Name: induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)
Uploaded: 2016-03-25T13:00:00
Description: Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

We would like to honor the late Dr. Paul H. Patterson for his contributions to the progress of MIA model, autism, and schizophrenia research. We acknowledge Sarkis K. Mazmanian for his great support on this protocol; Ruben M. Bayon, Yvette Garcia-Flores, Karen C. Lencioni, and Leslie A. Neumann for administrative assistance; Ali Khoshnan and Jan C. Ko for the assistance on filming; Elaine Y. Hsiao and Natalia Malkova for their advice on MIA induction; Jeffrey S. Cochrane, Joaquin Gutierrez, Kwan F. Lee, Jaime Rodriguez, Lorena C. Sandoval, and Natalie A. Verduzco for their expert animal husbandry. This work was supported by the NIH Conte Center Award (NIH 5P50MH086383-04, to Paul H. Patterson); Autism Speaks (#7670, to Paul H. Patterson); Simons Foundation (#322839, to Sarkis K. Mazmanian); NIH Training Grant (NIH/NRSA T32GM07616 to K.-H.C.); Caltech Summer Undergraduate Research Fellowship (SURF) (to Z.Y.); Amgen Scholars Program at Caltech (to Z.Y.); and Postdoctoral Fellowship from National Science Council, Taiwan (NSC 101-2917-I-564-039, to W.-L.W.).

All protocols were performed under the approval of the California Institute of Technology Institutional Animal Care and Use Committee (IACUC).
1. Preparation for Timed-mating Pairs
<ol>
	<li>Use at least 6 dams for behavioral experiments and 3 for gene expression analysis. 
	NOTE: Use double the number of estimated female mice, as only about 50% of the mice will be plugged from the timed-mating.</li>
	<li>Use female mice with no prior pregnancy and at 8-16 weeks of age. 
	NOTE: Fem...

