Nós gostaríamos de homenagear o falecido Dr. Paul H. Patterson por suas contribuições para o progresso do modelo MIA, autismo e pesquisa da esquizofrenia. Nós reconhecemos Sarkis K. Mazmanian por seu grande apoio a este protocolo; Ruben M. Bayon, Yvette Garcia-Flores, Karen C. Lencioni, e Leslie A. Neumann de assistência administrativa; Ali Khoshnan e Jan C. Ko para a assistência sobre as filmagens; Elaine Y. Hsiao e Natalia Malkova para os seus conselhos na indução MIA; Jeffrey S. Cochrane, Joaquin Gutierrez, Kwan F. Lee, Jaime Rodriguez, Lorena C. Sandoval, e Natalie A. Verduzco para a sua criação de animais especialista. Este trabalho foi financiado pelo NIH Award Conte Center (NIH 5P50MH086383-04, de Paul H. Patterson); Autism Speaks (# 7670, a Paul H. Patterson); Fundação Simons (# 322839, com Sarkis K. Mazmanian); NIH Training Grant (NIH / NRSA T32GM07616 de K.-HC); Caltech Verão Graduação Research Fellowship (SURF) (para ZY); Amgen Scholars Programa no Caltech (para ZY); e pós-doutorado frConselho om National Science, Taiwan (NSC 101-2917-I-564-039, para W.-LW).

