We would like to honor the late Dr. Paul H. Patterson for his contributions to the progress of MIA model, autism, and schizophrenia research. We acknowledge Sarkis K. Mazmanian for his great support on this protocol; Ruben M. Bayon, Yvette Garcia-Flores, Karen C. Lencioni, and Leslie A. Neumann for administrative assistance; Ali Khoshnan and Jan C. Ko for the assistance on filming; Elaine Y. Hsiao and Natalia Malkova for their advice on MIA induction; Jeffrey S. Cochrane, Joaquin Gutierrez, Kwan F. Lee, Jaime Rodriguez, Lorena C. Sandoval, and Natalie A. Verduzco for their expert animal husbandry. This work was supported by the NIH Conte Center Award (NIH 5P50MH086383-04, to Paul H. Patterson); Autism Speaks (#7670, to Paul H. Patterson); Simons Foundation (#322839, to Sarkis K. Mazmanian); NIH Training Grant (NIH/NRSA T32GM07616 to K.-H.C.); Caltech Summer Undergraduate Research Fellowship (SURF) (to Z.Y.); Amgen Scholars Program at Caltech (to Z.Y.); and Postdoctoral Fellowship from National Science Council, Taiwan (NSC 101-2917-I-564-039, to W.-L.W.).

All protocols were performed under the approval of the California Institute of Technology Institutional Animal Care and Use Committee (IACUC).
1. Preparation for Timed-mating Pairs
<ol>
	<li>Use at least 6 dams for behavioral experiments and 3 for gene expression analysis. 
	NOTE: Use double the number of estimated female mice, as only about 50% of the mice will be plugged from the timed-mating.</li>
	<li>Use female mice with no prior pregnancy and at 8-16 weeks of age. 
	NOTE: Fem...

<ol>
	<li>Brown, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiologic+studies+of+exposure+to+prenatal+infection+and+risk+of+schizophrenia+and+autism.">Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism.</a> Dev Neurobiol. 72 (10), 1272-1276 (2012).</li><li>Fatemi, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+viral+theory+of+schizophrenia+revisited:+abnormal+placental+gene+expression+and+structural+changes+with+lack+of+evidence+for+H1N1+viral+presence+in+placentae+of+infected+mice+or+brains+of+exposed+offspring.">The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring.</a> Neuropharmacology. 62 (3), 1290-1298 (2012).</li><li>Shi, L., Tu, N., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+influenza+infection+is+likely+to+alter+fetal+brain+development+indirectly:+the+virus+is+not+detected+in+the+fetus.">Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus.</a> Int J Dev Neurosci. 23 (2-3), 299-305 (2005).</li><li>Knuesel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+abnormal+brain+development+across+CNS+disorders.">Maternal immune activation and abnormal brain development across CNS disorders.</a> Nat Rev Neurol. 10 (11), 643-660 (2014).</li><li>Meyer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+poly(i:C)+exposure+and+other+developmental+immune+activation+models+in+rodent+systems.">Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems.</a> Biol Psychiatry. 75 (4), 307-315 (2014).</li><li>Meyer, U., Feldon, J., Yee, B. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+the+fetal+brain+cytokine+imbalance+hypothesis+of+schizophrenia.">A review of the fetal brain cytokine imbalance hypothesis of schizophrenia.</a> Schizophr Bull. 35 (5), 959-972 (2009).</li><li>Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+prenatal+infection+on+brain+development+and+behavior:+a+review+of+findings+from+animal+models.">Effects of prenatal infection on brain development and behavior: a review of findings from animal models.</a> Brain Behav Immun. 24 (6), 881-897 (2010).</li><li>Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+an+autism+risk+factor+in+mice+leads+to+permanent+immune+dysregulation.">Modeling an autism risk factor in mice leads to permanent immune dysregulation.</a> Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).</li><li>Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+nonspatial+information+processing+in+the+hippocampus+of+the+adult+offspring.">Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring.</a> Brain Behav Immun. 24 (6), 930-941 (2010).</li><li>Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+fetal+brain+development+through+interleukin-6.">Maternal immune activation alters fetal brain development through interleukin-6.</a> J Neurosci. 27 (40), 10695-10702 (2007).</li><li>Shi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+alters+cerebellar+development+in+the+offspring.">Activation of the maternal immune system alters cerebellar development in the offspring.</a> Brain Behav Immun. 23 (1), 116-123 (2009).</li><li>Hsiao, E. Y., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+induces+endocrine+changes+in+the+placenta+via+IL-6.">Activation of the maternal immune system induces endocrine changes in the placenta via IL-6.</a> Brain Behav Immun. 25 (4), 604-615 (2011).</li><li>Wu, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+interaction+between+maternal+immune+activation+and+alpha+7+nicotinic+acetylcholine+receptor+in+regulating+behaviors+in+the+offspring.">The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring.</a> Brain Behav Immun. , (2015).</li><li>Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+causes+age-+and+region-specific+changes+in+brain+cytokines+in+offspring+throughout+development.">Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development.</a> Brain Behav Immun. 31, 54-68 (2013).</li><li>Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+maternal+immune+activation+on+gene+expression+patterns+in+the+fetal+brain.">Effects of maternal immune activation on gene expression patterns in the fetal brain.</a> Transl Psychiatry. 2, e98 (2012).</li><li>Hsiao, E. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbiota+modulate+behavioral+and+physiological+abnormalities+associated+with+neurodevelopmental+disorders.">Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders.</a> Cell. 155 (7), 1451-1463 (2013).</li><li>Naviaux, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antipurinergic+therapy+corrects+the+autism-like+features+in+the+poly(IC)+mouse+model.">Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model.</a> PLoS One. 8 (3), e57380 (2013).</li><li>Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+inflammation+promotes+fetal+microglial+activation+and+increased+cholinergic+expression+in+the+fetal+basal+forebrain:+role+of+interleukin-6.">Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6.</a> Pediatr Res. 74 (4), 393-401 (2013).</li><li>Schwartzer, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+strain+specific+interactions+in+the+development+of+autism-like+behaviors+in+mice.">Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice.</a> Transl Psychiatry. 3, e240 (2013).</li><li>Khan, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+effects+of+maternal+immune+activation+on+depression-like+behavior+in+the+mouse.">Long-term effects of maternal immune activation on depression-like behavior in the mouse.</a> Transl Psychiatry. 4, e363 (2014).</li><li>Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+transformations+of+neurodevelopmental+sequences+across+mammalian+species.">Modeling transformations of neurodevelopmental sequences across mammalian species.</a> J Neurosci. 33 (17), 7368-7383 (2013).</li><li>Abazyan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+interaction+of+mutant+DISC1+and+immune+activation+produces+adult+psychopathology.">Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology.</a> Biol Psychiatry. 68 (12), 1172-1181 (2010).</li><li>Meyer, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adult+behavioral+and+pharmacological+dysfunctions+following+disruption+of+the+fetal+brain+balance+between+pro-inflammatory+and+IL-10-mediated+anti-inflammatory+signaling.">Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling.</a> Mol Psychiatry. 13 (2), 208-221 (2008).</li><li>Vuillermot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+immune+activation+interacts+with+genetic+Nurr1+deficiency+in+the+development+of+attentional+impairments.">Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments.</a> J Neurosci. 32 (2), 436-451 (2012).</li><li>Bechard, A., Nicholson, A., Mason, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Litter+size+predicts+adult+stereotypic+behavior+in+female+laboratory+mice.">Litter size predicts adult stereotypic behavior in female laboratory mice.</a> J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).</li><li>Harvey, L., Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stereological+comparison+of+GAD67+and+reelin+expression+in+the+hippocampal+stratum+oriens+of+offspring+from+two+mouse+models+of+maternal+inflammation+during+pregnancy.">A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy.</a> Neuropharmacology. 62 (4), 1767-1776 (2012).</li></ol>

The authors have nothing to disclose.

MIA induction at different time windows perturbs different brain development events in rodents, and consequently leads to different behavioral abnormalities and neuropathologies in the offspring. Here, we described a protocol to induce MIA in mice with poly(I:C) injection at E12.5. This method of MIA induction leads to behavioral, neurological, immunological, and gastrointestinal abnormalities associated with autism and schizophrenia in the offspring8,10,11,16. It is important to note that, because MIA is an e...