<ol>
	<li>Brown, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiologic+studies+of+exposure+to+prenatal+infection+and+risk+of+schizophrenia+and+autism.">Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism.</a> Dev Neurobiol. 72 (10), 1272-1276 (2012).</li><li>Fatemi, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+viral+theory+of+schizophrenia+revisited:+abnormal+placental+gene+expression+and+structural+changes+with+lack+of+evidence+for+H1N1+viral+presence+in+placentae+of+infected+mice+or+brains+of+exposed+offspring.">The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring.</a> Neuropharmacology. 62 (3), 1290-1298 (2012).</li><li>Shi, L., Tu, N., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+influenza+infection+is+likely+to+alter+fetal+brain+development+indirectly:+the+virus+is+not+detected+in+the+fetus.">Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus.</a> Int J Dev Neurosci. 23 (2-3), 299-305 (2005).</li><li>Knuesel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+abnormal+brain+development+across+CNS+disorders.">Maternal immune activation and abnormal brain development across CNS disorders.</a> Nat Rev Neurol. 10 (11), 643-660 (2014).</li><li>Meyer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+poly(i:C)+exposure+and+other+developmental+immune+activation+models+in+rodent+systems.">Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems.</a> Biol Psychiatry. 75 (4), 307-315 (2014).</li><li>Meyer, U., Feldon, J., Yee, B. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+the+fetal+brain+cytokine+imbalance+hypothesis+of+schizophrenia.">A review of the fetal brain cytokine imbalance hypothesis of schizophrenia.</a> Schizophr Bull. 35 (5), 959-972 (2009).</li><li>Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+prenatal+infection+on+brain+development+and+behavior:+a+review+of+findings+from+animal+models.">Effects of prenatal infection on brain development and behavior: a review of findings from animal models.</a> Brain Behav Immun. 24 (6), 881-897 (2010).</li><li>Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+an+autism+risk+factor+in+mice+leads+to+permanent+immune+dysregulation.">Modeling an autism risk factor in mice leads to permanent immune dysregulation.</a> Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).</li><li>Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+nonspatial+information+processing+in+the+hippocampus+of+the+adult+offspring.">Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring.</a> Brain Behav Immun. 24 (6), 930-941 (2010).</li><li>Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+fetal+brain+development+through+interleukin-6.">Maternal immune activation alters fetal brain development through interleukin-6.</a> J Neurosci. 27 (40), 10695-10702 (2007).</li><li>Shi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+alters+cerebellar+development+in+the+offspring.">Activation of the maternal immune system alters cerebellar development in the offspring.</a> Brain Behav Immun. 23 (1), 116-123 (2009).</li><li>Hsiao, E. Y., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+induces+endocrine+changes+in+the+placenta+via+IL-6.">Activation of the maternal immune system induces endocrine changes in the placenta via IL-6.</a> Brain Behav Immun. 25 (4), 604-615 (2011).</li><li>Wu, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+interaction+between+maternal+immune+activation+and+alpha+7+nicotinic+acetylcholine+receptor+in+regulating+behaviors+in+the+offspring.">The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring.</a> Brain Behav Immun. , (2015).</li><li>Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+causes+age-+and+region-specific+changes+in+brain+cytokines+in+offspring+throughout+development.">Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development.</a> Brain Behav Immun. 31, 54-68 (2013).</li><li>Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+maternal+immune+activation+on+gene+expression+patterns+in+the+fetal+brain.">Effects of maternal immune activation on gene expression patterns in the fetal brain.</a> Transl Psychiatry. 2, e98 (2012).</li><li>Hsiao, E. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbiota+modulate+behavioral+and+physiological+abnormalities+associated+with+neurodevelopmental+disorders.">Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders.</a> Cell. 155 (7), 1451-1463 (2013).</li><li>Naviaux, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antipurinergic+therapy+corrects+the+autism-like+features+in+the+poly(IC)+mouse+model.">Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model.</a> PLoS One. 8 (3), e57380 (2013).</li><li>Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+inflammation+promotes+fetal+microglial+activation+and+increased+cholinergic+expression+in+the+fetal+basal+forebrain:+role+of+interleukin-6.">Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6.</a> Pediatr Res. 74 (4), 393-401 (2013).</li><li>Schwartzer, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+strain+specific+interactions+in+the+development+of+autism-like+behaviors+in+mice.">Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice.</a> Transl Psychiatry. 3, e240 (2013).</li><li>Khan, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+effects+of+maternal+immune+activation+on+depression-like+behavior+in+the+mouse.">Long-term effects of maternal immune activation on depression-like behavior in the mouse.</a> Transl Psychiatry. 4, e363 (2014).</li><li>Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+transformations+of+neurodevelopmental+sequences+across+mammalian+species.">Modeling transformations of neurodevelopmental sequences across mammalian species.</a> J Neurosci. 33 (17), 7368-7383 (2013).</li><li>Abazyan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+interaction+of+mutant+DISC1+and+immune+activation+produces+adult+psychopathology.">Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology.</a> Biol Psychiatry. 68 (12), 1172-1181 (2010).</li><li>Meyer, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adult+behavioral+and+pharmacological+dysfunctions+following+disruption+of+the+fetal+brain+balance+between+pro-inflammatory+and+IL-10-mediated+anti-inflammatory+signaling.">Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling.</a> Mol Psychiatry. 13 (2), 208-221 (2008).</li><li>Vuillermot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+immune+activation+interacts+with+genetic+Nurr1+deficiency+in+the+development+of+attentional+impairments.">Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments.</a> J Neurosci. 32 (2), 436-451 (2012).</li><li>Bechard, A., Nicholson, A., Mason, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Litter+size+predicts+adult+stereotypic+behavior+in+female+laboratory+mice.">Litter size predicts adult stereotypic behavior in female laboratory mice.</a> J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).</li><li>Harvey, L., Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stereological+comparison+of+GAD67+and+reelin+expression+in+the+hippocampal+stratum+oriens+of+offspring+from+two+mouse+models+of+maternal+inflammation+during+pregnancy.">A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy.</a> Neuropharmacology. 62 (4), 1767-1776 (2012).</li></ol>

MIA induction at different time windows perturbs different brain development events in rodents, and consequently leads to different behavioral abnormalities and neuropathologies in the offspring. Here, we described a protocol to induce MIA in mice with poly(I:C) injection at E12.5. This method of MIA induction leads to behavioral, neurological, immunological, and gastrointestinal abnormalities associated with autism and schizophrenia in the offspring8,10,11,16. It is important to note that, because MIA is an e...