Todos os protocolos foram realizados sob a aprovação do California Institute of Comité Cuidados e Uso de Animais Institucional Tecnologia (IACUC). 1. Preparação para Pairs cronometrado-acasalamento <ol><li> Use pelo menos 6 barragens para experimentos comportamentais e 3 para análise da expressão gênica. NOTA: Use o dobro do número de ratos fêmeas estimados, já que apenas cerca de 50% dos ratos será conectado a partir da cronometrado-acasalamento. </li><li> Use ratos fêmea com nenhum gravidez antes e, 8-16 semanas de idade. NOTA: os ratos fêmeas que tenham exposição sexual antes de camundongos machos, mas não foram grávida são aceitáveis. </li><li> Casa a ratos fêmea juntos e colocar as gaiolas ao lado do outro, a fim de sincronizar o ciclo estral. Use uma gaiola de ratos padrão com uma altura de mais de 5,5 polegadas e um piso interior 75 polegada quadrada para permitir habitação de 5 ratos adultos. Etiquetar cada rato fêmea utilizando um soco orelha. </li></ol> 2. Configurando cronometrado-mating Pair <ol><li> Configure o cronometrado-acasalamento 0-2 horas antes do ciclo escuro começa. Coloque dois ratos fêmeas em cada gaiola. Retire os ratos e pesá-los individualmente. Registe o peso do corpo de cada ratinho fêmea. </li><li> Coloque um rato macho em cada gaiola com as duas fêmeas de camundongo. Use trio de acoplamento para minimizar o efeito paterno confundindo. </li></ol> 3. Vaginal bujão de verificação (E0.5) <ol><li> Verifique a fêmea ratos 0-4 horas após o ciclo escuro termina. Levante cuidadosamente o rato fêmea da base da cauda e permitir que o mouse para pegar a grade de arame, gaiola superior, ou a borda gaiola. </li><li> Procurar sinais de plugue vaginal: plugue vaginal é uma massa esbranquiçada visível na abertura vaginal. Se a ficha não é óbvio, insira suavemente uma ponteira 200 mL na abertura vaginal. Resistência de coagulação confirma formação de um tampão vaginal. Verifique o plugue vaginal uma vez por dia. NOTA: plugue Vaginal é apenas uma indicação de que a cópula ocorreu e, portanto, não ggravidez ARANTIA. rolhão vaginal podem ser difíceis de identificar, em determinadas estirpes de murganhos. Procure a ajuda de um cuidador ratos experiente para aumentar a precisão da identificação plugue. </li><li> Mova os ratos ligados a uma nova gaiola e grupo abrigá-los. Definir o dia da aparição plugue vaginal como embrionária 0,5 dia (E0.5). </li></ol> 4. Na E10.5-11.5, verificar se a gravidez <ol><li> Levante cuidadosamente a base da cauda e permitir que o mouse para pegar a grade de arame, gaiola superior, ou a borda gaiola. Observe a área do abdômen para verificar se há sinais de gravidez, por exemplo, uma protuberância no abdômen (Figura 1). NOTA: O sinal de gravidez é sempre mais óbvio à E11.5 do que em E10.5. </li><li> Pesar os ratinhos para verificar a gravidez. O ratinho grávida geralmente pesa cerca de 20% mais pesados ​​em E10.5 e 30% mais pesados ​​em E12.5 em comparação com um ratinho não grávidas (Figura 2). Única casa os ratos grávidas em gaiolas limpas. </li></ol> 5. 20 mg /kg de poli (I: C) Preparação <ol><li> Use pelo menos 6 barragens por grupo para experimentos comportamentais e 3 por grupo para análise de expressão de genes. Prepara-se o valor correspondente de poli (I: C). </li><li> Pesa-se o poli (I: C) de pó num tubo de 50 ml para fazer uma concentração final de 40 mg / ml. A fim de minimizar e padronizar o stress causado pelo volume de injecção, injectar 5 ul de poli (I: C) por cada grama de peso corporal do rato (5 mL / g, ou 5 ml / kg). Para induzir a MIA, que injectar 20 mg de poli (I: C) por kg. NOTA: A concentração de poli (I: C) é necessária (20 mg / kg) / (5 ml / kg) = 4 mg / ml. Uma vez que a poli (I: C) em pó contém 10% de poli (I: C), é necessário fazer uma concentração final de ml de poli (4 mg / ml) /0.1= 40 mg / (I: C). CUIDADO: O poli (I: C) em pó é muito leve. Tenha cuidado para não perder qualquer pó durante a transferência da espátula para o tubo cônico. </li><li> Adicionar o volume correspondente de cloreto de sódio a 0,9% (solução salina) para a banheira cónicae e fechar a tampa. Dissolve-se o pó por laminagem suavemente a gota de solução salina através da poli (I: C) de pó até a solução ficar clara. Centrifuga-se o tubo cónico a 800 xg durante 1 min (Figura 3C). Filtra-se o poli: solução por filtro de 0,22? M (I C). Transferir o poli: solução (I C) para um tubo de 1,5 ou 2 ml de microcentrífuga. Opcional: Use um espectrofotómetro para medir a razão entre o poli (I: C) 260/280 solução. Assegurar o rácio situa-se entre 1,54-1,82 (Figura 3) tal como descrito pelo fabricante. NOTA: A solução salina utilizada para dissolver o poli (I: C) em pó e servem como controlo de injecção deve ser de grau farmacêutico e estéril. </li></ol> 6. Saline ou poli (I: C) Injeção em E12.5 <ol><li> Pesar o rato na escala e colocá-lo de volta para a jaula. Utilize a seguinte fórmula para calcular o volume de injecção tanto para solução salina e poli (I: C) ratos: o peso corporal (g) multiplicados por 5 = volume de injecção desejado (ul). Use um insul 0,3 mlem seringa para elaborar o