיות, ושינויים אימונולוגיים אצל צאצאיהם המשויכים אוטיזם וסכיזופרניה 8-11. העבודות הקודמות שלנו מראות כי צאצאי MIA להציג ליקויים התנהגותיים (למשל, impairmen החברתיt, גירעון תקשורת, התנהגות שחוזרת על עצמו, התנהגות כמו חרדה, ונסתרי עיכוב גירעון 8,10,12), חוסר איזון dysregulation וציטוקינים חיסוני 8,13,14, שינוי של ביטוי גנים במוח עוברי 15, אובדן של תאי פורקינג ב lobule VII של מוח קטן 11, שינוי של נכסים הסינפטי בהיפוקמפוס 9, אינטראקצית סביבת x גן 13, שינוי של חדירות מעי, ורכב חיידקים במעיים 16. יתר על כן, אסטרטגיות טיפוליות-מונעות מפותחות גם 13,16,17 מערכת מודל זה. גרימת MIA ב E12.5, ואחרים הראו כי MIA מייצרת ההפעלה microglial עוברית שינוי התפתחותי כולינרגית בקידמתו הבזליים 18, אינטראקציה ספציפית זן 19, המוח מוחין synaptosomal מומים ultrastructural, מומים hyperfunction שרשרת הנשימה במיטוכונדריה מוחין, downregulation של מולקולות synaptosomal מוחין 17 ,התנהגויות דיכאוניות דמוי, ירידת קוגניציה הגברה לטווח ארוך בהיפוקמפוס (LTP), והגירעון הנוירוגנזה בהיפוקמפוס מבוגר 20. כאן, אנו מספקים שיטה מפורטת של איך לגרום MIA ב E12.5 ידי פולי (אני: C), כמו גם פרדיגמות של איך ליישם מודל זה ללמוד את האטיולוגיה של אוטיזם וסכיזופרניה. חשוב לציין כי MIA הוא גורם סיכון עבור מגוון רחב של הפרעות 4, ותוצאותיה רגישות במיוחד את הזמן ואת שיטת האינדוקציה וכן הבעלים של הסכרים בהריון. ככזה, אפילו סתירות קלות בין מעבדות לעתים לגרום שחזור נמוך ו / או פנוטיפים שונים אצל צאצאיהם. השיטה שלנו היא תוכננה במיוחד עבור אלו המעוניינים ללמוד MIA כגורם סיכון סביבתי לאוטיזם וסכיזופרניה, ואת התיאור המפורט הניתנים יסייע לחוקרים לשפר השחזור של הנתונים שלהם.