The concept of maternal immune activation (MIA) originates from the epidemiology studies on the association of maternal infection with autism and schizophrenia1. Due to the absence of detectable replicating viral pathogens in the placenta or the fetal brain after maternal viral infection2,3, the effect of the infection on the offspring is hypothesized to be caused by the activation of the maternal immune system rather than the pathogens themselves.
To elucidate the cause-and-effect relationship between MIA and psychiatric disorders, injection of chemically synthesized, viral mimic double stranded RNA polyinosinic:polycytidylic acid (poly(I:C)) into pregnant rodents has been widely used as the animal model for MIA4,5. Poly(I:C) is recognized by toll-like receptor 3 (TLR3), and systemic administration of poly(I:C) induces viral-like acute inflammatory response. One of the mechanisms by which poly(I:C) produces behavioral abnormalities and neuropathologies in the offspring is by causing an imbalance of pro- and anti- inflammatory cytokines in the maternal-placental-fetal axis6. Several groups have adopted the MIA model to understand the etiology of psychiatric disorders7, and due to the diverse interests among research groups, various time points of immune activation have been used to achieve different perturbations on brain development and behaviors7.
The Paul H. Patterson laboratory at the California Institute of Technology adopts the strategy of injecting poly(I:C) into pregnant mice at embryonic 12.5 days (E12.5), which has successfully demonstrated that MIA is capable of inducing behavioral, neurological, and immunological changes in the offspring that are associated with autism and schizophrenia8-11. Our prior works show that MIA offspring display behavioral abnormalities (e.g.,&#160;social impairment, communication deficit, repetitive behavior, anxiety-like behavior, and latent inhibition deficit8,10,12), immune dysregulation and cytokines imbalance8,13,14, alteration of fetal brain gene expression15, loss of Purkinje cell in lobule VII of cerebellum11, alteration of synaptic properties in hippocampus9, gene x environment interaction13, alteration of gut permeability, and gut microbiota composition16. Furthermore, therapeutic and prophylactic strategies are also developed from this model system13,16,17. By inducing MIA at E12.5, others have shown that MIA produces fetal microglial activation and cholinergic developmental alteration in basal forebrain18, strain specific interaction19, brain cerebral synaptosomal ultrastructural abnormalities, cerebral mitochondrial respiratory chain hyperfunction abnormalties, downregulation of cerebral synaptosomal molecules17, depressive-like behaviors, impairment in cognition and hippocampal long-term potentiation (LTP), and deficit of adult hippocampal neurogenesis20.
Here, we provide a detailed method of how to induce MIA at E12.5 by poly(I:C), as well as paradigms of how to apply this model to study the etiology of autism and schizophrenia. It is important to note that MIA is a risk factor for a variety of disorders4, and its outcomes are extremely sensitive to the time and method of induction as well as the husbandry of the pregnant dams. As such, even minor inconsistencies between laboratories often result in low reproducibility and/or different phenotypes in the offspring. Our method is specifically designed for those interested in studying MIA as an environmental risk factor for autism and schizophrenia, and the detailed description provided will help researchers improve the reproducibility of their data.

<table border="0" cellpadding="0" cellspacing="0" width="711">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:283px;">Polyinosinic&#8211;polycytidylic acid potassium salt</td>
			<td style="width:129px;">SIGMA</td>
			<td style="width:167px;">P9582</td>
			<td style="width:133px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">0.9% sodium chloride INJ. USP</td>
			<td>HOSPIRA</td>
			<td>NDC 0409-4888-10</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MONOJECT insuline syrinage 3/10 mL 29G x 1/2&#34;</td>
			<td>COVIDIEN</td>
			<td>8881600145</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">50 ml conical screw cap tubes</td>
			<td>USA SCIENTIFIC</td>
			<td>1500-1211</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nanodrop 1000 spectrophotometer</td>
			<td>THERMO SCIENTIFIC</td>
			<td>1000</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Stereomicroscope</td>
			<td>Wild Heerbrugg</td>
			<td>M5A</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dumont #5 Forceps Inox Tip Size .10 X .06mm</td>
			<td>Roboz</td>
			<td>RS-5045</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNAlater RNA stabilization reagent</td>
			<td>Qiagen</td>
			<td>76104</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TRIzol reagent</td>
			<td>Life Technologies</td>
			<td>15596-026&#160;</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RQ1 Rnase-free DNase</td>
			<td>Promega</td>
			<td>M610A</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iScript cDNA synthesis kit</td>
			<td>Bio-Rad</td>
			<td>170-8891</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastStart universal SYBR green master mix with ROX&#160;</td>
			<td>Roche</td>
			<td>4913922001</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Real-time PCR</td>
			<td>ABI</td>
			<td>7300</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: Il6 forward</td>
			<td>Life Technologies</td>
			<td>TAGTCCTTCCTACCCCAATTTCC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: Il6 Reverse</td>
			<td>Life Technologies</td>
			<td>TTGGTCCTTAGCCACTCCTTC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: beta-actin forward</td>
			<td>Life Technologies</td>
			<td>AGAGGGAAATCGTGCGTGAC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: beta-actin Reverse</td>
			<td>Life Technologies</td>
			<td>CAATAGTGATGACCTGGCCGT</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MicroAmp optical 96-well reaction plate</td>
			<td>Life Technologies</td>
			<td>4306737</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MicroAmp optical adhesive film&#160;</td>
			<td>Life Technologies</td>
			<td>4311971</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EthoVision</td>
			<td>Noldus</td>
			<td>EthoVision</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SR-LAB apparatus (PPI)</td>
			<td>San Diego Instruments&#160;</td>
			<td>SR-LAB</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Marbles</td>
			<td>PENN-PLAX</td>
			<td>Blue gem stones marbles</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dulbecco&#39;s Phosphate-Buffered Saline (DPBS)</td>
			<td>Life Technologies</td>
			<td>21600-069</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Paraformaldehyde</td>
			<td>MACRON</td>
			<td>2621-59</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vibratome</td>
			<td>Leica</td>
			<td>VT1000 S</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium azide</td>
			<td>Sigma</td>
			<td>S2002</td>
			<td>Optionl</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Triton x-100</td>
			<td>Sigma</td>
			<td>X100</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hydrogen peroxide solution</td>
			<td>Sigma</td>
			<td>18312</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Goat serum</td>
			<td>Vector Laboratories</td>
			<td>S-1000</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rabbit anti-calbindin antibody</td>
			<td>Abcam</td>
			<td>ab11426</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Biotinlyated goat anti-rabbit IgGantibody</td>
			<td>Vector Laboratories</td>
			<td>BA-1000</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">VECTASTAIN ABC Kit</td>
			<td>Vector Laboratories</td>
			<td>PK-4000</td>
			<td>Optionl</td>
		</tr>
	</tbody>
</table>

induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

Injection of 20 mg/kg poly(I:C) at E12.5 could evoke an acute inflammatory response in the maternal-placental-fetal axis and precipitate a chronic effect to brain development and behavioral phenotypes12,13. Elevated levels of a proinflammatory cytokine, Interleukin (IL)-6, is a reliable indicator of acute inflammatory response after MIA. The peak time for Il6 gene expression in the placenta and fetal brain is at 3 hr post-poly(I:C) injection12,13. We have sh...

Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

The overall goal of this procedure is to induce maternal immune activation, or MIA, in mice by intraperitoneal injection of the viral mimic poly at the mid-gestational embryonic stage. This method can help us answer key questions in a neuro-immunology field, such as, how immune dysfunction can lead to perturbations in brain development and behavior. The main advantage of this technique is that it's specifically designed for researchers interested in studying MIA as an environmental risk factor for autism and schizophrenia.Generally, individuals new to this method will struggle, because small differences in the MIA induction method can significantly alter the downstream response in the offspring. To set up a timed mating pair, begin by housing five female mice per cage next to each other in standard mouse cages to synchronize their estra cycles, and use an ear punch to label each animal. Zero to two hours before the dark cycle begins, house the female mice two to a cage, and weigh and record the body weight of each individual mouse, then add one male mouse per cage of two female mice.Zero to four hours after the dark cycle ends, gently lift each female mouse by the base of the tail, allowing the animal to grip the cage grid with the forepaws, to determine the existence of a whitish mass in the vaginal opening. If a plug is not apparent, gently insert a 200 microliter pipette tip into the vaginal opening. Resistance from coagulation confirms the formation of a plug.Group the plugged mice into a new cage, as the presence of a vaginal plug confirms only that copulation has occurred. On embryonic days 10.5 to 11.5, lift each plugged female mouse by the base of the tail, and look for a bulge in the abdomen, then weigh the mice to verify the pregnancy, and house the pregnant animals in individual clean cages. Weigh the poly(I:C)powder in a 50 milliliter conical.On embryonic day 12.5, add the appropriate volume of 0.9%sodium chloride to the corresponding volume of poly(I:C)in a conical tube, and close the cap. Gently roll the saline droplet over the powder until the solution is clear. then centrifuge the tube, and transfer the poly(I:C)solution to a microcentrifuge tube.Use a spectrophotometer to measure the 260 to 280 ratio of the poly(I:C)solution. The ratio should be between 1.54 and 1.82, as described by the manufacturer. Next, weigh the first mouse and load a 0.3 milliliter insulin syringe with the corresponding calculated volume of poly(I:C)solution.Then, picking the mouse up by the tail, place it on the cage top, and secure it by the scruff. Now insert the needle, bevel side up, into the center of the two upper nipples at approximately 20 degrees relative to the mouse, and administer the poly(I:C)solution. Then place the mouse back into the cage.After all of the mice have been injected, house the cages in a quiet, low-traffic room to avoid other confounding effects, and weigh the mice the next morning. At least three days before the behavioral testing, change the cage bedding of the eight to 12 week old adult maternal immune activation or MIA offspring. 30 minutes before the test, acclimate the mice to the testing room.For a pre-pulse inhibition test, restrain the mice in plexiglass cylinders on top of a piezoelectric sensor. Acclimate the mouse to the pre-pulse inhibition chamber for five minutes, with six trials of 120 decibels of white noise. Then expose the mice to randomized mixtures of sound, as outlined in the table, and compare the results to the baseline startle response, to determine the pre-pulse inhibition of the MIA animals.For an open field test, place a mouse in the corner of an open square arena, with a defined 17 by 17 centimeter center zone, and record the trajectory of the mouse for 10 minutes, through a ceiling-mounted camera. Then quantify the center zone entries, and the time spent in the center zone. For a marble burying test, acclimate a mouse to a test cage, with compressed five centimeter deep, clean aspen pine bedding for 10 minutes, then place the mouse back in the home cage, and gently arrange 20 navy blue 1.5 centimeter diameter glass marbles in a four by five grid in the test cage.Now return the mouse to the test cage for 10 minutes, then place the animal back in the home cage, and count the number of marbles that were buried during the test period. Poly(I:C)injection at embryonic day 12.5 can evoke an acute inflammatory response in the maternal placental fetal axis, and precipitate a chronic effect on brain development and behavioral phenotypes. Indeed, poly(I:C)induces a higher Il6 gene expression in the maternal spleen, placenta, and fetal brain, three hours post-injection.Generally, when compared to saline-treated adult offspring, MIA adult offspring exhibit fewer center zone entries, and a shorter center zone duration in the open field test. The poly(I:C)injected animals also display more frequent burying behaviors in the marble burying test, and a lower pre-pulse inhibition. The loss of Purkinje cells in the cerebellum lobule seven is another hallmark of MIA offspring, with fewer calbindin positive Purkinje cells observed in the cerebellum lobule seven of these animals, compared to saline injected controls.While attempting this procedure, it's important to remember not to disturb the pregnant mice after MIA induction. Afterward, additional factors such as postnatal stress or infection can be induced to study additional environment environment interactions.