volume calculado de solução salina ou 20 mg / kg de poli (I: C), por exemplo, 150 mL de um rato 30 g. </li><li> Gentilmente pegar o mouse pela base da cauda e colocá-lo no topo da gaiola. Lidar com o mouse com cuidado para evitar efeitos de confusão induzida por stress. Inserir a agulha, bisel para cima, a aproximadamente 20 ° em relação ao rato para o centro dos seus dois bocais superiores (Figura 4), ​​e injectar o (I: C) solução salina ou solução de poli. NOTA: A agulha deve ser substituída para cada rato após a injeção. </li><li> Posicione o mouse de volta para sua gaiola. Coloque as gaiolas numa zona calma, de baixo sala de tráfego para evitar outros efeitos de confusão. </li></ol> 7. O Dia Depois de poli (I: C) Injeção (E13.5) <ol><li> Verificar os ratinhos injectados na manhã seguinte. Use uma escala para medir o peso corporal. NOTA: poli (I: C) injectados murganhos grávidas geralmente ganhar menos peso do que os murganhos injectados solução salina no dia após a injexão. </li><li> Não perturbe os ratos até que a prole nascem. </li></ol> 8. Medidor de MIA Offspring <ol><li> A fim de minimizar os efeitos de indução de MIA, siga as diretrizes listadas abaixo para medir o uso de MIA prole. <ol><li> Excluir as ninhadas de prematuro ou nascimento atrasado, ou se o tamanho da leitegada é menor do que 5. </li><li> Euthanize os filhotes excessivas de CO 2, se o tamanho da ninhada é maior do que 10. </li></ol></li></ol> 9. Opcional: Examine a resposta inflamatória aguda Após MIA <ol><li> Sacrificar a grávida ratos 3 horas após soro fisiológico ou poli (I: C) injecção utilizando o método descrito no protocolo aprovado-comité cuidados com os animais da instituição. NOTA: Deslocação cervical é muitas vezes preferido, uma vez que minimiza o efeito de CO drogas 2 / eutanásia sobre a barragem e do embrião. </li><li> Recolher o baço dos camundongos grávidas adultos e isolar a placenta e bra fetalno sob o microscópio estereoscópico. <ol><li> Para a coleta de baço, coloque o mouse sobre a placa de dissecação e pulverizar 70% de etanol na região abdominal dos ratos grávidas. Utilizar um par de tesouras estéreis para fazer um corte vertical, no centro da área abdominal abaixo da caixa torácica através da pele. </li><li> O baço fica no quadrante abdominal superior, esquerda. Use uma pinça para isolar o baço. Rolar o baço em limpadores tarefa delicada para remover o tecido adiposo em torno do órgão. Recolher cerca de 50 mg de tecido do baço e colocá-los individualmente em tubos de Eppendorf com 500 RNA ul estabilizar tampão ou TRIzol para evitar a degradação do ácido nucleico. Armazenar as amostras a -80 ° C até à sua utilização congelador. </li><li> Para a coleta de placenta, retire com cuidado os cornos uterinos do corpo. Coloque as trompas uterinas num prato de Petri cheio com solução salina tamponada com fosfato autoclavado (PBS) e deixar o prato em gelo. Use duas pinças para rasgar a parede uterina e expor o saco amniótico. <ol><li>Cuidadosamente usar a pinça para abrir o saco amniótico, sem danificar a placenta e o feto. Separa-se a placenta do feto e cortar o cordão umbilical tão perto quanto possível da placenta. Remover o saco amniótico detritos a partir da placenta. Coloque a placenta individualmente em tubos de Eppendorf com 500 ul de ARN estabilizar tampão ou Trizol. Armazenar a amostra a -80 ° C até à sua utilização congelador. </li></ol></li><li> Para a coleta de cérebro fetal, armazenar o feto no RNA estabilizar tampão do passo 9.2.2 até dissecção. Amole fora da membrana pial do ventrículo do cérebro utilizando fórceps delicados # 5 sob o microscópio estereoscópico. Remova cuidadosamente toda a membrana do cérebro fetal. Coloque os cérebros fetais individualmente em tubos de Eppendorf com 500 RNA ul estabilizar tampão ou TRIzol. Armazenar a amostra a -80 ° C até à sua utilização congelador. </li></ol></li><li> Extrai-se a ARN a partir do tecido e converter o ARN em ADNc. Analisar a expressão de genes IL6 no cDNA por real-time PCR. </li><li> Extrai-se a ARN dos tecidos, seguindo o protocolo de fabrico de TRIzol. Se os tecidos são armazenados no buffer de estabilização de ARN. Descongelar a amostra e girar o buffer. Transferir o tecido por ponta para outro eppendorf com 500 mL de TRIzol e continuar a extracção de ARN. </li><li> Utilizar um espectrofotómetro para determinar a concentração de, 260/280 e 260/230 razão do ARN. Certifique-se os índices são acima de 2,0. </li><li> Eliminar a contaminação de ADN do ARN por tratamento com ADNase I. mistura de 1 ug de ARN, 1 ul de tampão de reacção 10X, 1 ul de DNase isenta de RNase, e água isenta de nuclease para um volume final de 10 ul. Incubar a mistura principal a 37 ° C durante 30 min. Adicione 1 solução DNase parada ul para terminar a reacção. Incubar a mistura a 65 ° C durante 10 min. </li><li> Reverter transcrever o RNA para cDNA. Usar 20 reacções ul, e até 1 ug de ARN total por reacção. Misture 4 l de 5x tampão de transcrição reversa (RT) mistura de reacção, 1 ul reverse transcriptase, 11 ul de molde de ARN após tratamento com ADNase I e 4 ul livre de nuclease