Wir möchten, dass der verstorbene Dr. Paul H. Patterson für seine Beiträge zum Fortschritt der MIA-Modell zu ehren, Autismus und Schizophrenie-Forschung. Wir erkennen an Sarkis K. Mazmanian für seine große Unterstützung auf diesem Protokoll; Ruben M. Bayon, Yvette Garcia-Flores, Karen C. Lencioni und Leslie A. Neumann für administrative Unterstützung; Ali Khoshnan und Jan C. Ko für die Unterstützung bei der Verfilmung; Elaine Y. Hsiao und Natalia Malkova für ihre Beratung auf MIA Induktion; Jeffrey S. Cochrane, Joaquin Gutierrez, Kwan F. Lee, Jaime Rodriguez, Lorena C. Sandovals und Natalie A. Verduzco für ihre Fachtierhaltung. Diese Arbeit wurde durch das NIH Conte-Center-Preis (NIH 5P50MH086383-04, Paul H. Patterson) unterstützt; Autismus spricht (# 7670, Paul H. Patterson); Simons Foundation (# 322839, zu Sarkis K. Mazmanian); NIH Ausbildung Grant (NIH / NRSA T32GM07616 K.-HC); Caltech Sommer Wissenschaftliche Fellowship (SURF) (bis ZY); Amgen Scholars Program am California Institute of Technology (zu ZY); und Postdoctoral Fellowship from National Science Council, Taiwan (NSC 101-2917-I-564-039, W.-LW).