induction-maternal-immune-activation-mice-at-mid-gestation-stage-with

Research

JoVE Journal

Immunology and Infection

Induction of Experimental Autoimmune Hypophysitis in SJL Mice

Autoimmune hypophysitis can be reproduced experimentally by the injection of pituitary proteins mixed with an adjuvant into susceptible mice1. Mouse models allow us to study how diseases unfold, often providing a good replica of the same processes occurring in humans. For some autoimmune diseases, like type 1A diabetes, there are models (the NOD mouse) that spontaneously develop a disease similar to the human counterpart. For many other autoimmune diseases, however, the model needs to be induced experimentally. A common approach in this regard is to inject the mouse with a dominant antigen derived from the organ being studied. For example, investigators interested in autoimmune thyroiditis inject mice with thyroglobulin2, and those interested in myasthenia gravis inject them with the acetylcholine receptor3. If the autoantigen for a particular autoimmune disease is not known, investigators inject a crude protein extract from the organ targeted by the autoimmune reaction. For autoimmune hypophysitis, the pathogenic autoantigen(s) remain to be identified4, and thus a crude pituitary protein preparation is used. In this video article we demonstrate how to induce experimental autoimmune hypophysitis in SJL mice.

This video shows how to induce autoimmune hypophysitis in SJL mice and how to assess its severity by histopathology.

Autoimmune hypophysitis can be reproduced experimentally by the injection of pituitary proteins mixed with an adjuvant into susceptible mice1. Mouse ...

Seven Steps to Stellate Cells

Hepatic stellate cells are liver-resident cells of star-like morphology and are located in the space of Disse between liver sinusoidal endothelial cells and hepatocytes1,2. Stellate cells are derived from bone marrow precursors and store up to 80% of the total body vitamin A1, 2. Upon activation, stellate cells differentiate into myofibroblasts to produce extracellular matrix, thus contributing to liver fibrosis3. Based on their ability to contract, myofibroblastic stellate cells can regulate the vascular tone associated with portal hypertension4. Recently, we demonstrated that hepatic stellate cells are potent antigen presenting cells and can activate NKT cells as well as conventional T lymphocytes5. 

 Here we present a method for the efficient preparation of hepatic stellate cells from mouse liver. Due to their perisinusoidal localization, the isolation of hepatic stellate cells is a multi-step process. In order to render stellate cells accessible to isolation from the space of Disse, mouse livers are perfused in situ with the digestive enzymes Pronase E and Collagenase P. Following perfusion, the liver tissue is subjected to additional enzymatic treatment with Pronase E and Collagenase P in vitro. Subsequently, the method takes advantage of the massive amount of vitamin A-storing lipid droplets in hepatic stellate cells. This feature allows the separation of stellate cells from other hepatic cell types by centrifugation on an 8% Nycodenz gradient. The protocol described here yields a highly pure and homogenous population of stellate cells. Purity of preparations can be assessed by staining for the marker molecule glial fibrillary acidic protein (GFAP), prior to analysis by fluorescence microscopy or flow cytometry. Further, light microscopy reveals the unique appearance of star-shaped hepatic stellate cells that harbor high amounts of lipid droplets. 


 Taken together, we present a detailed protocol for the efficient isolation of hepatic stellate cells, including representative images of their morphological appearance and GFAP expression that help to define the stellate cell entity.

Here we describe a method for the isolation of hepatic stellate cells from mouse liver. For stellate cell purification, mouse livers are digested in situ and in vitro by pronase-collagenase treatment prior to density gradient centrifugation. This technique yields highly pure hepatic stellate cells.

Hepatic stellate cells are liver-resident  cells of star-like morphology and are located in the space of Disse between  liver sinusoidal endothelial cells ...