<table><tbody><tr><td>Polyinosinic&amp;ndash;polycytidylic acid potassium salt</td><td>SIGMA</td><td>P9582</td><td></td></tr><tr><td>0.9% sodium chloride INJ. USP</td><td>HOSPIRA</td><td>NDC 0409-4888-10</td><td></td></tr><tr><td>MONOJECT insuline syrinage 3/10 ml 29 G x 1/2&quot;</td><td>COVIDIEN</td><td>8881600145</td><td></td></tr><tr><td>50 ml conical screw cap tubes</td><td>USA SCIENTIFIC</td><td>1500-1211</td><td></td></tr><tr><td>Nanodrop 1000 spectrophotometer</td><td>THERMO SCIENTIFIC</td><td>1000</td><td>Optional</td></tr><tr><td>Stereomicroscope</td><td>Wild Heerbrugg</td><td>M5A</td><td>Optional</td></tr><tr><td>Dumont #5 Forceps Inox Tip Size .10 X .06 mm</td><td>Roboz</td><td>RS-5045</td><td>Optional</td></tr><tr><td>RNAlater RNA stabilization reagent</td><td>Qiagen</td><td>76104</td><td>Optional</td></tr><tr><td>TRIzol reagent</td><td>Life Technologies</td><td>15596-026&amp;nbsp;</td><td>Optional</td></tr><tr><td>RQ1 Rnase-free DNase</td><td>Promega</td><td>M610A</td><td>Optional</td></tr><tr><td>iScript cDNA synthesis kit</td><td>Bio-Rad</td><td>170-8891</td><td>Optional</td></tr><tr><td>FastStart universal SYBR green master mix with ROX&amp;nbsp;</td><td>Roche</td><td>4913922001</td><td>Optional</td></tr><tr><td>Real-time PCR</td><td>ABI</td><td>7300</td><td>Optional</td></tr><tr><td>Primer: Il6 forward</td><td>Life Technologies</td><td>TAGTCCTTCCTACCCCAATTTCC</td><td>Optional</td></tr><tr><td>Primer: Il6 Reverse</td><td>Life Technologies</td><td>TTGGTCCTTAGCCACTCCTTC</td><td>Optional</td></tr><tr><td>Primer: beta-actin forward</td><td>Life Technologies</td><td>AGAGGGAAATCGTGCGTGAC</td><td>Optional</td></tr><tr><td>Primer: beta-actin Reverse</td><td>Life Technologies</td><td>CAATAGTGATGACCTGGCCGT</td><td>Optional</td></tr><tr><td>MicroAmp optical 96-well reaction plate</td><td>Life Technologies</td><td>4306737</td><td>Optionl</td></tr><tr><td>MicroAmp optical adhesive film&amp;nbsp;</td><td>Life Technologies</td><td>4311971</td><td>Optionl</td></tr><tr><td>EthoVision</td><td>Noldus</td><td>EthoVision</td><td>Optionl</td></tr><tr><td>SR-LAB apparatus (PPI)</td><td>San Diego Instruments&amp;nbsp;</td><td>SR-LAB</td><td>Optionl</td></tr><tr><td>Marbles</td><td>PENN-PLAX</td><td>Blue gem stones marbles</td><td>Optionl</td></tr><tr><td>Dulbecco&#039;s Phosphate-Buffered Saline (DPBS)</td><td>Life Technologies</td><td>21600-069</td><td>Optionl</td></tr><tr><td>Paraformaldehyde</td><td>MACRON</td><td>2621-59</td><td>Optionl</td></tr><tr><td>Vibratome</td><td>Leica</td><td>VT1000 S</td><td>Optionl</td></tr><tr><td>Sodium azide</td><td>Sigma</td><td>S2002</td><td>Optionl</td></tr><tr><td>Triton x-100</td><td>Sigma</td><td>X100</td><td>Optionl</td></tr><tr><td>Hydrogen peroxide solution</td><td>Sigma</td><td>18312</td><td>Optionl</td></tr><tr><td>Goat serum</td><td>Vector Laboratories</td><td>S-1000</td><td>Optionl</td></tr><tr><td>Rabbit anti-calbindin antibody</td><td>Abcam</td><td>ab11426</td><td>Optionl</td></tr><tr><td>Biotinlyated goat anti-rabbit IgGantibody</td><td>Vector Laboratories</td><td>BA-1000</td><td>Optionl</td></tr><tr><td>VECTASTAIN ABC Kit</td><td>Vector Laboratories</td><td>PK-4000</td><td>Optionl</td></tr></tbody></table>

induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

<html> הזרקה של 20 מ&quot;ג / קילו פולי (אני: C) ב E12.5 יכולה לעורר תגובה דלקתית חריפה בציר האימהי-שליה-עוברית לזרז השפעה כרונית להתפתחות מוח פנוטיפים התנהגותיים 12,13. רמות גבוהות של ציטוקינים מעודדי דלקת, Interleukin (IL) -6, הוא אינדיקטור אמין של תגובה דלקתית חרי?...

Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

אינדוקציה של הפעלה האימהית חיסונית בעכברים בשלב אמצע הריון עם ויראלי לחקות פולי (אני: C)

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

induction-maternal-immune-activation-mice-at-mid-gestation-stage-with

Research

JoVE Journal

Immunology and Infection

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

18.3K Views.  California Institute of Technology. Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Video: Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

A Mouse Model of in Utero Transplantation

The transplantation of stem cells and viruses in utero has tremendous potential for treating congenital disorders in the human fetus. For example, in utero transplantation (IUT) of hematopoietic stem cells has been used to successfully treat patients with severe combined immunodeficiency.1,2 In several other conditions, however, IUT has been attempted without success.3 Given these mixed results, the availability of an efficient non-human model to study the biological sequelae of stem cell transplantation and gene therapy is critical to advance this field. We and others have used the mouse model of IUT to study factors affecting successful engraftment of in utero transplanted hematopoietic stem cells in both wild-type mice4-7 and those with genetic diseases.8,9 The fetal environment also offers considerable advantages for the success of in utero gene therapy. For example, the delivery of adenoviral10, adeno-associated viral10, retroviral11, and lentiviral vectors12,13 into the fetus has resulted in the transduction of multiple organs distant from the site of injection with long-term gene expression. in utero gene therapy may therefore be considered as a possible treatment strategy for single gene disorders such as muscular dystrophy or cystic fibrosis. Another potential advantage of IUT is the ability to induce immune tolerance to a specific antigen. As seen in mice with hemophilia, the introduction of Factor IX early in development results in tolerance to this protein.14 
In addition to its use in investigating potential human therapies, the mouse model of IUT can be a powerful tool to study basic questions in developmental and stem cell biology. For example, one can deliver various small molecules to induce or inhibit specific gene expression at defined gestational stages and manipulate developmental pathways. The impact of these alterations can be assessed at various timepoints after the initial transplantation. Furthermore, one can transplant pluripotent or lineage specific progenitor cells into the fetal environment to study stem cell differentiation in a non-irradiated and unperturbed host environment.
The mouse model of IUT has already provided numerous insights within the fields of immunology, and developmental and stem cell biology. In this video-based protocol, we describe a step-by-step approach to performing IUT in mouse fetuses and outline the critical steps and potential pitfalls of this technique.

A Mouse Model of in Utero Transplantation

The mouse model of in utero transplantation is a versatile tool that can be used to study the potential clinical applications of stem cell transplantation and gene therapy in the fetus. In this protocol, we present a general approach to performing this technique

במודל עכבר של בתוך הרחם השתלה

The transplantation of stem cells and viruses in utero has tremendous potential for treating congenital disorders in the human fetus.  For example, in ...

Medicine

Assessment of Maternal Vascular Remodeling During Pregnancy in the Mouse Uterus

The placenta mediates the exchange of factors such as gases and nutrients between mother and fetus and has specific demands for supply of blood from the maternal circulation. The maternal uterine vasculature needs to adapt to this temporary demand and the success of this arterial remodeling process has implications for fetal growth. Cells of the maternal immune system, especially natural killer (NK) cells, play a critical role in this process. Here we describe a method to assess the degree of remodeling of maternal spiral arteries during mouse pregnancy. Hematoxylin and eosin-stained tissue sections are scanned and the size of the vessels analysed. As a complementary validation method, we also present a qualitative assessment for the success of the remodeling process by immunohistochemical detection of smooth muscle actin (SMA), which normally disappears from within the arterial vascular media at mid-gestation. Together, these methods enable determination of an important parameter of the pregnancy phenotype. These results can be combined with other endpoints of mouse pregnancy to provide insight into the mechanisms underlying pregnancy-related complications.

This protocol describes a technique to assess changes in the maternal vasculature during pregnancy in mice. Using stereological methods, remodeling of the decidual spiral arteries is assessed quantitatively and the results confirmed qualitatively using immunohistochemistry.

הערכה של כלי דם אימהי שיפוץ במהלך ההריון ברחם העכבר

The placenta mediates the exchange of factors such as gases and nutrients between mother and fetus and has specific demands for supply of blood from the ...