Alle Protokolle wurden im Rahmen der Genehmigung des California Institute of Technology Institutional Animal Care und Use Committee (IACUC) durchgeführt. 1. Vorbereitung für Timed-Paarung Paare <ol><li> Verwenden Sie mindestens sechs Dämme für Verhaltensexperimente und 3 für die Genexpressionsanalyse. HINWEIS: die doppelte Anzahl der geschätzten weiblichen Mäusen, da nur etwa 50% der Mäuse aus der timed-mating eingesteckt werden. </li><li> Verwenden weibliche Mäuse ohne vorherige Schwangerschaft und bei 8-16 Wochen alt sind. HINWEIS: Weibliche Mäuse, die vor sexuellen Kontakt mit männlichen Mäusen haben, aber noch nicht schwanger gewesen sind akzeptabel. </li><li> Haus der weiblichen Mäusen zusammen und legen Sie die Käfige nebeneinander, um ihre Östrocyclus zu synchronisieren. Verwenden Sie ein Standard-Mäuse Käfig mit einer Höhe von mehr als 5,5 Zoll und einer 75 Quadratzoll Innenboden Gehäuse von 5 erwachsenen Mäusen zu ermöglichen. Beschriften Sie jede weibliche Maus mit einem Ohr Schlag. </li></ol> 2. Einrichten Timed-mating Pair <ol><li> Stellen Sie die timed-Paarung 0-2 Stunden, bevor der Dunkel-Zyklus beginnt. Legen Sie zwei weibliche Mäuse in jedem Käfig. Nehmen Sie die Mäuse heraus und wiegen sie einzeln. Nehmen Sie das Körpergewicht der einzelnen weiblichen Maus. </li><li> Legen Sie eine männliche Maus in jedem Käfig mit den beiden weiblichen Mäusen. Verwenden trio Paarungs das väterliche Verwechselung Effekt zu minimieren. </li></ol> 3. Vaginalpfropfens Check (E0.5) <ol><li> Überprüfen Sie die weibliche Mäuse 0-4 Stunden nach der Dunkel-Zyklus endet. Heben Sie vorsichtig die weibliche Maus aus der Basis des Schwanzes und lassen Sie die Maus, um das Drahtgitter, Käfig oben oder Käfigrand zu greifen. </li><li> Suchen Sie nach Anzeichen von Vaginalpfropfens: Vaginalpfropfens ist eine sichtbare weißliche Masse in die vaginale Öffnung. Wenn der Stecker nicht offensichtlich ist, legen Sie vorsichtig mit einem 200 ul Pipettenspitze in die vaginale Öffnung. Widerstand von Koagulation bestätigt Vaginalpfropfens Bildung. Überprüfen Sie die Vaginalpfropfens einmal pro Tag. HINWEIS: Vaginal Stecker ist nur ein Hinweis darauf, dass der Kopulation, aufgetreten ist und daher nicht funktioniert guarantee Schwangerschaft. Vaginalpfropfens kann schwierig sein, in bestimmten Stämmen von Mäusen zu identifizieren. Wenden Sie sich an einen erfahrenen Mäuse Betreuer, die Genauigkeit der Stecker Identifizierung zu erhöhen. </li><li> Bewegen Sie die gesteckten Mäuse in einen neuen Käfig und Gruppe beherbergen sie. Definieren Sie den Tag der Vaginalpfropfens Aussehen wie embryonale 0,5 Tage (E0.5). </li></ol> 4. Auf E10.5-11.5, Check für Schwangerschaft <ol><li> Heben Sie vorsichtig die Basis des Schwanzes und lassen Sie die Maus, um das Drahtgitter, Käfig oben oder Käfigrand zu greifen. Beachten Sie die Bauchbereich auf Anzeichen einer Schwangerschaft zu überprüfen, zum Beispiel eine Ausbuchtung im Bauch (Abbildung 1). HINWEIS: Das Zeichen der Schwangerschaft ist immer deutlicher bei E11,5 als bei E10,5. </li><li> Wiegen Sie die Mäuse Schwangerschaft zu überprüfen. Die schwangere Maus wiegt im Allgemeinen ungefähr 20% schwerer bei E10.5 und 30% schwerer bei E12.5 im Vergleich zu einer nicht-schwangeren Maus (Abbildung 2). Einfamilienhaus die schwangere Mäuse in saubere Käfige. </li></ol> 5. 20 mg /kg Poly (I: C) Herstellung <ol><li> Verwenden Sie mindestens sechs Dämme pro Gruppe für Verhaltensexperimente und 3 pro Gruppe für die Genexpressionsanalyse. Bereiten Sie die entsprechende Menge an Poly (I: C) Lösung. </li><li> Wiegen Sie die poly (I: C) -Pulver in einem 50 ml konischen Röhrchen eine Endkonzentration von 40 mg / ml herzustellen. Um die Spannung, die durch Injektionsvolumen zu minimieren und zu standardisieren, injizieren 5 ul poly (I: C) Lösung pro Gramm Körpergewicht der Maus (5 &amp; mgr; l / g bzw. 5 ml / kg). Zu induzieren MIA injizieren wir 20 mg Poly (I: C) pro kg. HINWEIS: Die Konzentration von Poly (I: C) Lösung erforderlich ist (20 mg / kg) / (5 ml / kg) = 4 mg / ml. Da das poly (I: C) Pulver enthält 10% poly (I: C), benötigen wir eine Endkonzentration von (4 mg / ml) /0.1= 40 mg / ml Poly (I: C), um Lösung. ACHTUNG: Die Poly (I: C) Pulver ist sehr leicht. Achten Sie darauf, keine Pulver zu verlieren, während aus dem Spachtel auf den konischen Röhrchen übertragen. </li><li> Fügen Sie die entsprechenden Volumen von 0,9% Natriumchlorid (Kochsalzlösung) in den konischen Wannee und die Kappe schließen. Lösen Sie das Pulver durch sanft die Salztropfen über der Poly-Walzen (I: C) Pulver, bis die Lösung klar ist. Zentrifugieren Sie die konische Röhrchen bei 800 g für 1 min (3C). Filtern die poly (I: C) Lösung von 0,22-um-Filter. Übertragen die poly (I: C) Lösung eines 1,5 oder 2 ml Mikrozentrifugenröhrchen. Optional: ein Spektralphotometer Verwenden Sie das 260/280 Verhältnis des Poly (I: C) zu messen Lösung. Sicherstellen , dass das Verhältnis zwischen 1,54 bis 1,82 (3) , wie vom Hersteller beschrieben. HINWEIS: Die Kochsalzlösung verwendet Poly aufzulösen (I: C) Pulver und dienen als Kontroll Injektion sollte steril und pharmazeutischer Qualität sein. </li></ol> 6. Saline oder Poly (I: C) Injection auf E12.5 <ol><li> Wiegen Sie die Maus auf die Waage und steckte es wieder in den Käfig. Verwenden Sie die folgende Formel, um das Volumen der Injektion sowohl für Kochsalzlösung und Poly zu berechnen (I: C) Mäuse: Körpergewicht (g), multipliziert mit 5 = gewünschte Injektionsvolumen (ul). Verwenden Sie ein 0,3 ml insul(I: C) Lösung, beispielsweise 150 &amp; mgr; l für eine 30 g Maus in der Spritze das berechnete Volumen Kochsalzlösung oder 20 mg / kg Poly auszuarbeiten. </li><li> holen Sie vorsichtig die Maus durch die Basis des Schwanzes und legen Sie es auf der Oberseite des Käfigs. Behandeln Sie die Maus verwirrende Effekte sanft durch Stress ausgelöst zu vermeiden. Führen Sie die Nadel, Fase auf, bei etwa 20 ° gegenüber der Maus in die Mitte seiner beiden oberen Nippel (Abbildung 4), und injizieren , um die Kochsalzlösung oder Poly (I: C) Lösung. HINWEIS: Die Nadel sollte für jede Maus nach der Injektion ersetzt werden. </li><li> Platzieren Sie die Maus wieder in seinen Käfig. Legen Sie die Käfige in einer ruhigen, wenig Verkehr Zimmer, die anderen verwirrende Effekte zu vermeiden. </li></ol> 7. Der Tag nach Poly (I: C) Injektion (E13.5) <ol><li> Schauen Sie sich die injizierten Mäuse am folgenden Morgen. Verwenden Sie eine Skala Körpergewicht zu messen. HINWEIS: Poly (I: C) injiziert trächtige Mäuse gewinnen in der Regel weniger Gewicht als Salz Mäuse am Tag nach inj injiziertection. </li><li> Bitte nicht stören die Mäuse, bis die Nachkommen geboren werden. </li></ol> 8. Spur von MIA Nachkommen <ol><li> Um die verwirrende Wirkung von MIA Induktion zu minimieren, befolgen Sie die unten aufgeführten Richtlinien die Verwendung von MIA Nachkommen zu messen. <ol><li> Schließen Sie die Würfe von Frühgeborenen oder verzögerte Geburt, oder wenn die Wurfgröße kleiner als 5. </li><li> Euthanize die übermäßigen Welpen von CO 2 , wenn die Wurfgröße größer als 10 ist. </li></ol></li></ol> 9. Optional: Überprüfen Sie die akute Entzündungsantwort nach MIA <ol><li> Opfere die schwangere Mäuse 3 Stunden nach der Kochsalzlösung oder Poly (I: C) Injektion mit dem beschriebenen Verfahren in der Tierpflege Institution Ausschuss genehmigten Protokoll. HINWEIS: Cervical Dislokation wird oft bevorzugt , da sie die Wirkung von CO 2 / Euthanasie Medikamente auf dem Damm und embryo minimiert. </li><li> Sammeln Sie die Milz von den erwachsenen schwangeren Mäusen und zu isolieren, die Plazenta und fetale brain unter dem Stereomikroskop. <ol><li> Für Milz Sammlung, legen Sie die Maus auf die Dissektion Platte und 70% Ethanol auf den Bauchbereich der schwangeren Mäusen sprühen. ein Paar sterile Schere unter dem Brustkorb durch die Haut einen vertikalen Schnitt in der Mitte der Bauchbereich zu machen. </li><li> Die Milz liegt in der linken überlegen Bauch. Verwenden einer Pinzette, die Milz zu isolieren. Rollen Sie die Milz auf heikle Aufgabe Wischer, um das Fettgewebe um das Organ zu entfernen. Sammeln Sie in etwa 50 mg Milzgewebe und legen Sie sie einzeln in Eppendorf-Röhrchen mit 500 &amp; mgr; l RNA stabilisieren Puffer oder TRIzol zu Nukleinsäure-Abbau zu verhindern. Lagern Sie die Proben bei -80 ° C Gefrierschrank bis zur Verwendung. </li><li> Für Plazenta Sammlung, ziehen Sie vorsichtig die Gebärmutterhörner aus dem Körper. Legen Sie die Gebärmutterhörner in einer Petrischale gefüllt mit autoklavierten phosphatgepufferter Salzlösung (PBS) und lassen Sie die Schüssel auf dem Eis. Verwenden Sie zwei Zangen die Gebärmutterwand aufreißen und die Fruchtblase aus. <ol><li>Verwenden Sie vorsichtig die Pinzette die Fruchtblase zu öffnen, ohne die Plazenta und den Fötus schädigen. Trennen Sie die Plazenta von der Fötus und schneiden die Nabelschnur so nah an der Plazenta wie möglich. Entfernen Sie die Fruchtblase Trümmer aus der Plazenta. Legen Sie die Plazenta einzeln in Eppendorf-Röhrchen mit 500 &amp; mgr; l RNA-Puffer oder TRIzol stabilisieren. Lagern Sie die Probe bei -80 ° C Gefrierschrank bis zur Verwendung. </li></ol></li><li> Für fötale Gehirn Sammlung, Speicherung der Fötus in der RNA-Puffer von Schritt 9.2.2 bis Dissektion stabilisieren. Necken die pialen Membran aus dem Ventrikel des Gehirns mit zarten # 5 Pinzette unter dem Stereomikroskop ab. Entfernen Sie vorsichtig alle die Membran von der fetalen Gehirns. Legen Sie die fötale Gehirn einzeln in Eppendorf-Röhrchen mit 500 &amp; mgr; l RNA-Puffer oder TRIzol stabilisieren. Lagern Sie die Probe bei -80 ° C Gefrierschrank bis zur Verwendung. </li></ol></li><li> Extrahieren Sie die RNA aus dem Gewebe und wandeln die RNA in cDNA. Analysieren Sie den IL - 6 - Gen - Expression in der cDNA durch real-time PCR. </li><li> Extrahieren Sie die RNA aus den Geweben durch Befolgen der Herstellung Protokoll TRIzol. Wenn die Gewebe in RNA Stabilisierungspuffer gespeichert. Tauen Sie die Probe und drehen Sie den Puffer nach unten. Übertragen Sie das Gewebe durch die Spitze auf einen anderen eppendorf mit 500 ul TRIzol und RNA-Extraktion fortzusetzen. </li><li> Verwenden Sie ein Spektralfotometer, die Konzentration, 260/280 und 260/230 Verhältnis der RNA zu messen. Sicherstellen, dass die Verhältnisse über 2,0 sind. </li><li> Beseitigen die DNA Kontamination durch behandelt, um die RNA mit DNase I. Mix 1 &amp; mgr; g RNA, 1 &amp; mgr; l 10X-Reaktionspuffer, 1 &amp; mgr; l RNase-Free DNase und Nuklease-freies Wasser bis zu einem Endvolumen von 10 &amp; mgr; l. Inkubieren des Mastermix bei 37 ° C für 30 min. 1 &amp; mgr; l DNase Stop-Lösung, um die Reaktion zu beenden. Inkubieren der Mischung bei 65 ° C für 10 min. </li><li> Kehrt die RNA in cDNA transkribiert. Verwenden 20 ul-Reaktionen und bis zu 1 &amp; mgr; g Gesamt-RNA pro Reaktion. Mix 4 ul 5x Transkription (RT) Reaktionsmischung Puffer umkehren, 1 &amp; mgr; l reverse Transkriptase, 11 &amp; mgr; l RNA - Matrize nach der Behandlung mit DNase I und 4 &amp; mgr; l Nuklease-freies H 2 O , um eine endgültige 20 &amp; mgr; l Lösung herzustellen. Den Thermocycler Bedingungen für die RT. Ein allgemeiner Zustand sind: Schritt 1: 25 ° C für 5 min; Schritt 2: 42 ° C für 30 min; Schritt 3: 85 ° C für 5 min; Schritt 4: Halten bei 4 ° C. Verdünnen Sie die cDNA 5 mal. Für die kurzfristige Lagerung, speichern Sie die cDNA bei 4 ° C. Für die Langzeitlagerung gefrier die cDNA bei -20 ° C. </li><li> Analysieren Sie den IL - 6 - Gen - Expression in der cDNA durch real-time PCR und normalisieren die IL - 6 - Genexpression zu ß-Actin - Genexpression. <ol><li> Machen Sie einen Master - Mix für IL - 6 und β-Actin - Erkennung. Verwenden Sie 25 ul Reaktion, die Master - Mix für jedes Gen enthält 12,5 ul SYBR Green Mix, 0,5 ul 10 uM Vorwärtsprimer, 0,5 ul 10 uM Reverse - Primer und 6,5 ul Nuklease-freies H 2 O. </li><li> Platz 5 ul 5x verdünnt cDNA eint die Unterseite des Brunnens von optischen 96-Well-Reaktionsplatte. Je 20 ul Master-Mix in jede Vertiefung eine endgültige 25 &amp; mgr; l PCR-Mix zu machen. Verdreifachen jedes Gen für jede Probe. Verschließen Sie die Platte durch eine optische Klebefolie verwendet wird. Spin down die Platte bei 800 × g für 3 min bei 4 ° C Verwenden Sie das Standardprogramm von real-time PCR: Schritt 1: 50 ° C für 2 min; Schritt 2: 95 ° C für 10 min; Schritt 3: 40 Zyklen von 95 ° C für 15 sec und die Temperatur 60 ° C für 1 min. Fügen Sie einen zusätzlichen Schritt für -Dissoziationskurve. </li></ol></li></ol> Untersuchen 10. die Verhaltensauffälligkeiten in MIA Erwachsene Kinder (Optional): <ol><li> Führen Sie die Verhaltenstests im Alter von 8-12 Wochen. Ändern Sie den Käfig Bettwäsche mindestens 3 Tage vor dem Test. Akklimatisieren die Mäuse auf die Verhaltenstestraum mindestens 30 min vor dem Test. </li><li> Für Präpulsinhibition (PPI), hemmen die Mäuse in Plexiglaszylinder mit einem piezoelektrischen Sensor darunter. Akklimatisieren die Mäuse auf die PPIKammer für 5 min. Setzen Sie die Mäuse mit 6 Studien mit 120 dB weißes Rauschen (Schreckhaftigkeit). </li><li> Dann setzen die Mäuse mit randomisierten Mischungen von 14 Studien von Hintergrundgeräuschen, 14 Studien mit Startle, 14 Studien mit Prepuls 5 dB (5 dB höher als Hintergrundrauschen) + Startle (PPI5) und 14 Studien mit Prepuls 15 dB (15 dB höher als Hintergrundrauschen + Startle (PPI15). </li><li> Der Mittelwert der Schreckhaftigkeit für die ersten 6 Studien von 120 dB Studien. Der Mittelwert der Schreckhaftigkeit für die anderen einzelnen Stimulationen. Covert den Wert auf Präpulsinhibition durch (Startle - PPI5 oder PPI15) / Startle. </li><li> Für Open-Feldtest, legen Sie die Maus in die Ecke eines offenen Platz Arena (50 x 50 x 50 cm 3). Notieren Sie sich die Flugbahn der Maus für 10 min durch eine Decke montierten Kamera. Definieren Sie die Mitte der Arena als der mittleren Zone (17 x 17 cm 2). Quantifizieren Sie die zurückgelegte Strecke, Mittelzone Einträge und Zeit in Mittelzone verbracht manuell oder durch bildbasierte automatische Analyse-Software. </li&gt; <li> Für Marmor Vergraben Test akklimatisieren Sie die Maus auf einen Testkäfig mit Druck 5cm tief, sauber, Aspen Kiefer Betten für 10 min. Bringen Sie die Maus auf seine homecage. Sanft legen Sie 20 marineblau 1,5 cm Durchmesser Glasmurmeln in der Art und Weise von 4 x 5-Anordnung. Platzieren Sie die Maus zurück in den Testkäfig mit Murmeln für 10 min. Zählen Sie die Murmeln, die in der 10 min Prüfdauer begraben wurde. </li></ol> 11. Überprüfen Sie die Zerebelläre Neuropathologie in MIA Erwachsene Kinder (Optional): <ol><li> Euthanize die Saline und MIA erwachsenen Nachkommen von Betäubungsmittel. Perfundieren die Maus mit 50 ml PBS und anschließend 50 ml 4% Paraformaldehyd durch die Herz-Kreislauf-System. </li><li> Entfernen Sie das Gehirn sorgfältig und Postfix das Gehirn in 4% Paraformaldehyd über Nacht bei 4 ° C. Spülen Sie das Gehirn mit PBS dreimal und speichern das Gehirn in PBS mit 0,02% Natriumazid in einem 4 ° C Kühlschrank bis zur Verwendung. HINWEIS: Das nachfixiert Gehirn kann in PBS mit 0,02% sod gespeichert werdenium Azid im Kühlschrank für bis zu einem Monat. </li><li> Abschnitt das Gehirn in 50 &amp; mgr; m dünne Scheiben sagittal mit Vibratom. Sammeln Sie die Gehirnschnitte mit einem weichen Pinsel Stift. Beenden Sie die endogene Peroxidase-Aktivität durch die Abschnitte in 0,6% Wasserstoffperoxid für 30 Minuten bei Raumtemperatur inkubiert. </li><li> Inkubieren der Abschnitte in anti-Calbindin Antikörper in Blockierungspuffer (10% Ziegenserum mit 0,1% Triton X-100 und 0,02% Natriumazid in PBS) verdünnt, über Nacht bei Raumtemperatur. Dann Inkubieren der Abschnitte in entsprechende in biotinylierter sekundärer Antikörper verdünnt Puffer für 2 Stunden bei Raumtemperatur blockiert. </li><li> Inkubieren der Abschnitte in Avidin DH - biotinylierter Peroxidase-Komplex H-Puffer des Biotin für 1 Stunde bei Raumtemperatur zu detektieren. Entwickeln Sie die Abschnitte durch Peroxidase-Substrat mit dem Antigen zu visualisieren. Waschen der Schnitte mit PBS dreimal zwischen den Schritten. Montieren Sie die Schnitte auf Objektträger. Bild die Abschnitte unter dem Mikroskop. </li></ol&gt;