The concept of maternal immune activation (MIA) originates from the epidemiology studies on the association of maternal infection with autism and schizophrenia1. Due to the absence of detectable replicating viral pathogens in the placenta or the fetal brain after maternal viral infection2,3, the effect of the infection on the offspring is hypothesized to be caused by the activation of the maternal immune system rather than the pathogens themselves.
To elucidate the cause-and-effect relationship between MIA and psychiatric disorders, injection of chemically synthesized, viral mimic double stranded RNA polyinosinic:polycytidylic acid (poly(I:C)) into pregnant rodents has been widely used as the animal model for MIA4,5. Poly(I:C) is recognized by toll-like receptor 3 (TLR3), and systemic administration of poly(I:C) induces viral-like acute inflammatory response. One of the mechanisms by which poly(I:C) produces behavioral abnormalities and neuropathologies in the offspring is by causing an imbalance of pro- and anti- inflammatory cytokines in the maternal-placental-fetal axis6. Several groups have adopted the MIA model to understand the etiology of psychiatric disorders7, and due to the diverse interests among research groups, various time points of immune activation have been used to achieve different perturbations on brain development and behaviors7.
The Paul H. Patterson laboratory at the California Institute of Technology adopts the strategy of injecting poly(I:C) into pregnant mice at embryonic 12.5 days (E12.5), which has successfully demonstrated that MIA is capable of inducing behavioral, neurological, and immunological changes in the offspring that are associated with autism and schizophrenia8-11. Our prior works show that MIA offspring display behavioral abnormalities (e.g.,&#160;social impairment, communication deficit, repetitive behavior, anxiety-like behavior, and latent inhibition deficit8,10,12), immune dysregulation and cytokines imbalance8,13,14, alteration of fetal brain gene expression15, loss of Purkinje cell in lobule VII of cerebellum11, alteration of synaptic properties in hippocampus9, gene x environment interaction13, alteration of gut permeability, and gut microbiota composition16. Furthermore, therapeutic and prophylactic strategies are also developed from this model system13,16,17. By inducing MIA at E12.5, others have shown that MIA produces fetal microglial activation and cholinergic developmental alteration in basal forebrain18, strain specific interaction19, brain cerebral synaptosomal ultrastructural abnormalities, cerebral mitochondrial respiratory chain hyperfunction abnormalties, downregulation of cerebral synaptosomal molecules17, depressive-like behaviors, impairment in cognition and hippocampal long-term potentiation (LTP), and deficit of adult hippocampal neurogenesis20.
Here, we provide a detailed method of how to induce MIA at E12.5 by poly(I:C), as well as paradigms of how to apply this model to study the etiology of autism and schizophrenia. It is important to note that MIA is a risk factor for a variety of disorders4, and its outcomes are extremely sensitive to the time and method of induction as well as the husbandry of the pregnant dams. As such, even minor inconsistencies between laboratories often result in low reproducibility and/or different phenotypes in the offspring. Our method is specifically designed for those interested in studying MIA as an environmental risk factor for autism and schizophrenia, and the detailed description provided will help researchers improve the reproducibility of their data.