Developmental Biology

Use of In vivo Imaging to Monitor the Progression of Experimental Mouse Cytomegalovirus Infection in Neonates

Human Cytomegalovirus (HCMV or HHV-5) is a life-threatening pathogen in immune-compromised individuals. Upon congenital or neonatal infection, the virus can infect and replicate in the developing brain, which may induce severe neurological damage, including deafness and mental retardation. Despite the potential severity of the symptoms, the therapeutic options are limited by the unavailability of a vaccine and the absence of a specific antiviral therapy. Furthermore, a precise description of the molecular events occurring during infection of the central nervous system (CNS) is still lacking since observations mostly derive from the autopsy of infected children. Several animal models, such as rhesus macaque CMV, have been developed and provided important insights into CMV pathogenesis in the CNS. However, despite its evolutionary proximity with humans, this model was limited by the intracranial inoculation procedure used to infect the animals and consistently induce CNS infection. Furthermore, ethical considerations have promoted the development of alternative models, among which neonatal infection of newborn mice with mouse cytomegalovirus (MCMV) has recently led to significant advances. For instance, it was reported that intraperitoneal injection of MCMV to Balb/c neonates leads to infection of neurons and glial cells in specific areas of the brain. These findings suggested that experimental inoculation of mice might recapitulate the deficits induced by HCMV infection in children. Nevertheless, a dynamic analysis of MCMV infection of neonates is difficult to perform because classical methodology requires the sacrifice of a significant number of animals at different time points to analyze the viral burden and/or immune-related parameters. To circumvent this bottleneck and to enable future investigations of rare mutant animals, we applied in vivo imaging technology to perform a time-course analysis of the viral dissemination in the brain upon peripheral injection of a recombinant MCMV expressing luciferase to C57Bl/6 neonates.

Use of In vivo Imaging to Monitor the Progression of Experimental Mouse Cytomegalovirus Infection in Neonates

Human Cytomegalovirus (HCMV) infection of neonates represents an important cause of mental retardation, yet the molecular events leading to virus-induced pathogenesis are still poorly understood. To investigate the dynamics of brain infection, we adapted whole-animal in vivo imaging to perform time-course analysis of neonates infected with a luciferase-recombinant virus.

שימוש<em&gt; בvivo</em&gt; הדמיה למעקב אחר ההתקדמות של זיהום ציטומגלווירוס עכבר ניסיוני בילודים

Human Cytomegalovirus (HCMV or HHV-5) is a life-threatening  pathogen in immune-compromised individuals. Upon congenital or neonatal  infection, the virus ...

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. Conversely, viruses have evolved intricate strategies to evade and exploit host immune signaling for survival and propagation. Viral immune evasion, entailing host defense and viral evasion, provides one of the most fascinating and dynamic interfaces to discern the host-virus interaction. These studies advance our understanding in innate immune regulation and pave our way to develop novel antiviral therapies.
Murine &#947;HV68 is a natural pathogen of murine rodents. &#947;HV68 infection of mice provides a tractable small animal model to examine the antiviral response to human KSHV and EBV of which perturbation of in vivo virus-host interactions is not applicable. Here we describe a protocol to determine the antiviral cytokine production. This protocol can be adapted to other viruses and signaling pathways.
Recently, we have discovered that &#947;HV68 hijacks MAVS and IKK&#946;, key innate immune signaling components downstream of the cytosolic RIG-I and MDA5, to abrogate NF&#922;B activation and antiviral cytokine production. Specifically, &#947;HV68 infection activates IKK&#946; and that activated IKK&#946; phosphorylates RelA to accelerate RelA degradation. As such, &#947;HV68 efficiently uncouples NF&#922;B activation from its upstream activated IKK&#946;, negating antiviral cytokine gene expression. This study elucidates an intricate strategy whereby the upstream innate immune activation is intercepted by a viral pathogen to nullify the immediate downstream transcriptional activation and evade antiviral cytokine production.