<ol>
	<li>Brown, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiologic+studies+of+exposure+to+prenatal+infection+and+risk+of+schizophrenia+and+autism.">Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism.</a> Dev Neurobiol. 72 (10), 1272-1276 (2012).</li><li>Fatemi, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+viral+theory+of+schizophrenia+revisited:+abnormal+placental+gene+expression+and+structural+changes+with+lack+of+evidence+for+H1N1+viral+presence+in+placentae+of+infected+mice+or+brains+of+exposed+offspring.">The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring.</a> Neuropharmacology. 62 (3), 1290-1298 (2012).</li><li>Shi, L., Tu, N., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+influenza+infection+is+likely+to+alter+fetal+brain+development+indirectly:+the+virus+is+not+detected+in+the+fetus.">Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus.</a> Int J Dev Neurosci. 23 (2-3), 299-305 (2005).</li><li>Knuesel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+abnormal+brain+development+across+CNS+disorders.">Maternal immune activation and abnormal brain development across CNS disorders.</a> Nat Rev Neurol. 10 (11), 643-660 (2014).</li><li>Meyer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+poly(i:C)+exposure+and+other+developmental+immune+activation+models+in+rodent+systems.">Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems.</a> Biol Psychiatry. 75 (4), 307-315 (2014).</li><li>Meyer, U., Feldon, J., Yee, B. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+the+fetal+brain+cytokine+imbalance+hypothesis+of+schizophrenia.">A review of the fetal brain cytokine imbalance hypothesis of schizophrenia.</a> Schizophr Bull. 35 (5), 959-972 (2009).</li><li>Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+prenatal+infection+on+brain+development+and+behavior:+a+review+of+findings+from+animal+models.">Effects of prenatal infection on brain development and behavior: a review of findings from animal models.</a> Brain Behav Immun. 24 (6), 881-897 (2010).</li><li>Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+an+autism+risk+factor+in+mice+leads+to+permanent+immune+dysregulation.">Modeling an autism risk factor in mice leads to permanent immune dysregulation.</a> Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).</li><li>Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+nonspatial+information+processing+in+the+hippocampus+of+the+adult+offspring.">Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring.</a> Brain Behav Immun. 24 (6), 930-941 (2010).</li><li>Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+fetal+brain+development+through+interleukin-6.">Maternal immune activation alters fetal brain development through interleukin-6.</a> J Neurosci. 27 (40), 10695-10702 (2007).</li><li>Shi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+alters+cerebellar+development+in+the+offspring.">Activation of the maternal immune system alters cerebellar development in the offspring.</a> Brain Behav Immun. 23 (1), 116-123 (2009).</li><li>Hsiao, E. Y., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+induces+endocrine+changes+in+the+placenta+via+IL-6.">Activation of the maternal immune system induces endocrine changes in the placenta via IL-6.</a> Brain Behav Immun. 25 (4), 604-615 (2011).</li><li>Wu, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+interaction+between+maternal+immune+activation+and+alpha+7+nicotinic+acetylcholine+receptor+in+regulating+behaviors+in+the+offspring.">The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring.</a> Brain Behav Immun. , (2015).</li><li>Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+causes+age-+and+region-specific+changes+in+brain+cytokines+in+offspring+throughout+development.">Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development.</a> Brain Behav Immun. 31, 54-68 (2013).</li><li>Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+maternal+immune+activation+on+gene+expression+patterns+in+the+fetal+brain.">Effects of maternal immune activation on gene expression patterns in the fetal brain.</a> Transl Psychiatry. 2, e98 (2012).</li><li>Hsiao, E. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbiota+modulate+behavioral+and+physiological+abnormalities+associated+with+neurodevelopmental+disorders.">Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders.</a> Cell. 155 (7), 1451-1463 (2013).</li><li>Naviaux, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antipurinergic+therapy+corrects+the+autism-like+features+in+the+poly(IC)+mouse+model.">Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model.</a> PLoS One. 8 (3), e57380 (2013).</li><li>Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+inflammation+promotes+fetal+microglial+activation+and+increased+cholinergic+expression+in+the+fetal+basal+forebrain:+role+of+interleukin-6.">Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6.</a> Pediatr Res. 74 (4), 393-401 (2013).</li><li>Schwartzer, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+strain+specific+interactions+in+the+development+of+autism-like+behaviors+in+mice.">Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice.</a> Transl Psychiatry. 3, e240 (2013).</li><li>Khan, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+effects+of+maternal+immune+activation+on+depression-like+behavior+in+the+mouse.">Long-term effects of maternal immune activation on depression-like behavior in the mouse.</a> Transl Psychiatry. 4, e363 (2014).</li><li>Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+transformations+of+neurodevelopmental+sequences+across+mammalian+species.">Modeling transformations of neurodevelopmental sequences across mammalian species.</a> J Neurosci. 33 (17), 7368-7383 (2013).</li><li>Abazyan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+interaction+of+mutant+DISC1+and+immune+activation+produces+adult+psychopathology.">Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology.</a> Biol Psychiatry. 68 (12), 1172-1181 (2010).</li><li>Meyer, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adult+behavioral+and+pharmacological+dysfunctions+following+disruption+of+the+fetal+brain+balance+between+pro-inflammatory+and+IL-10-mediated+anti-inflammatory+signaling.">Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling.</a> Mol Psychiatry. 13 (2), 208-221 (2008).</li><li>Vuillermot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+immune+activation+interacts+with+genetic+Nurr1+deficiency+in+the+development+of+attentional+impairments.">Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments.</a> J Neurosci. 32 (2), 436-451 (2012).</li><li>Bechard, A., Nicholson, A., Mason, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Litter+size+predicts+adult+stereotypic+behavior+in+female+laboratory+mice.">Litter size predicts adult stereotypic behavior in female laboratory mice.</a> J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).</li><li>Harvey, L., Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stereological+comparison+of+GAD67+and+reelin+expression+in+the+hippocampal+stratum+oriens+of+offspring+from+two+mouse+models+of+maternal+inflammation+during+pregnancy.">A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy.</a> Neuropharmacology. 62 (4), 1767-1776 (2012).</li></ol>