<table border="0" cellpadding="0" cellspacing="0" width="711">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:283px;">Polyinosinic&#8211;polycytidylic acid potassium salt</td>
			<td style="width:129px;">SIGMA</td>
			<td style="width:167px;">P9582</td>
			<td style="width:133px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">0.9% sodium chloride INJ. USP</td>
			<td>HOSPIRA</td>
			<td>NDC 0409-4888-10</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MONOJECT insuline syrinage 3/10 mL 29G x 1/2&#34;</td>
			<td>COVIDIEN</td>
			<td>8881600145</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">50 ml conical screw cap tubes</td>
			<td>USA SCIENTIFIC</td>
			<td>1500-1211</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nanodrop 1000 spectrophotometer</td>
			<td>THERMO SCIENTIFIC</td>
			<td>1000</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Stereomicroscope</td>
			<td>Wild Heerbrugg</td>
			<td>M5A</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dumont #5 Forceps Inox Tip Size .10 X .06mm</td>
			<td>Roboz</td>
			<td>RS-5045</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNAlater RNA stabilization reagent</td>
			<td>Qiagen</td>
			<td>76104</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TRIzol reagent</td>
			<td>Life Technologies</td>
			<td>15596-026&#160;</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RQ1 Rnase-free DNase</td>
			<td>Promega</td>
			<td>M610A</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iScript cDNA synthesis kit</td>
			<td>Bio-Rad</td>
			<td>170-8891</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastStart universal SYBR green master mix with ROX&#160;</td>
			<td>Roche</td>
			<td>4913922001</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Real-time PCR</td>
			<td>ABI</td>
			<td>7300</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: Il6 forward</td>
			<td>Life Technologies</td>
			<td>TAGTCCTTCCTACCCCAATTTCC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: Il6 Reverse</td>
			<td>Life Technologies</td>
			<td>TTGGTCCTTAGCCACTCCTTC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: beta-actin forward</td>
			<td>Life Technologies</td>
			<td>AGAGGGAAATCGTGCGTGAC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: beta-actin Reverse</td>
			<td>Life Technologies</td>
			<td>CAATAGTGATGACCTGGCCGT</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MicroAmp optical 96-well reaction plate</td>
			<td>Life Technologies</td>
			<td>4306737</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MicroAmp optical adhesive film&#160;</td>
			<td>Life Technologies</td>
			<td>4311971</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EthoVision</td>
			<td>Noldus</td>
			<td>EthoVision</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SR-LAB apparatus (PPI)</td>
			<td>San Diego Instruments&#160;</td>
			<td>SR-LAB</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Marbles</td>
			<td>PENN-PLAX</td>
			<td>Blue gem stones marbles</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dulbecco&#39;s Phosphate-Buffered Saline (DPBS)</td>
			<td>Life Technologies</td>
			<td>21600-069</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Paraformaldehyde</td>
			<td>MACRON</td>
			<td>2621-59</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vibratome</td>
			<td>Leica</td>
			<td>VT1000 S</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium azide</td>
			<td>Sigma</td>
			<td>S2002</td>
			<td>Optionl</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Triton x-100</td>
			<td>Sigma</td>
			<td>X100</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hydrogen peroxide solution</td>
			<td>Sigma</td>
			<td>18312</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Goat serum</td>
			<td>Vector Laboratories</td>
			<td>S-1000</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rabbit anti-calbindin antibody</td>
			<td>Abcam</td>
			<td>ab11426</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Biotinlyated goat anti-rabbit IgGantibody</td>
			<td>Vector Laboratories</td>
			<td>BA-1000</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">VECTASTAIN ABC Kit</td>
			<td>Vector Laboratories</td>
			<td>PK-4000</td>
			<td>Optionl</td>
		</tr>
	</tbody>
</table>

induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

Injection of 20 mg/kg poly(I:C) at E12.5 could evoke an acute inflammatory response in the maternal-placental-fetal axis and precipitate a chronic effect to brain development and behavioral phenotypes12,13. Elevated levels of a proinflammatory cytokine, Interleukin (IL)-6, is a reliable indicator of acute inflammatory response after MIA. The peak time for Il6 gene expression in the placenta and fetal brain is at 3 hr post-poly(I:C) injection12,13. We have sh...

Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

The overall goal of this procedure is to induce maternal immune activation, or MIA, in mice by intraperitoneal injection of the viral mimic poly at the mid-gestational embryonic stage. This method can help us answer key questions in a neuro-immunology field, such as, how immune dysfunction can lead to perturbations in brain development and behavior. The main advantage of this technique is that it's specifically designed for researchers interested in studying MIA as an environmental risk factor for autism and schizophrenia.Generally, individuals new to this method will struggle, because small differences in the MIA induction method can significantly alter the downstream response in the offspring. To set up a timed mating pair, begin by housing five female mice per cage next to each other in standard mouse cages to synchronize their estra cycles, and use an ear punch to label each animal. Zero to two hours before the dark cycle begins, house the female mice two to a cage, and weigh and record the body weight of each individual mouse, then add one male mouse per cage of two female mice.Zero to four hours after the dark cycle ends, gently lift each female mouse by the base of the tail, allowing the animal to grip the cage grid with the forepaws, to determine the existence of a whitish mass in the vaginal opening. If a plug is not apparent, gently insert a 200 microliter pipette tip into the vaginal opening. Resistance from coagulation confirms the formation of a plug.Group the plugged mice into a new cage, as the presence of a vaginal plug confirms only that copulation has occurred. On embryonic days 10.5 to 11.5, lift each plugged female mouse by the base of the tail, and look for a bulge in the abdomen, then weigh the mice to verify the pregnancy, and house the pregnant animals in individual clean cages. Weigh the poly(I:C)powder in a 50 milliliter conical.On embryonic day 12.5, add the appropriate volume of 0.9%sodium chloride to the corresponding volume of poly(I:C)in a conical tube, and close the cap. Gently roll the saline droplet over the powder until the solution is clear. then centrifuge the tube, and transfer the poly(I:C)solution to a microcentrifuge tube.Use a spectrophotometer to measure the 260 to 280 ratio of the poly(I:C)solution. The ratio should be between 1.54 and 1.82, as described by the manufacturer. Next, weigh the first mouse and load a 0.3 milliliter insulin syringe with the corresponding calculated volume of poly(I:C)solution.Then, picking the mouse up by the tail, place it on the cage top, and secure it by the scruff. Now insert the needle, bevel side up, into the center of the two upper nipples at approximately 20 degrees relative to the mouse, and administer the poly(I:C)solution. Then place the mouse back into the cage.After all of the mice have been injected, house the cages in a quiet, low-traffic room to avoid other confounding effects, and weigh the mice the next morning. At least three days before the behavioral testing, change the cage bedding of the eight to 12 week old adult maternal immune activation or MIA offspring. 30 minutes before the test, acclimate the mice to the testing room.For a pre-pulse inhibition test, restrain the mice in plexiglass cylinders on top of a piezoelectric sensor. Acclimate the mouse to the pre-pulse inhibition chamber for five minutes, with six trials of 120 decibels of white noise. Then expose the mice to randomized mixtures of sound, as outlined in the table, and compare the results to the baseline startle response, to determine the pre-pulse inhibition of the MIA animals.For an open field test, place a mouse in the corner of an open square arena, with a defined 17 by 17 centimeter center zone, and record the trajectory of the mouse for 10 minutes, through a ceiling-mounted camera. Then quantify the center zone entries, and the time spent in the center zone. For a marble burying test, acclimate a mouse to a test cage, with compressed five centimeter deep, clean aspen pine bedding for 10 minutes, then place the mouse back in the home cage, and gently arrange 20 navy blue 1.5 centimeter diameter glass marbles in a four by five grid in the test cage.Now return the mouse to the test cage for 10 minutes, then place the animal back in the home cage, and count the number of marbles that were buried during the test period. Poly(I:C)injection at embryonic day 12.5 can evoke an acute inflammatory response in the maternal placental fetal axis, and precipitate a chronic effect on brain development and behavioral phenotypes. Indeed, poly(I:C)induces a higher Il6 gene expression in the maternal spleen, placenta, and fetal brain, three hours post-injection.Generally, when compared to saline-treated adult offspring, MIA adult offspring exhibit fewer center zone entries, and a shorter center zone duration in the open field test. The poly(I:C)injected animals also display more frequent burying behaviors in the marble burying test, and a lower pre-pulse inhibition. The loss of Purkinje cells in the cerebellum lobule seven is another hallmark of MIA offspring, with fewer calbindin positive Purkinje cells observed in the cerebellum lobule seven of these animals, compared to saline injected controls.While attempting this procedure, it's important to remember not to disturb the pregnant mice after MIA induction. Afterward, additional factors such as postnatal stress or infection can be induced to study additional environment environment interactions.

induction-maternal-immune-activation-mice-at-mid-gestation-stage-with

Research

JoVE Journal

Immunology and Infection

17.8K ビュー.  California Institute of Technology. The overall goal of this procedure is to induce maternal immune activation, or MIA, in mice by intraperitoneal injection of the viral mimic poly at the mid-gestational embryonic stage. This method can help us answer key questions in a neuro-immunology field, such as, how immune dysfunction can lead to perturbations in brain development and behavior. The main advantage of this technique is that it's specifically designed for researchers interested in studying MIA as an environmental risk facto...