We describe a protocol to measure the antiviral cytokine production in mice infected with a model herpesvirus, murine gamma herpesvirus 68 (&#947;HV68) that is closely-related to human Kaposi&#8217;s sarcoma-associated herpesvirus (KSHV) and Epstein-Barr virus (EBV). Utilizing genetically modified mouse strains and mouse embryonic fibroblasts (MEFs), we assessed the antiviral cytokine production both in vivo and ex vivo. &#8220;Reconstituting&#8221; the expression of innate immune components in knockout embryonic fibroblasts by lentiviral transduction, we further pinpoint specific innate immune molecules and dissect the key signaling events that differentially regulate the antiviral cytokine production.

הביתור מולדת איתות חיסון בהתחמקות ויראלי של ציטוקין ייצור

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Mouse In Vivo Placental Targeted CRISPR Manipulation

The placenta is an essential organ that regulates and maintains mammalian development in utero. The placenta is responsible for the transfer of nutrients and waste between the mother and fetus and the production and delivery of growth factors and hormones. Placental genetic manipulations in mice are critical for understanding the placenta's specific role in prenatal development. Placental-specific Cre-expressing transgenic mice have varying effectiveness, and other methods for placental gene manipulation can be useful alternatives. This paper describes a technique to directly alter placental gene expression using CRISPR gene manipulation, which can be used to modify the expression of targeted genes. Using a relatively advanced surgical approach, pregnant dams undergo a laparotomy on embryonic day 12.5 (E12.5), and a CRISPR plasmid is delivered by a glass micropipette into the individual placentas. The plasmid is immediately electroporated after each injection. After dam recovery, the placentas and embryos can continue development until assessment at a later time point. The evaluation of the placenta and offspring after the use of this technique can determine the role of time-specific placental function in development. This type of manipulation will allow for a better understanding of how placental genetics and function impact fetal growth and development in multiple disease contexts.

Mouse In Vivo Placental Targeted CRISPR Manipulation

Here we describe a time-specific method to effectively manipulate critical developmental pathways in the mouse placenta in vivo. This is performed through the injection and electroporation of CRISPR plasmids into the placentas of pregnant dams on embryonic day 12.5.

עכבר ב- Vivo שליה ממוקד מניפולציה CRISPR

The placenta is an essential organ that regulates and maintains mammalian development in utero. The placenta is responsible for the transfer of nutrients ...

Genetics

Isolation of Leukocytes from the Murine Tissues at the Maternal-Fetal Interface

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing fetus. This tolerance is initiated during coitus, established during fecundation and implantation, and maintained throughout pregnancy. Active cellular and molecular mediators of maternal-fetal tolerance are enriched at the site of contact between fetal and maternal tissues, known as the maternal-fetal interface, which includes the placenta and the uterine and decidual tissues. This interface is comprised of stromal cells and infiltrating leukocytes, and their abundance and phenotypic characteristics change over the course of pregnancy. Infiltrating leukocytes at the maternal-fetal interface include neutrophils, macrophages, dendritic cells, mast cells, T cells, B cells, NK cells, and NKT cells that together create the local micro-environment that sustains pregnancy. An imbalance among these cells or any inappropriate alteration in their phenotypes is considered a mechanism of disease in pregnancy. Therefore, the study of leukocytes that infiltrate the maternal-fetal interface is essential in order to elucidate the immune mechanisms that lead to pregnancy-related complications. Described herein is a protocol that uses a combination of gentle mechanical dissociation followed by a robust enzymatic disaggregation with a proteolytic and collagenolytic enzymatic cocktail to isolate the infiltrating leukocytes from the murine tissues at the maternal-fetal interface. This protocol allows for the isolation of high numbers of viable leukocytes (&#62;70%) with sufficiently conserved antigenic and functional properties. Isolated leukocytes can then be analyzed by several techniques, including immunophenotyping, cell sorting, imaging, immunoblotting, mRNA expression, cell culture, and in vitro functional assays such as mixed leukocyte reactions, proliferation, or cytotoxicity assays.