The authors have nothing to disclose.

MIA Induktion zu unterschiedlichen Zeitfenstern stört unterschiedliche Entwicklung des Gehirns Ereignisse bei Nagern und folglich führt zu unterschiedlichen Verhaltensstörungen und Neuropathologien bei den Nachkommen. Hier beschrieben wir ein Protokoll zu induzieren MIA in Mäusen, die mit Poly (I: C) Injektion an E12.5. Diese Methode der MIA Induktion führt zu Verhaltens, neurologische, immunologische und Magen - Darm - Anomalien im Zusammenhang mit Autismus und Schizophrenie bei den Nachkommen 8,10,11,16.</su...

Das Konzept der mütterlichen Immunaktivierung (MIA) stammt aus den epidemiologischen Studien über die Assoziation der Infektion der Mutter mit Autismus und Schizophrenie 1. Aufgrund des Fehlens von nachweisbarem replizierenden viralen Pathogenen in der Plazenta oder fetalen Gehirn nach mütterlichen Virusinfektion 2,3, wird die Wirkung der Infektion auf die Nachkommen Hypothese eher durch die Aktivierung des mütterlichen Immunsystem verursacht werden , als die Pathogene selbst . Polycytidylsäure: Um die Ursache-Wirkungs-Beziehung zwischen MIA und psychiatrischen Störungen, die Injektion von chemisch synthetisierten, viral mimic doppelsträngige RNA polyinosinic aufzuklären (poly (I: C)) in schwangeren Nagetieren wurde als Tiermodell für MIA weit verbreitet 4,5. Poly (I: C) von Toll-like-Rezeptor erkannt wird 3 (TLR3) und die systemische Verabreichung von Poly (I: C) induziert viral wie akute Entzündungsreaktion. Einer der Mechanismen, durch die poly (I: C) produces Verhaltensstörungen und Neuropathologien bei den Nachkommen wird durch ein Ungleichgewicht von pro- und anti - inflammatorischen Zytokinen in der mütterlichen Plazenta-fetalen Achse 6 verursacht. Mehrere Gruppen haben die MIA - Modell angenommen , die Ätiologie von psychiatrischen Störungen 7 und aufgrund der unterschiedlichen Interessen zwischen Forschungsgruppen, verschiedenen Zeitpunkten der Immunaktivierung verwendet worden , um zu verstehen , 7 verschiedene Störungen auf die Entwicklung des Gehirns und das Verhalten zu erreichen. Das Paul H. Patterson Labor am California Institute of Technology nimmt die Strategie der Injektion von Poly (I: C) in trächtigen Mäusen an embryonalen 12,5 Tage (E12,5), die erfolgreich unter Beweis gestellt hat, dass MIA induzieren Verhaltens-, neurologische fähig ist, und immunologische Veränderungen bei den Nachkommen , die mit Autismus und Schizophrenie 8-11 verbunden sind. Unser Stand der Arbeiten zeigen , dass MIA Nachwuchs Verhaltensauffälligkeiten zeigen (zB soziale impairment, Kommunikationsdefizit, repetitive Verhalten, Angst-ähnliches Verhalten und latente Hemmung Defizit 8,10,12), Immundysregulation und Zytokine Ungleichgewicht 8,13,14, Veränderung des fötalen Gehirns Genexpression 15, Verlust der Purkinje - Zellen in Läppchen VII von Cerebellum 11, Veränderung der synaptischen Eigenschaften in Hippocampus 9, Gen - Umwelt - Interaktion x 13, Veränderung der Darmdurchlässigkeit und Darmmikrobiota Zusammensetzung 16. Darüber hinaus werden therapeutische und prophylaktische Strategien auch von diesem Modellsystem 13,16,17 entwickelt. Durch die Induktion MIA bei E12,5, andere haben gezeigt , dass MIA fötalen Mikrogliaaktivierung und cholinergen Entwicklungs Veränderung in basalen Vorderhirns 18, Stamm spezifische Wechselwirkung 19, Gehirn zerebralen synaptosomaler ultra Anomalien, zerebrale mitochondrialen Atmungskette Überfunktion abnormalties, Herabregulation der zerebralen synaptischen Moleküle 17 erzeugt .depressiv-ähnliche Verhaltensweisen, Beeinträchtigung der Kognition und des Hippocampus Langzeit - Potenzierung (LTP), und das Defizit von Erwachsenen Neurogenese im Hippocampus 20. Hier bieten wir eine detaillierte Methode, wie MIA zu induzieren bei E12,5 von Poly (I: C), sowie Paradigmen, wie dieses Modell anzuwenden, um die Entstehung von Autismus und Schizophrenie zu studieren. Es ist wichtig zu beachten , dass MIA ein Risikofaktor für eine Vielzahl von Erkrankungen ist 4, und dessen Ergebnisse sind extrem empfindlich gegenüber der Zeit und Methode der Induktion sowie die Haltung der trächtigen Muttertieren. Als solche auch kleinere Unstimmigkeiten zwischen den Laboratorien führen oft zu geringe Reproduzierbarkeit und / oder unterschiedlichen Phänotypen bei den Nachkommen. Unsere Methode ist für die Interessenten an einem Studium MIA als Umweltrisikofaktor für Autismus und Schizophrenie speziell entwickelt, und die detaillierte Beschreibung wird es den Forschern zur Verfügung gestellt helfen, die Reproduzierbarkeit ihrer Daten zu verbessern.

<table border="0" cellpadding="0" cellspacing="0" width="711">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:283px;">Polyinosinic&#8211;polycytidylic acid potassium salt</td>
			<td style="width:129px;">SIGMA</td>
			<td style="width:167px;">P9582</td>
			<td style="width:133px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">0.9% sodium chloride INJ. USP</td>
			<td>HOSPIRA</td>
			<td>NDC 0409-4888-10</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MONOJECT insuline syrinage 3/10 mL 29G x 1/2&#34;</td>
			<td>COVIDIEN</td>
			<td>8881600145</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">50 ml conical screw cap tubes</td>
			<td>USA SCIENTIFIC</td>
			<td>1500-1211</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nanodrop 1000 spectrophotometer</td>
			<td>THERMO SCIENTIFIC</td>
			<td>1000</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Stereomicroscope</td>
			<td>Wild Heerbrugg</td>
			<td>M5A</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dumont #5 Forceps Inox Tip Size .10 X .06mm</td>
			<td>Roboz</td>
			<td>RS-5045</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNAlater RNA stabilization reagent</td>
			<td>Qiagen</td>
			<td>76104</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TRIzol reagent</td>
			<td>Life Technologies</td>
			<td>15596-026&#160;</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RQ1 Rnase-free DNase</td>
			<td>Promega</td>
			<td>M610A</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iScript cDNA synthesis kit</td>
			<td>Bio-Rad</td>
			<td>170-8891</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastStart universal SYBR green master mix with ROX&#160;</td>
			<td>Roche</td>
			<td>4913922001</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Real-time PCR</td>
			<td>ABI</td>
			<td>7300</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: Il6 forward</td>
			<td>Life Technologies</td>
			<td>TAGTCCTTCCTACCCCAATTTCC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: Il6 Reverse</td>
			<td>Life Technologies</td>
			<td>TTGGTCCTTAGCCACTCCTTC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: beta-actin forward</td>
			<td>Life Technologies</td>
			<td>AGAGGGAAATCGTGCGTGAC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: beta-actin Reverse</td>
			<td>Life Technologies</td>
			<td>CAATAGTGATGACCTGGCCGT</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MicroAmp optical 96-well reaction plate</td>
			<td>Life Technologies</td>
			<td>4306737</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MicroAmp optical adhesive film&#160;</td>
			<td>Life Technologies</td>
			<td>4311971</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EthoVision</td>
			<td>Noldus</td>
			<td>EthoVision</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SR-LAB apparatus (PPI)</td>
			<td>San Diego Instruments&#160;</td>
			<td>SR-LAB</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Marbles</td>
			<td>PENN-PLAX</td>
			<td>Blue gem stones marbles</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dulbecco&#39;s Phosphate-Buffered Saline (DPBS)</td>
			<td>Life Technologies</td>
			<td>21600-069</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Paraformaldehyde</td>
			<td>MACRON</td>
			<td>2621-59</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vibratome</td>
			<td>Leica</td>
			<td>VT1000 S</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium azide</td>
			<td>Sigma</td>
			<td>S2002</td>
			<td>Optionl</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Triton x-100</td>
			<td>Sigma</td>
			<td>X100</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hydrogen peroxide solution</td>
			<td>Sigma</td>
			<td>18312</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Goat serum</td>
			<td>Vector Laboratories</td>
			<td>S-1000</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rabbit anti-calbindin antibody</td>
			<td>Abcam</td>
			<td>ab11426</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Biotinlyated goat anti-rabbit IgGantibody</td>
			<td>Vector Laboratories</td>
			<td>BA-1000</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">VECTASTAIN ABC Kit</td>
			<td>Vector Laboratories</td>
			<td>PK-4000</td>
			<td>Optionl</td>
		</tr>
	</tbody>
</table>

induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

<html> Die Injektion von 20 mg / kg Poly (I: C) bei E12,5 konnte eine akute Entzündungsreaktion in der mütterlichen Plazenta-fetale Achse hervorrufen und eine chronische Wirkung auf die Entwicklung des Gehirns und Verhaltens - Phänotypen 12,13 auszufällen. Erhöhte Niveaus eines proinflammatorischen Cytokin, Interleukin (IL) -6, ist ein zuverlässiger Indikator einer akuten Entzündungsreaktion nach MIA. Die Spitzenzeit für IL6 Genexpression in der Plazenta und f?...

Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Die Induktion der mütterliche Immunaktivierung bei Mäusen in der Mitte der Schwangerschaft Bühne mit Viral Mimic Poly (I: C)

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

induction-maternal-immune-activation-mice-at-mid-gestation-stage-with

Research

JoVE Journal

Immunology and Infection

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

18.1K Aufrufe.  California Institute of Technology. Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Serie: Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Induction of Experimental Autoimmune Hypophysitis in SJL Mice

Autoimmune hypophysitis can be reproduced experimentally by the injection of pituitary proteins mixed with an adjuvant into susceptible mice1. Mouse models allow us to study how diseases unfold, often providing a good replica of the same processes occurring in humans. For some autoimmune diseases, like type 1A diabetes, there are models (the NOD mouse) that spontaneously develop a disease similar to the human counterpart. For many other autoimmune diseases, however, the model needs to be induced experimentally. A common approach in this regard is to inject the mouse with a dominant antigen derived from the organ being studied. For example, investigators interested in autoimmune thyroiditis inject mice with thyroglobulin2, and those interested in myasthenia gravis inject them with the acetylcholine receptor3. If the autoantigen for a particular autoimmune disease is not known, investigators inject a crude protein extract from the organ targeted by the autoimmune reaction. For autoimmune hypophysitis, the pathogenic autoantigen(s) remain to be identified4, and thus a crude pituitary protein preparation is used. In this video article we demonstrate how to induce experimental autoimmune hypophysitis in SJL mice.

This video shows how to induce autoimmune hypophysitis in SJL mice and how to assess its severity by histopathology.

Induktion der experimentellen autoimmunen Hypophysitis in SJL Mäuse

Autoimmune hypophysitis can be reproduced experimentally by the injection of pituitary proteins mixed with an adjuvant into susceptible mice1. Mouse ...

Forschung

Immunologie und Infektion

Seven Steps to Stellate Cells

Hepatic stellate cells are liver-resident cells of star-like morphology and are located in the space of Disse between liver sinusoidal endothelial cells and hepatocytes1,2. Stellate cells are derived from bone marrow precursors and store up to 80% of the total body vitamin A1, 2. Upon activation, stellate cells differentiate into myofibroblasts to produce extracellular matrix, thus contributing to liver fibrosis3. Based on their ability to contract, myofibroblastic stellate cells can regulate the vascular tone associated with portal hypertension4. Recently, we demonstrated that hepatic stellate cells are potent antigen presenting cells and can activate NKT cells as well as conventional T lymphocytes5. 

 Here we present a method for the efficient preparation of hepatic stellate cells from mouse liver. Due to their perisinusoidal localization, the isolation of hepatic stellate cells is a multi-step process. In order to render stellate cells accessible to isolation from the space of Disse, mouse livers are perfused in situ with the digestive enzymes Pronase E and Collagenase P. Following perfusion, the liver tissue is subjected to additional enzymatic treatment with Pronase E and Collagenase P in vitro. Subsequently, the method takes advantage of the massive amount of vitamin A-storing lipid droplets in hepatic stellate cells. This feature allows the separation of stellate cells from other hepatic cell types by centrifugation on an 8% Nycodenz gradient. The protocol described here yields a highly pure and homogenous population of stellate cells. Purity of preparations can be assessed by staining for the marker molecule glial fibrillary acidic protein (GFAP), prior to analysis by fluorescence microscopy or flow cytometry. Further, light microscopy reveals the unique appearance of star-shaped hepatic stellate cells that harbor high amounts of lipid droplets. 


 Taken together, we present a detailed protocol for the efficient isolation of hepatic stellate cells, including representative images of their morphological appearance and GFAP expression that help to define the stellate cell entity.

Here we describe a method for the isolation of hepatic stellate cells from mouse liver. For stellate cell purification, mouse livers are digested in situ and in vitro by pronase-collagenase treatment prior to density gradient centrifugation. This technique yields highly pure hepatic stellate cells.

Seven Steps to Cells Stellate

Hepatic stellate cells are liver-resident  cells of star-like morphology and are located in the space of Disse between  liver sinusoidal endothelial cells ...

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of Listeria, which results in systemic infection2. After injection, Listeria quickly disseminates to the spleen and liver due to uptake by CD8&alpha;+ dendritic cells and Kupffer cells3,4. Once phagocytosed, various bacterial proteins enable Listeria to escape the phagosome, survive within the cytosol, and infect neighboring cells5. During the first three days of infection, different innate immune cells (e.g. monocytes, neutrophils, NK cells, dendritic cells) mediate bactericidal mechanisms that minimize Listeria proliferation. CD8+ T cells are subsequently recruited and responsible for the eventual clearance of Listeria from the host, typically within 10 days of infection6.
Successful clearance of Listeria from infected mice depends on the appropriate onset of host immune responses6	. There is a broad range of sensitivities amongst inbred mouse strains7,8. Generally, mice with increased susceptibility to Listeria infection are less able to control bacterial proliferation, demonstrating increased bacterial load and/or delayed clearance compared to resistant mice. Genetic studies, including linkage analyses and knockout mouse strains, have identified various genes for which sequence variation affects host responses to Listeria infection6,8-14. Determination and comparison of infection kinetics between different mouse strains is therefore an important method for identifying host genetic factors that contribute to immune responses against Listeria. Comparison of host responses to different Listeria strains is also an effective way to identify bacterial virulence factors that may serve as potential targets for antibiotic therapy or vaccine design.
We describe here a straightforward method for measuring bacterial load (colony forming units [CFU] per tissue) and preparing single-cell suspensions of the liver and spleen for FACS analysis of immune responses in Listeria-infected mice. This method is particularly useful for initial characterization of Listeria infection in novel mouse strains, as well as comparison of immune responses between different mouse strains infected with Listeria. We use the Listeria monocytogenes EGD strain15 that, when cultured on blood agar, exhibits a characteristic halo zone around each colony due to &beta;-hemolysis1 (Figure 1). Bacterial load and immune responses can be determined at any time-point after infection by culturing tissue homogenate on blood agar plates and preparing tissue cell suspensions for FACS analysis using the protocols described below. We would note that individuals who are immunocompromised or pregnant should not handle Listeria, and the relevant institutional biosafety committee and animal facility management should be consulted before work commences.