H2O para fazer uma solução final de 20 ul. Programar as condições termociclador para RT. Uma condição genérica incluem: Passo 1: 25 ° C durante 5 min; Passo 2: 42 ° C durante 30 min; Passo 3: 85 ° C durante 5 min; Passo 4: manter a 4 ° C. Dilui-se o ADNc de 5 vezes. Para armazenagem a curto prazo, armazenar o ADNc a 4 ° C. Para armazenamento a longo prazo, congelar o cDNA a -20 ° C. </li><li> Analisar a expressão do gene IL6 no cDNA por PCR em tempo real e normalizar a expressão do gene IL-6 para a p-actina a expressão do gene. <ol><li> Faça uma mistura mestre para IL6 e detecção de β-actina. Usar 25 ul de reacção, a mistura principal para cada gene inclui 12,5 uL da mistura de SYBR Verde, 0,5 ul de 10 mM iniciador directo, 0,5 ul de 10 pM e iniciador inverso 6,5 ul livre de nuclease H 2 O. </li><li> Coloque 5 jul 5x diluída cDNA umt o fundo do poço da placa de reacção óptica de 96 poços. Pipetar 20 ul de mistura principal para cada poço, para fazer uma de 25 uL finais mistura de PCR. Triplicado, cada gene para cada amostra. Selar a placa usando película adesiva óptica. Girar a placa a 800 xg durante 3 min a 4 ° C, utilizar o programa standard de PCR em tempo real: Passo 1: 50 ° C durante 2 min; Passo 2: 95 ° C durante 10 min; Passo 3: 40 ciclos de 95 ° C durante 15 segundos e a temperatura de 60 ° C durante 1 min. Adicionar uma etapa adicional para a curva de dissociação. </li></ol></li></ol> 10. Examine as anormalidades comportamentais em Offspring MIA Adulto (opcional): <ol><li> Execute os testes de comportamento nas idades de 8-12 semanas. Mudar a cama gaiola de pelo menos 3 dias antes do teste. Aclimatar os ratos ao ambiente de teste comportamental, pelo menos, 30 min antes do teste. </li><li> Para a inibição pré-pulso (PPI), restringir os ratos no cilindro de plexiglass com um sensor piezo-elétrico debaixo dela. Aclimatar os ratos ao PPIcâmara por 5 min. Expor os ratos com 6 ensaios de 120 dB de ruído branco (sobressalto). </li><li> Em seguida, expor os ratos com misturas randomizados de 14 ensaios de ruído de fundo, 14 ensaios de sobressalto, 14 ensaios de pré-pulso 5 dB (5 dB maior do que o ruído de fundo) + Startle (PPI5), e 14 ensaios de pré-pulso de 15 dB (15 dB mais elevados do que o ruído de fundo + Startle (PPI15). </li><li> Em média, a resposta de sobressalto para os primeiros 6 ensaios de 120 ensaios dB. Em média, a resposta de sobressalto para os outros estímulos individuais. Converter o valor para a inibição pré-pulso por (Startle - PPI5 ou PPI15) / Startle. </li><li> Para o teste de campo aberto, coloque o mouse no canto de uma arena praça aberta (50 x 50 x 50 cm 3). Grave a trajetória do rato durante 10 min através de uma câmera montada no teto. Definir o centro de como a zona central (17 x 17 cm2) na arena. Quantificar a distância percorrida, entradas de fuso centro, eo tempo passado na zona centro manualmente ou por software de análise automática baseada em imagem. </li&gt; <li> Para o teste de enterramento mármore, aclimatar o mouse para uma gaiola de teste com cinco centímetros de profundidade comprimido, roupas de cama de pinho, limpo Aspen para 10 min. Devolver o mouse para a sua homecage. Delicadamente, coloque 20 azul marinho 1,5 cm de diâmetro bolinhas de vidro na forma de 4 x 5 arranjo. Coloque o mouse de volta para a jaula de teste com berlindes para 10 min. Conte os mármores que tem sido enterrados no período de testes de 10 min. </li></ol> 11. Examine a neuropatologia cerebelar em Offspring MIA Adulto (opcional): <ol><li> Eutanásia do salina e MIA filhos adultos pelo anestésico. Perfundir o rato com 50 ml de PBS e, subsequentemente, 50 ml de 4% de paraformaldeído através do sistema cardiovascular. </li><li> Remover cuidadosamente o cérebro e pós- fixarem o cérebro em paraformaldeído a 4% durante a noite a 4 ° C. Lavar o cérebro com PBS três vezes, e armazenar o cérebro em PBS com 0,02% de azida de sódio num frigorífico a 4 ° C até à sua utilização. NOTA: O cérebro fixadas posteriormente pode ser armazenado em PBS com 0,02% de SODazida ium na geladeira por até um mês. </li><li> Seção do cérebro em 50 mm fatias finas sagital utilizando vibratome. Recolher as seções do cérebro usando um pincel macio. Terminar a actividade da peroxidase endógena por incubação das secções em peróxido de hidrogénio a 0,6% durante 30 min à temperatura ambiente. </li><li> Incubam-se as secções em anticorpo anti-calbindina diluído no tampão de bloqueio (soro de cabra a 10% com 0,1% de Triton X-100 e 0,02% de azida de sódio em PBS) durante a noite à temperatura ambiente. Em seguida, incubar as secções na correspondente anticorpo secundário biotinilado diluído em tampão de bloqueio durante 2 horas à temperatura ambiente. </li><li> Incubam-se as secções em DH avidina - peroxidase de tampão H complexo biotinilado para detectar a biotina, durante 1 h à temperatura ambiente. Desenvolver as secções utilizando o substrato de peroxidase para visualizar o antigénio. Lavam-se as secções com PBS três vezes entre os passos. Montar as secções em lâminas de microscópio. Imagem as seções sob o microscópio. </li></ol&gt;