Described herein is a protocol to isolate and analyze the infiltrating leukocytes of tissues at the maternal-fetal interface (uterus, decidua, and placenta) of mice. This protocol maintains the integrity of most cell surface markers and yields enough viable cells for downstream applications including flow cytometry analysis.

בידוד של לויקוציטים מרקמות Murine בממשק האם והעובר

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing ...

Intracerebroventricular and Intravascular Injection of Viral Particles and Fluorescent Microbeads into the Neonatal Brain

In the study on the pathogenesis of viral encephalitis, the infection method is critical. The first of the two main infectious routes to the brain is the hematogenous route, which involves infection of the endothelial cells and pericytes of the brain. The second is the intracerebroventricular (ICV) route. Once within the central nervous system (CNS), viruses may spread to the subarachnoid space, meninges, and choroid plexus via the cerebrospinal fluid. In experimental models, the earliest stages of CNS viral distribution are not well characterized, and it is unclear whether only certain cells are initially infected. Here, we have analyzed the distribution of cytomegalovirus (CMV) particles during the acute phase of infection, termed primary viremia, following ICV or intravascular (IV) injection into the neonatal mouse brain. In the ICV injection model, 5 &#181;l of murine CMV (MCMV) or fluorescent microbeads were injected into the lateral ventricle at the midpoint between the ear and eye using a 10-&#181;l syringe with a 27 G needle. In the IV injection model, a 1-ml syringe with a 35 G needle was used. A transilluminator was used to visualize the superficial temporal (facial) vein of the neonatal mouse. We infused 50 &#181;l of MCMV or fluorescent microbeads into the superficial temporal vein. Brains were harvested at different time points post-injection. MCMV genomes were detected using the in situ hybridization method. Fluorescent microbeads or green fluorescent protein expressing recombinant MCMV particles were observed by fluorescent microscopy. These techniques can be applied to many other pathogens to investigate the pathogenesis of encephalitis.

Here, we describe a simple method of intracerebroventricular and intravascular injection of viral particles or fluorescent microbeads into the neonatal mouse brain. The localization pattern of the virus and nanoparticles could be detected by microscopic evaluation or by in situ hybridization.

הזרקת intracerebroventricular ו intravascular של חלקיקים נגיפיים ו פלורסנט microbeads לתוך המוח בילוד

In the study on the pathogenesis of viral encephalitis, the infection method is critical. The first of the two main infectious routes to the brain is the ...

Neuroscience

C-section of Preclinical Animal Model of Chorioamnionitis Triggered by Group B Streptococcus (GBS)

Group B Streptococcus (GBS) is one of the most common bacteria isolated during human pregnancy. It is a leading cause of placental infection/inflammation, termed chorioamnionitis. Chorioamnionitis exposes the developing fetus to a high risk of organ injuries, perinatal morbidity, and mortality, as well as life-long neurobehavioral impairments and other non-neurological developmental issues. The two most frequent subtypes of GBS isolates from maternal and fetal tissues are serotypes Ia (13%-23%) and III (25%-53%). Our lab has developed and characterized a rat model of GBS-induced chorioamnionitis to study subsequent impacts on the central nervous system of the developing fetus and to understand underlying mechanistic aspects. This article presents the design as well as uses of the preclinical rat model, which closely reproduces the hallmark of GBS-induced chorioamnionitis in humans. This article aims to help scientists reproduce the experimental design as well as to provide support through examples of troubleshooting. The present model may also contribute to potential discoveries through uncovering causes, mechanisms, and novel therapeutic avenues, which remain unsettled in many developmental impairments arising from chorioamnionitis. Furthermore, the use of this model may be extended to the studies of perinatal non-neurological common and severe morbidities affecting, for instance, the retina, bowel, lung, and kidney. The main interest of this research is in the field of GBS-induced fetal neurodevelopmental impairments such as cerebral palsy (CP), attention deficit hyperactivity disorder (ADHD), and autism spectrum disorder (ASD). The rationale supporting this model is presented in this article, followed by procedures and results.