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Listeria monocytogenes is a model organism for studying immune responses and genetic susceptibility to intracellular bacteria in mice. This method enables one to measure bacterial load and generate single-cell suspensions of the liver and spleen from mice for FACS analysis to determine changes in immune cells due to Listeria infection.

Mess-bakterielle Belastung und Immunreaktionen in Mäuse Infizierte mit Listeria monocytogenes</em

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of ...

Right Ventricular Systolic Pressure Measurements in Combination with Harvest of Lung and Immune Tissue Samples in Mice

The function of the right heart is to pump blood through the lungs, thus linking right heart physiology and pulmonary vascular physiology. Inflammation is a common modifier of heart and lung function, by elaborating cellular infiltration, production of cytokines and growth factors, and by initiating remodeling processes 1.
Compared to the left ventricle, the right ventricle is a low-pressure pump that operates in a relatively narrow zone of pressure changes. Increased pulmonary artery pressures are associated with increased pressure in the lung vascular bed and pulmonary hypertension 2. Pulmonary hypertension is often associated with inflammatory lung diseases, for example chronic obstructive pulmonary disease, or autoimmune diseases 3. Because pulmonary hypertension confers a bad prognosis for quality of life and life expectancy, much research is directed towards understanding the mechanisms that might be targets for pharmaceutical intervention 4. The main challenge for the development of effective management tools for pulmonary hypertension remains the complexity of the simultaneous understanding of molecular and cellular changes in the right heart, the lungs and the immune system.
Here, we present a procedural workflow for the rapid and precise measurement of pressure changes in the right heart of mice and the simultaneous harvest of samples from heart, lungs and immune tissues. The method is based on the direct catheterization of the right ventricle via the jugular vein in close-chested mice, first developed in the late 1990s as surrogate measure of pressures in the pulmonary artery5-13. The organized team-approach facilitates a very rapid right heart catheterization technique. This makes it possible to perform the measurements in mice that spontaneously breathe room air. The organization of the work-flow in distinct work-areas reduces time delay and opens the possibility to simultaneously perform physiology experiments and harvest immune, heart and lung tissues.
The procedural workflow outlined here can be adapted for a wide variety of laboratory settings and study designs, from small, targeted experiments, to large drug screening assays. The simultaneous acquisition of cardiac physiology data that can be expanded to include echocardiography5,14-17 and harvest of heart, lung and immune tissues reduces the number of animals needed to obtain data that move the scientific knowledge basis forward. The procedural workflow presented here also provides an ideal basis for gaining knowledge of the networks that link immune, lung and heart function. The same principles outlined here can be adapted to study other or additional organs as needed.

A specific and rapid protocol to simultaneously investigate right heart function, lung inflammation, and the immune response is described as a learning tool. Video and figures describe physiology and microdissection techniques in an organized team-approach that is adaptable to be used for small to large sized studies.

Rechtsventrikulären systolischen Druck Messungen in Kombination mit Harvest of Lung and Immune Gewebeproben in Mäuse

The function of the right heart is to pump blood through the lungs, thus linking right heart physiology and pulmonary vascular physiology. Inflammation is ...

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. Conversely, viruses have evolved intricate strategies to evade and exploit host immune signaling for survival and propagation. Viral immune evasion, entailing host defense and viral evasion, provides one of the most fascinating and dynamic interfaces to discern the host-virus interaction. These studies advance our understanding in innate immune regulation and pave our way to develop novel antiviral therapies.
Murine &#947;HV68 is a natural pathogen of murine rodents. &#947;HV68 infection of mice provides a tractable small animal model to examine the antiviral response to human KSHV and EBV of which perturbation of in vivo virus-host interactions is not applicable. Here we describe a protocol to determine the antiviral cytokine production. This protocol can be adapted to other viruses and signaling pathways.
Recently, we have discovered that &#947;HV68 hijacks MAVS and IKK&#946;, key innate immune signaling components downstream of the cytosolic RIG-I and MDA5, to abrogate NF&#922;B activation and antiviral cytokine production. Specifically, &#947;HV68 infection activates IKK&#946; and that activated IKK&#946; phosphorylates RelA to accelerate RelA degradation. As such, &#947;HV68 efficiently uncouples NF&#922;B activation from its upstream activated IKK&#946;, negating antiviral cytokine gene expression. This study elucidates an intricate strategy whereby the upstream innate immune activation is intercepted by a viral pathogen to nullify the immediate downstream transcriptional activation and evade antiviral cytokine production.

We describe a protocol to measure the antiviral cytokine production in mice infected with a model herpesvirus, murine gamma herpesvirus 68 (&#947;HV68) that is closely-related to human Kaposi&#8217;s sarcoma-associated herpesvirus (KSHV) and Epstein-Barr virus (EBV). Utilizing genetically modified mouse strains and mouse embryonic fibroblasts (MEFs), we assessed the antiviral cytokine production both in vivo and ex vivo. &#8220;Reconstituting&#8221; the expression of innate immune components in knockout embryonic fibroblasts by lentiviral transduction, we further pinpoint specific innate immune molecules and dissect the key signaling events that differentially regulate the antiviral cytokine production.

Zergliedern Angeborene Immunsystem Signaling in Viral Evasion von Zytokin-Produktion

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages and disadvantages. We describe here an experimental colitis model that is initiated by adoptive transfer of syngeneic splenic CD4+CD45RBhigh T cells into T and B cell deficient recipient mice. The CD4+CD45RBhigh T cell population that largely consists of na&#239;ve effector cells is capable of inducing chronic intestinal inflammation, closely resembling key aspects of human IBD. This method can be manipulated to study aspects of disease onset and progression. Additionally it can be used to study the function of innate, adaptive, and regulatory immune cell populations, and the role of environmental exposures, i.e., the microbiota, in intestinal inflammation. In this article we illustrate the methodology for inducing colitis with a step-by-step protocol. This includes a video demonstration of key technical aspects required to successfully develop this murine model of experimental colitis for research purposes.

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Here, we present a protocol to induce colonic inflammation in mice by adoptive transfer of syngeneic CD4+CD45RBhigh T cells into T and B cell deficient recipients. Clinical and histopathological features mimic human inflammatory bowel diseases. This method allows the study of the initiation of colonic inflammation and progression of disease.

Die Induktion von Murine Darmentzündungen durch adoptiven Transfer von Effektor CD4<sup&gt; +</sup&gt; CD45RB<sup&gt; Hoch</sup&gt; T-Zellen in immundefizienten Mäusen

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages ...