<ol>
	<li>Brown, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiologic+studies+of+exposure+to+prenatal+infection+and+risk+of+schizophrenia+and+autism.">Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism.</a> Dev Neurobiol. 72 (10), 1272-1276 (2012).</li><li>Fatemi, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+viral+theory+of+schizophrenia+revisited:+abnormal+placental+gene+expression+and+structural+changes+with+lack+of+evidence+for+H1N1+viral+presence+in+placentae+of+infected+mice+or+brains+of+exposed+offspring.">The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring.</a> Neuropharmacology. 62 (3), 1290-1298 (2012).</li><li>Shi, L., Tu, N., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+influenza+infection+is+likely+to+alter+fetal+brain+development+indirectly:+the+virus+is+not+detected+in+the+fetus.">Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus.</a> Int J Dev Neurosci. 23 (2-3), 299-305 (2005).</li><li>Knuesel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+abnormal+brain+development+across+CNS+disorders.">Maternal immune activation and abnormal brain development across CNS disorders.</a> Nat Rev Neurol. 10 (11), 643-660 (2014).</li><li>Meyer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+poly(i:C)+exposure+and+other+developmental+immune+activation+models+in+rodent+systems.">Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems.</a> Biol Psychiatry. 75 (4), 307-315 (2014).</li><li>Meyer, U., Feldon, J., Yee, B. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+the+fetal+brain+cytokine+imbalance+hypothesis+of+schizophrenia.">A review of the fetal brain cytokine imbalance hypothesis of schizophrenia.</a> Schizophr Bull. 35 (5), 959-972 (2009).</li><li>Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+prenatal+infection+on+brain+development+and+behavior:+a+review+of+findings+from+animal+models.">Effects of prenatal infection on brain development and behavior: a review of findings from animal models.</a> Brain Behav Immun. 24 (6), 881-897 (2010).</li><li>Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+an+autism+risk+factor+in+mice+leads+to+permanent+immune+dysregulation.">Modeling an autism risk factor in mice leads to permanent immune dysregulation.</a> Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).</li><li>Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+nonspatial+information+processing+in+the+hippocampus+of+the+adult+offspring.">Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring.</a> Brain Behav Immun. 24 (6), 930-941 (2010).</li><li>Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+fetal+brain+development+through+interleukin-6.">Maternal immune activation alters fetal brain development through interleukin-6.</a> J Neurosci. 27 (40), 10695-10702 (2007).</li><li>Shi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+alters+cerebellar+development+in+the+offspring.">Activation of the maternal immune system alters cerebellar development in the offspring.</a> Brain Behav Immun. 23 (1), 116-123 (2009).</li><li>Hsiao, E. Y., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+induces+endocrine+changes+in+the+placenta+via+IL-6.">Activation of the maternal immune system induces endocrine changes in the placenta via IL-6.</a> Brain Behav Immun. 25 (4), 604-615 (2011).</li><li>Wu, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+interaction+between+maternal+immune+activation+and+alpha+7+nicotinic+acetylcholine+receptor+in+regulating+behaviors+in+the+offspring.">The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring.</a> Brain Behav Immun. , (2015).</li><li>Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+causes+age-+and+region-specific+changes+in+brain+cytokines+in+offspring+throughout+development.">Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development.</a> Brain Behav Immun. 31, 54-68 (2013).</li><li>Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+maternal+immune+activation+on+gene+expression+patterns+in+the+fetal+brain.">Effects of maternal immune activation on gene expression patterns in the fetal brain.</a> Transl Psychiatry. 2, e98 (2012).</li><li>Hsiao, E. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbiota+modulate+behavioral+and+physiological+abnormalities+associated+with+neurodevelopmental+disorders.">Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders.</a> Cell. 155 (7), 1451-1463 (2013).</li><li>Naviaux, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antipurinergic+therapy+corrects+the+autism-like+features+in+the+poly(IC)+mouse+model.">Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model.</a> PLoS One. 8 (3), e57380 (2013).</li><li>Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+inflammation+promotes+fetal+microglial+activation+and+increased+cholinergic+expression+in+the+fetal+basal+forebrain:+role+of+interleukin-6.">Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6.</a> Pediatr Res. 74 (4), 393-401 (2013).</li><li>Schwartzer, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+strain+specific+interactions+in+the+development+of+autism-like+behaviors+in+mice.">Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice.</a> Transl Psychiatry. 3, e240 (2013).</li><li>Khan, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+effects+of+maternal+immune+activation+on+depression-like+behavior+in+the+mouse.">Long-term effects of maternal immune activation on depression-like behavior in the mouse.</a> Transl Psychiatry. 4, e363 (2014).</li><li>Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+transformations+of+neurodevelopmental+sequences+across+mammalian+species.">Modeling transformations of neurodevelopmental sequences across mammalian species.</a> J Neurosci. 33 (17), 7368-7383 (2013).</li><li>Abazyan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+interaction+of+mutant+DISC1+and+immune+activation+produces+adult+psychopathology.">Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology.</a> Biol Psychiatry. 68 (12), 1172-1181 (2010).</li><li>Meyer, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adult+behavioral+and+pharmacological+dysfunctions+following+disruption+of+the+fetal+brain+balance+between+pro-inflammatory+and+IL-10-mediated+anti-inflammatory+signaling.">Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling.</a> Mol Psychiatry. 13 (2), 208-221 (2008).</li><li>Vuillermot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+immune+activation+interacts+with+genetic+Nurr1+deficiency+in+the+development+of+attentional+impairments.">Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments.</a> J Neurosci. 32 (2), 436-451 (2012).</li><li>Bechard, A., Nicholson, A., Mason, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Litter+size+predicts+adult+stereotypic+behavior+in+female+laboratory+mice.">Litter size predicts adult stereotypic behavior in female laboratory mice.</a> J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).</li><li>Harvey, L., Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stereological+comparison+of+GAD67+and+reelin+expression+in+the+hippocampal+stratum+oriens+of+offspring+from+two+mouse+models+of+maternal+inflammation+during+pregnancy.">A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy.</a> Neuropharmacology. 62 (4), 1767-1776 (2012).</li></ol>