<meta charset="utf8"></head><body>ניתוח קיסרי של מודל פרה-קליני בבעלי חיים של כוריואמניוניטיס המופעל על ידי סטרפטוקוקוס GBS מקבוצה B

The goal of this protocol is to describe a preclinical animal model of Group B Streptococcus (GBS)-induced chorioamnionitis. The study is designed to investigate mechanistic processes, potential causal links with developmental impairments, and finally to develop translational anti-inflammatory placento- and neuro-protective treatments.

ניתוח קיסרי של מודל פרה-קליני בבעלי חיים של כוריואמניוניטיס המופעל על ידי סטרפטוקוקוס מקבוצה B (GBS)

Group B Streptococcus (GBS) is one of the most common bacteria isolated during human pregnancy. It is a leading cause of placental infection/inflammation, ...

A Murine Model of Fetal Exposure to Maternal Inflammation to Study the Effects of Acute Chorioamnionitis on Newborn Intestinal Development

Chorioamnionitis is a common precipitant of preterm birth and is associated with many of the morbidities of prematurity, including necrotizing enterocolitis (NEC). However, a mechanistic link between these two conditions remains yet to be discovered. We have adopted a murine model of chorioamnionitis involving lipopolysaccharide (LPS)-induced fetal exposure to maternal inflammation (FEMI). This model of FEMI induces a sterile maternal, placental, and fetal inflammatory cascade, which is also present in many cases of clinical chorioamnionitis. Although models exist that utilize live bacteria and more accurately mimic the pathophysiology of an ascending infection resulting in chorioamnionitis, these methods may cause indirect effects on development of the immature intestinal tract and the associated developing microbiome. Using this protocol, we have demonstrated that LPS-induced FEMI results in a dose-dependent increase in pregnancy loss and preterm birth, as well as disruption of normal intestinal development in offspring. Further, we have demonstrated that FEMI significantly increases intestinal injury and serum cytokines in offspring, while simultaneously decreasing goblet and Paneth cells, both of which provide a first line of innate immunity against intestinal inflammation. Although a similar model of LPS-induced FEMI has been used to model the association between chorioamnionitis and subsequent abnormalities of the central nervous system, to our knowledge, this protocol is the first to attempt to elucidate a mechanistic link between chorioamnionitis and later perturbations in intestinal development as a potential link between chorioamnionitis and NEC.

We developed a model of chorioamnionitis to simulate fetal exposure to maternal inflammation (FEMI) without complications of live organisms to examine the effects of FEMI on development of the offspring&#8217;s intestinal tract. This allows for study of mechanistic causes for development of intestinal injury following chorioamnionitis.

אינדוקציה של הפעלה האימהית חיסונית בעכברים בשלב אמצע הריון עם ויראלי לחקות פולי (אני: C)

Summary

Explore More Videos

Chapters in this video

במודל עכבר של בתוך הרחם השתלה

הערכה של כלי דם אימהי שיפוץ במהלך ההריון ברחם העכבר

שימוש

הביתור מולדת איתות חיסון בהתחמקות ויראלי של ציטוקין ייצור

עכבר ב- Vivo שליה ממוקד מניפולציה CRISPR

בידוד של לויקוציטים מרקמות Murine בממשק האם והעובר

הזרקת intracerebroventricular ו intravascular של חלקיקים נגיפיים ו פלורסנט microbeads לתוך המוח בילוד

ניתוח קיסרי של מודל פרה-קליני בבעלי חיים של כוריואמניוניטיס המופעל על ידי סטרפטוקוקוס מקבוצה B (GBS)

ניתוח קיסרי של מודל פרה-קליני בבעלי חיים של כוריואמניוניטיס המופעל על ידי סטרפטוקוקוס מקבוצה B (GBS)

מודל מורין של חשיפה עוברית לדלקת אימהית כדי ללמוד את ההשפעות של Chorioamnionitis חריפה על התפתחות מעיים שזה עתה נולד