Isolation of Leukocytes from the Murine Tissues at the Maternal-Fetal Interface

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing fetus. This tolerance is initiated during coitus, established during fecundation and implantation, and maintained throughout pregnancy. Active cellular and molecular mediators of maternal-fetal tolerance are enriched at the site of contact between fetal and maternal tissues, known as the maternal-fetal interface, which includes the placenta and the uterine and decidual tissues. This interface is comprised of stromal cells and infiltrating leukocytes, and their abundance and phenotypic characteristics change over the course of pregnancy. Infiltrating leukocytes at the maternal-fetal interface include neutrophils, macrophages, dendritic cells, mast cells, T cells, B cells, NK cells, and NKT cells that together create the local micro-environment that sustains pregnancy. An imbalance among these cells or any inappropriate alteration in their phenotypes is considered a mechanism of disease in pregnancy. Therefore, the study of leukocytes that infiltrate the maternal-fetal interface is essential in order to elucidate the immune mechanisms that lead to pregnancy-related complications. Described herein is a protocol that uses a combination of gentle mechanical dissociation followed by a robust enzymatic disaggregation with a proteolytic and collagenolytic enzymatic cocktail to isolate the infiltrating leukocytes from the murine tissues at the maternal-fetal interface. This protocol allows for the isolation of high numbers of viable leukocytes (&#62;70%) with sufficiently conserved antigenic and functional properties. Isolated leukocytes can then be analyzed by several techniques, including immunophenotyping, cell sorting, imaging, immunoblotting, mRNA expression, cell culture, and in vitro functional assays such as mixed leukocyte reactions, proliferation, or cytotoxicity assays.

Described herein is a protocol to isolate and analyze the infiltrating leukocytes of tissues at the maternal-fetal interface (uterus, decidua, and placenta) of mice. This protocol maintains the integrity of most cell surface markers and yields enough viable cells for downstream applications including flow cytometry analysis.

Isolierung von Leukozyten aus dem Mausgeweben an der Maternal-Fetal-Schnittstelle

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing ...

Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) resulting in cognitive and motor impairment. Experimental autoimmune encephalomyelitis (EAE) is a useful animal model of MS, because it is also characterized by lesion formation in the CNS, motor impairment and is also driven by autoimmune and inflammatory reactions. One of the EAE models is induced with a peptide derived from the myelin oligodendrocyte protein (MOG)35-55 in mice. The EAE mice develop a progressive disease course. This course is divided into three phases: the preclinical phase (day 0 - 9), the disease onset (day 10 - 11) and the acute phase (day 12 - 14). MS and EAE are induced by autoreactive T cells that infiltrate the CNS. These T cells secrete chemokines and cytokines which lead to the recruitment of further immune cells. Therefore, the immune cell distribution in the spinal cord during the three disease phases was investigated. To highlight the time point of the disease at which the activation/proliferation/accumulation of T cells, B cells and monocytes starts, the immune cell distribution in lymph nodes, spleen and blood was also assessed. Furthermore, the levels of several cytokines (IL-1&#946;, IL-6, IL-23, TNF&#945;, IFN&#947;) in the three disease phases were determined, to gain insight into the inflammatory processes of the disease. In conclusion, the data provide an overview of the functional profile of immune cells during EAE pathology.

This manuscript describes the methods for induction and scoring of the experimental autoimmune encephalomyelitis (EAE) model, together with the assessment of immune cell distribution and mRNA cytokine levels in lymph nodes, spleen, blood and spinal cord using flow cytometry and quantitative PCR, respectively, at various disease phases.

Die Induktion der experimentellen autoimmunen Enzephalomyelitis bei Mäusen und die Auswertung des Krankheitsabhängige Verteilung von Immunzellen in verschiedenen Geweben

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) ...

Human Placental and Decidual Organ Cultures to Study Infections at the Maternal-fetal Interface

The placenta shows a large degree of interspecies anatomic variability. To best understand biology and pathophysiology of the human placenta, it is imperative to design experiments using human cells and tissues. An advantage of organ culture is maintenance of three-dimensional (3D) structural organization and extracellular matrix. The goal of the method described here is successful establishment of ex vivo human gestational tissue organ cultures and their healthy culture maintenance for 72-96 hr. The protocol details the immediate processing of research-consented, placental and decidual specimens fresh from the operating suite. These are abundant specimens that would otherwise be discarded. Detailed instructions on the sterile collection of these samples, including morphologic details on how to select appropriate tissues to establish 3D organ cultures, is provided. Placental villous and decidual tissues are microdissected into 2-3 mm3 pieces and placed separately on matrix-lined transwell filters and cultured for several days. Villous and decidual organ cultures are well suited for the study of human host-pathogen interaction. As compared to other model organisms, these human cultures are particularly advantageous to examine mechanism of infection for pathogens that demonstrate variable patterns of host specificity. As an example, we demonstrate infection of placental and decidual organ cultures with the clinically relevant, facultative intracellular bacterial pathogen Listeria monocytogenes.

A simple method to establish primary human placental (villous) and decidual organ cultures is described. Villous and decidual organ cultures are invaluable tools for studying pathogenesis at the human maternal-fetal interface. Infection with the facultative intracellular bacterium Listeria monocytogenes is demonstrated.

Menschliche Plazenta und Deziduale Organkulturen Infektionen zu studieren an der Maternal-fetale Schnittstelle

The placenta shows a large degree of interspecies anatomic variability. To best understand biology and pathophysiology of the human placenta, it is ...

Determining Immune System Suppression versus CNS Protection for Pharmacological Interventions in Autoimmune Demyelination

A major hallmark of the autoimmune demyelinating disease multiple sclerosis (MS) is immune cell infiltration into the brain and spinal cord resulting in myelin destruction, which not only slows conduction of nerve impulses, but causes axonal injury resulting in motor and cognitive decline. Current treatments for MS focus on attenuating immune cell infiltration into the central nervous system (CNS). These treatments decrease the number of relapses, improving quality of life, but do not completely eliminate relapses so long-term disability is not improved. Therefore, therapeutic agents that protect the CNS are warranted. In both animal models as well as human patients with MS, T cell entry into the CNS is generally considered the initiating inflammatory event. In order to assess if a drug protects the CNS, any potential effects on immune cell infiltration or proliferation in the periphery must be ruled out. This protocol describes how to determine whether CNS protection observed after drug intervention is a consequence of attenuating CNS-infiltrating immune cells or blocking death of CNS cells during inflammatory insults. The ability to examine MS treatments that are protective to the CNS during inflammatory insults is highly critical for the advancement of therapeutic strategies since current treatments reduce, but do not completely eliminate, relapses (i.e., immune cell infiltration), leaving the CNS vulnerable to degeneration.

This protocol describes how to determine whether pharmacological treatments for experimental autoimmune encephalomyelitis show CNS protection as a consequence of suppressing immune cell infiltration or are neuroprotective during the onslaught of immune cell infiltration.

Die Bestimmung Unterdrückung des Immunsystems gegen ZNS-Schutz für pharmakologische Interventionen im Bereich der Autoimmun- Demyelinisierung

A major hallmark of the autoimmune demyelinating disease multiple sclerosis (MS) is immune cell infiltration into the brain and spinal cord resulting in ...