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of Listeria, which results in systemic infection2. After injection, Listeria quickly disseminates to the spleen and liver due to uptake by CD8&alpha;+ dendritic cells and Kupffer cells3,4. Once phagocytosed, various bacterial proteins enable Listeria to escape the phagosome, survive within the cytosol, and infect neighboring cells5. During the first three days of infection, different innate immune cells (e.g. monocytes, neutrophils, NK cells, dendritic cells) mediate bactericidal mechanisms that minimize Listeria proliferation. CD8+ T cells are subsequently recruited and responsible for the eventual clearance of Listeria from the host, typically within 10 days of infection6.
Successful clearance of Listeria from infected mice depends on the appropriate onset of host immune responses6	. There is a broad range of sensitivities amongst inbred mouse strains7,8. Generally, mice with increased susceptibility to Listeria infection are less able to control bacterial proliferation, demonstrating increased bacterial load and/or delayed clearance compared to resistant mice. Genetic studies, including linkage analyses and knockout mouse strains, have identified various genes for which sequence variation affects host responses to Listeria infection6,8-14. Determination and comparison of infection kinetics between different mouse strains is therefore an important method for identifying host genetic factors that contribute to immune responses against Listeria. Comparison of host responses to different Listeria strains is also an effective way to identify bacterial virulence factors that may serve as potential targets for antibiotic therapy or vaccine design.
We describe here a straightforward method for measuring bacterial load (colony forming units [CFU] per tissue) and preparing single-cell suspensions of the liver and spleen for FACS analysis of immune responses in Listeria-infected mice. This method is particularly useful for initial characterization of Listeria infection in novel mouse strains, as well as comparison of immune responses between different mouse strains infected with Listeria. We use the Listeria monocytogenes EGD strain15 that, when cultured on blood agar, exhibits a characteristic halo zone around each colony due to &beta;-hemolysis1 (Figure 1). Bacterial load and immune responses can be determined at any time-point after infection by culturing tissue homogenate on blood agar plates and preparing tissue cell suspensions for FACS analysis using the protocols described below. We would note that individuals who are immunocompromised or pregnant should not handle Listeria, and the relevant institutional biosafety committee and animal facility management should be consulted before work commences.

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Listeria monocytogenes is a model organism for studying immune responses and genetic susceptibility to intracellular bacteria in mice. This method enables one to measure bacterial load and generate single-cell suspensions of the liver and spleen from mice for FACS analysis to determine changes in immune cells due to Listeria infection.

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of ...

Right Ventricular Systolic Pressure Measurements in Combination with Harvest of Lung and Immune Tissue Samples in Mice

The function of the right heart is to pump blood through the lungs, thus linking right heart physiology and pulmonary vascular physiology. Inflammation is a common modifier of heart and lung function, by elaborating cellular infiltration, production of cytokines and growth factors, and by initiating remodeling processes 1.
Compared to the left ventricle, the right ventricle is a low-pressure pump that operates in a relatively narrow zone of pressure changes. Increased pulmonary artery pressures are associated with increased pressure in the lung vascular bed and pulmonary hypertension 2. Pulmonary hypertension is often associated with inflammatory lung diseases, for example chronic obstructive pulmonary disease, or autoimmune diseases 3. Because pulmonary hypertension confers a bad prognosis for quality of life and life expectancy, much research is directed towards understanding the mechanisms that might be targets for pharmaceutical intervention 4. The main challenge for the development of effective management tools for pulmonary hypertension remains the complexity of the simultaneous understanding of molecular and cellular changes in the right heart, the lungs and the immune system.
Here, we present a procedural workflow for the rapid and precise measurement of pressure changes in the right heart of mice and the simultaneous harvest of samples from heart, lungs and immune tissues. The method is based on the direct catheterization of the right ventricle via the jugular vein in close-chested mice, first developed in the late 1990s as surrogate measure of pressures in the pulmonary artery5-13. The organized team-approach facilitates a very rapid right heart catheterization technique. This makes it possible to perform the measurements in mice that spontaneously breathe room air. The organization of the work-flow in distinct work-areas reduces time delay and opens the possibility to simultaneously perform physiology experiments and harvest immune, heart and lung tissues.
The procedural workflow outlined here can be adapted for a wide variety of laboratory settings and study designs, from small, targeted experiments, to large drug screening assays. The simultaneous acquisition of cardiac physiology data that can be expanded to include echocardiography5,14-17 and harvest of heart, lung and immune tissues reduces the number of animals needed to obtain data that move the scientific knowledge basis forward. The procedural workflow presented here also provides an ideal basis for gaining knowledge of the networks that link immune, lung and heart function. The same principles outlined here can be adapted to study other or additional organs as needed.

A specific and rapid protocol to simultaneously investigate right heart function, lung inflammation, and the immune response is described as a learning tool. Video and figures describe physiology and microdissection techniques in an organized team-approach that is adaptable to be used for small to large sized studies.

The function of the right heart is to pump blood through the lungs, thus linking right heart physiology and pulmonary vascular physiology. Inflammation is ...