The authors have nothing to disclose.

indução MIA em diferentes janelas de tempo perturba diferentes eventos de desenvolvimento cerebral em roedores e, consequentemente, leva a anomalias comportamentais diferentes e neuropatologias na prole. Aqui, descrevemos um protocolo para induzir MIA em camundongos com poli (I: C) injecção a E12.5. Este método de indução MIA leva a comportamental, neurológica, imunológico, e anomalias gastrointestinais associados com o autismo e esquizofrenia na prole 8,10,11,16. É importante notar que, porque MIA ...

O conceito de ativação imune materna (MIA) tem origem nos estudos epidemiológicos sobre a associação da infecção materna com autismo e esquizofrenia 1. Devido à ausência de agentes patogénicos virais detectáveis ​​se replicar na placenta ou do cérebro fetal após a infecção viral materna 2,3, o efeito da infecção sobre a descendência é a hipótese de ser causadas pela activação do sistema imune materno, em vez do que os próprios agentes patogénicos . Para elucidar a relação de causa e efeito entre MIA e distúrbios psiquiátricos, injecção de quimicamente sintetizados, viral mímico dupla polyinosinic ARN de cadeia: ácido polycytidylic (poli (I: C)) em roedores grávida tem sido amplamente utilizado como modelo animal para a MIA 4,5. Poli (I: C) é reconhecida pelo receptor? Toll-like 3 (TLR3), e a administração sistémica de poli (I: C) induz-viral como a resposta inflamatória aguda. Um dos mecanismos pelos quais a poli (I: C) PRoduces anomalias comportamentais e neuropatologias na prole é por causando um desequilíbrio de citocinas pró-inflamatórias e anti no eixo materno-placentária-fetal 6. Vários grupos adotaram o modelo MIA para compreender a etiologia dos transtornos psiquiátricos 7, e devido aos diversos interesses entre grupos de pesquisa, vários pontos de tempo de ativação imune têm sido utilizados para alcançar diferentes perturbações no desenvolvimento do cérebro e comportamentos 7. O laboratório Paul H. Patterson no Califórnia Institute of Technology adota a estratégia de injecção de poli (I: C) em murganhos grávidas no dia embrionário 12,5 (E12.5), que demonstrou com sucesso que a MIA é capaz de induzir comportamental, neurológica, e alterações imunológicas na descendência que estão associados com a esquizofrenia e autismo 8-11. Nossas obras anteriores mostram que MIA prole apresentar anomalias comportamentais (por exemplo, impairmen sociaist, défice de comunicação, comportamentos repetitivos, comportamento de ansiedade-like, e latente déficit de inibição 8,10,12), imune desregulação e citocinas desequilíbrio 8,13,14, alteração da expressão do gene do cérebro fetal 15, perda de células de Purkinje no lóbulo VII do cerebelo 11, alteração de propriedades sinápticas no hipocampo 9, gene x interação ambiente 13, alteração da permeabilidade do intestino e intestino composição da microbiota 16. Além disso, as estratégias terapêuticas e profiláticas são também desenvolvido a partir deste sistema modelo 13,16,17. Ao induzir MIA em E12.5, outros mostraram que MIA produz ativação fetal microglial e alteração de desenvolvimento colinérgicos no cérebro anterior basal 18, cepa específica de interacção 19, anormalidades ultra-estruturais do cérebro sinaptossomais cerebral, mitocondriais respiratórias anormalidades cadeia hiperfunção, o downregulation das moléculas sinaptossomais cerebrais 17 ,comportamentos de tipo depressivo, déficit cognitivo e do hipocampo potenciação de longa duração (LTP) e déficit de neurogênese adulta 20. Aqui, nós fornecemos um método detalhado de como induzir MIA em E12.5 por poli (I: C), bem como os paradigmas de como aplicar este modelo para estudar a etiologia da esquizofrenia e autismo. É importante notar que a MIA é um factor de risco para uma variedade de distúrbios 4, e os seus resultados são extremamente sensíveis ao tempo e método de indução, bem como a criação de barragens grávidas. Como tal, mesmo pequenas inconsistências entre laboratórios muitas vezes resultam em baixa reprodutibilidade e / ou diferentes fenótipos na descendência. Nosso método é projetado especificamente para os interessados ​​em estudar MIA como um fator de risco ambiental para o autismo e esquizofrenia, e a descrição detalhada fornecida irá ajudar os pesquisadores a melhorar a reprodutibilidade dos seus dados.