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. Conversely, viruses have evolved intricate strategies to evade and exploit host immune signaling for survival and propagation. Viral immune evasion, entailing host defense and viral evasion, provides one of the most fascinating and dynamic interfaces to discern the host-virus interaction. These studies advance our understanding in innate immune regulation and pave our way to develop novel antiviral therapies.
Murine &#947;HV68 is a natural pathogen of murine rodents. &#947;HV68 infection of mice provides a tractable small animal model to examine the antiviral response to human KSHV and EBV of which perturbation of in vivo virus-host interactions is not applicable. Here we describe a protocol to determine the antiviral cytokine production. This protocol can be adapted to other viruses and signaling pathways.
Recently, we have discovered that &#947;HV68 hijacks MAVS and IKK&#946;, key innate immune signaling components downstream of the cytosolic RIG-I and MDA5, to abrogate NF&#922;B activation and antiviral cytokine production. Specifically, &#947;HV68 infection activates IKK&#946; and that activated IKK&#946; phosphorylates RelA to accelerate RelA degradation. As such, &#947;HV68 efficiently uncouples NF&#922;B activation from its upstream activated IKK&#946;, negating antiviral cytokine gene expression. This study elucidates an intricate strategy whereby the upstream innate immune activation is intercepted by a viral pathogen to nullify the immediate downstream transcriptional activation and evade antiviral cytokine production.

We describe a protocol to measure the antiviral cytokine production in mice infected with a model herpesvirus, murine gamma herpesvirus 68 (&#947;HV68) that is closely-related to human Kaposi&#8217;s sarcoma-associated herpesvirus (KSHV) and Epstein-Barr virus (EBV). Utilizing genetically modified mouse strains and mouse embryonic fibroblasts (MEFs), we assessed the antiviral cytokine production both in vivo and ex vivo. &#8220;Reconstituting&#8221; the expression of innate immune components in knockout embryonic fibroblasts by lentiviral transduction, we further pinpoint specific innate immune molecules and dissect the key signaling events that differentially regulate the antiviral cytokine production.

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages and disadvantages. We describe here an experimental colitis model that is initiated by adoptive transfer of syngeneic splenic CD4+CD45RBhigh T cells into T and B cell deficient recipient mice. The CD4+CD45RBhigh T cell population that largely consists of na&#239;ve effector cells is capable of inducing chronic intestinal inflammation, closely resembling key aspects of human IBD. This method can be manipulated to study aspects of disease onset and progression. Additionally it can be used to study the function of innate, adaptive, and regulatory immune cell populations, and the role of environmental exposures, i.e., the microbiota, in intestinal inflammation. In this article we illustrate the methodology for inducing colitis with a step-by-step protocol. This includes a video demonstration of key technical aspects required to successfully develop this murine model of experimental colitis for research purposes.

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Here, we present a protocol to induce colonic inflammation in mice by adoptive transfer of syngeneic CD4+CD45RBhigh T cells into T and B cell deficient recipients. Clinical and histopathological features mimic human inflammatory bowel diseases. This method allows the study of the initiation of colonic inflammation and progression of disease.

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages ...

Isolation of Leukocytes from the Murine Tissues at the Maternal-Fetal Interface

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing fetus. This tolerance is initiated during coitus, established during fecundation and implantation, and maintained throughout pregnancy. Active cellular and molecular mediators of maternal-fetal tolerance are enriched at the site of contact between fetal and maternal tissues, known as the maternal-fetal interface, which includes the placenta and the uterine and decidual tissues. This interface is comprised of stromal cells and infiltrating leukocytes, and their abundance and phenotypic characteristics change over the course of pregnancy. Infiltrating leukocytes at the maternal-fetal interface include neutrophils, macrophages, dendritic cells, mast cells, T cells, B cells, NK cells, and NKT cells that together create the local micro-environment that sustains pregnancy. An imbalance among these cells or any inappropriate alteration in their phenotypes is considered a mechanism of disease in pregnancy. Therefore, the study of leukocytes that infiltrate the maternal-fetal interface is essential in order to elucidate the immune mechanisms that lead to pregnancy-related complications. Described herein is a protocol that uses a combination of gentle mechanical dissociation followed by a robust enzymatic disaggregation with a proteolytic and collagenolytic enzymatic cocktail to isolate the infiltrating leukocytes from the murine tissues at the maternal-fetal interface. This protocol allows for the isolation of high numbers of viable leukocytes (&#62;70%) with sufficiently conserved antigenic and functional properties. Isolated leukocytes can then be analyzed by several techniques, including immunophenotyping, cell sorting, imaging, immunoblotting, mRNA expression, cell culture, and in vitro functional assays such as mixed leukocyte reactions, proliferation, or cytotoxicity assays.

Described herein is a protocol to isolate and analyze the infiltrating leukocytes of tissues at the maternal-fetal interface (uterus, decidua, and placenta) of mice. This protocol maintains the integrity of most cell surface markers and yields enough viable cells for downstream applications including flow cytometry analysis.

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing ...

Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) resulting in cognitive and motor impairment. Experimental autoimmune encephalomyelitis (EAE) is a useful animal model of MS, because it is also characterized by lesion formation in the CNS, motor impairment and is also driven by autoimmune and inflammatory reactions. One of the EAE models is induced with a peptide derived from the myelin oligodendrocyte protein (MOG)35-55 in mice. The EAE mice develop a progressive disease course. This course is divided into three phases: the preclinical phase (day 0 - 9), the disease onset (day 10 - 11) and the acute phase (day 12 - 14). MS and EAE are induced by autoreactive T cells that infiltrate the CNS. These T cells secrete chemokines and cytokines which lead to the recruitment of further immune cells. Therefore, the immune cell distribution in the spinal cord during the three disease phases was investigated. To highlight the time point of the disease at which the activation/proliferation/accumulation of T cells, B cells and monocytes starts, the immune cell distribution in lymph nodes, spleen and blood was also assessed. Furthermore, the levels of several cytokines (IL-1&#946;, IL-6, IL-23, TNF&#945;, IFN&#947;) in the three disease phases were determined, to gain insight into the inflammatory processes of the disease. In conclusion, the data provide an overview of the functional profile of immune cells during EAE pathology.

This manuscript describes the methods for induction and scoring of the experimental autoimmune encephalomyelitis (EAE) model, together with the assessment of immune cell distribution and mRNA cytokine levels in lymph nodes, spleen, blood and spinal cord using flow cytometry and quantitative PCR, respectively, at various disease phases.

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) ...

Human Placental and Decidual Organ Cultures to Study Infections at the Maternal-fetal Interface

The placenta shows a large degree of interspecies anatomic variability. To best understand biology and pathophysiology of the human placenta, it is imperative to design experiments using human cells and tissues. An advantage of organ culture is maintenance of three-dimensional (3D) structural organization and extracellular matrix. The goal of the method described here is successful establishment of ex vivo human gestational tissue organ cultures and their healthy culture maintenance for 72-96 hr. The protocol details the immediate processing of research-consented, placental and decidual specimens fresh from the operating suite. These are abundant specimens that would otherwise be discarded. Detailed instructions on the sterile collection of these samples, including morphologic details on how to select appropriate tissues to establish 3D organ cultures, is provided. Placental villous and decidual tissues are microdissected into 2-3 mm3 pieces and placed separately on matrix-lined transwell filters and cultured for several days. Villous and decidual organ cultures are well suited for the study of human host-pathogen interaction. As compared to other model organisms, these human cultures are particularly advantageous to examine mechanism of infection for pathogens that demonstrate variable patterns of host specificity. As an example, we demonstrate infection of placental and decidual organ cultures with the clinically relevant, facultative intracellular bacterial pathogen Listeria monocytogenes.

A simple method to establish primary human placental (villous) and decidual organ cultures is described. Villous and decidual organ cultures are invaluable tools for studying pathogenesis at the human maternal-fetal interface. Infection with the facultative intracellular bacterium Listeria monocytogenes is demonstrated.

The placenta shows a large degree of interspecies anatomic variability. To best understand biology and pathophysiology of the human placenta, it is ...

Determining Immune System Suppression versus CNS Protection for Pharmacological Interventions in Autoimmune Demyelination

A major hallmark of the autoimmune demyelinating disease multiple sclerosis (MS) is immune cell infiltration into the brain and spinal cord resulting in myelin destruction, which not only slows conduction of nerve impulses, but causes axonal injury resulting in motor and cognitive decline. Current treatments for MS focus on attenuating immune cell infiltration into the central nervous system (CNS). These treatments decrease the number of relapses, improving quality of life, but do not completely eliminate relapses so long-term disability is not improved. Therefore, therapeutic agents that protect the CNS are warranted. In both animal models as well as human patients with MS, T cell entry into the CNS is generally considered the initiating inflammatory event. In order to assess if a drug protects the CNS, any potential effects on immune cell infiltration or proliferation in the periphery must be ruled out. This protocol describes how to determine whether CNS protection observed after drug intervention is a consequence of attenuating CNS-infiltrating immune cells or blocking death of CNS cells during inflammatory insults. The ability to examine MS treatments that are protective to the CNS during inflammatory insults is highly critical for the advancement of therapeutic strategies since current treatments reduce, but do not completely eliminate, relapses (i.e., immune cell infiltration), leaving the CNS vulnerable to degeneration.

This protocol describes how to determine whether pharmacological treatments for experimental autoimmune encephalomyelitis show CNS protection as a consequence of suppressing immune cell infiltration or are neuroprotective during the onslaught of immune cell infiltration.

A major hallmark of the autoimmune demyelinating disease multiple sclerosis (MS) is immune cell infiltration into the brain and spinal cord resulting in ...