<table border="0" cellpadding="0" cellspacing="0" width="711">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:283px;">Polyinosinic&#8211;polycytidylic acid potassium salt</td>
			<td style="width:129px;">SIGMA</td>
			<td style="width:167px;">P9582</td>
			<td style="width:133px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">0.9% sodium chloride INJ. USP</td>
			<td>HOSPIRA</td>
			<td>NDC 0409-4888-10</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MONOJECT insuline syrinage 3/10 mL 29G x 1/2&#34;</td>
			<td>COVIDIEN</td>
			<td>8881600145</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">50 ml conical screw cap tubes</td>
			<td>USA SCIENTIFIC</td>
			<td>1500-1211</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nanodrop 1000 spectrophotometer</td>
			<td>THERMO SCIENTIFIC</td>
			<td>1000</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Stereomicroscope</td>
			<td>Wild Heerbrugg</td>
			<td>M5A</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dumont #5 Forceps Inox Tip Size .10 X .06mm</td>
			<td>Roboz</td>
			<td>RS-5045</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNAlater RNA stabilization reagent</td>
			<td>Qiagen</td>
			<td>76104</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TRIzol reagent</td>
			<td>Life Technologies</td>
			<td>15596-026&#160;</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RQ1 Rnase-free DNase</td>
			<td>Promega</td>
			<td>M610A</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iScript cDNA synthesis kit</td>
			<td>Bio-Rad</td>
			<td>170-8891</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastStart universal SYBR green master mix with ROX&#160;</td>
			<td>Roche</td>
			<td>4913922001</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Real-time PCR</td>
			<td>ABI</td>
			<td>7300</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: Il6 forward</td>
			<td>Life Technologies</td>
			<td>TAGTCCTTCCTACCCCAATTTCC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: Il6 Reverse</td>
			<td>Life Technologies</td>
			<td>TTGGTCCTTAGCCACTCCTTC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: beta-actin forward</td>
			<td>Life Technologies</td>
			<td>AGAGGGAAATCGTGCGTGAC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: beta-actin Reverse</td>
			<td>Life Technologies</td>
			<td>CAATAGTGATGACCTGGCCGT</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MicroAmp optical 96-well reaction plate</td>
			<td>Life Technologies</td>
			<td>4306737</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MicroAmp optical adhesive film&#160;</td>
			<td>Life Technologies</td>
			<td>4311971</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EthoVision</td>
			<td>Noldus</td>
			<td>EthoVision</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SR-LAB apparatus (PPI)</td>
			<td>San Diego Instruments&#160;</td>
			<td>SR-LAB</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Marbles</td>
			<td>PENN-PLAX</td>
			<td>Blue gem stones marbles</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dulbecco&#39;s Phosphate-Buffered Saline (DPBS)</td>
			<td>Life Technologies</td>
			<td>21600-069</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Paraformaldehyde</td>
			<td>MACRON</td>
			<td>2621-59</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vibratome</td>
			<td>Leica</td>
			<td>VT1000 S</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium azide</td>
			<td>Sigma</td>
			<td>S2002</td>
			<td>Optionl</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Triton x-100</td>
			<td>Sigma</td>
			<td>X100</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hydrogen peroxide solution</td>
			<td>Sigma</td>
			<td>18312</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Goat serum</td>
			<td>Vector Laboratories</td>
			<td>S-1000</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rabbit anti-calbindin antibody</td>
			<td>Abcam</td>
			<td>ab11426</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Biotinlyated goat anti-rabbit IgGantibody</td>
			<td>Vector Laboratories</td>
			<td>BA-1000</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">VECTASTAIN ABC Kit</td>
			<td>Vector Laboratories</td>
			<td>PK-4000</td>
			<td>Optionl</td>
		</tr>
	</tbody>
</table>

induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

<html> A injecção de 20 mg / kg de poli (I: C) em E12.5 pode evocar uma resposta inflamatória aguda no eixo materno-fetal e placentário-precipitar um efeito crónico para o desenvolvimento do cérebro e fenótipos comportamentais 12,13. Os níveis elevados de uma citocina pró-inflamatória, interleucina (IL) -6, é um indicador fiável da resposta inflamatória aguda após MIA. O tempo de pico para a expressão do gene IL6 na placenta e no cérebro fetal é de 3 h...

Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Indução de Maternal Immune Activation em Ratos na Fase Mid-gestação com Viral Mimic poli (I: C)

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

induction-maternal-immune-activation-mice-at-mid-gestation-stage-with

Research

JoVE Journal

Immunology and Infection

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

18.1K visualizações.  California Institute of Technology. Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Vídeo: Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Induction of Experimental Autoimmune Hypophysitis in SJL Mice

Autoimmune hypophysitis can be reproduced experimentally by the injection of pituitary proteins mixed with an adjuvant into susceptible mice1. Mouse models allow us to study how diseases unfold, often providing a good replica of the same processes occurring in humans. For some autoimmune diseases, like type 1A diabetes, there are models (the NOD mouse) that spontaneously develop a disease similar to the human counterpart. For many other autoimmune diseases, however, the model needs to be induced experimentally. A common approach in this regard is to inject the mouse with a dominant antigen derived from the organ being studied. For example, investigators interested in autoimmune thyroiditis inject mice with thyroglobulin2, and those interested in myasthenia gravis inject them with the acetylcholine receptor3. If the autoantigen for a particular autoimmune disease is not known, investigators inject a crude protein extract from the organ targeted by the autoimmune reaction. For autoimmune hypophysitis, the pathogenic autoantigen(s) remain to be identified4, and thus a crude pituitary protein preparation is used. In this video article we demonstrate how to induce experimental autoimmune hypophysitis in SJL mice.

This video shows how to induce autoimmune hypophysitis in SJL mice and how to assess its severity by histopathology.

Indução de hipofisite Auto-Imune Experimental em Ratos SJL

Autoimmune hypophysitis can be reproduced experimentally by the injection of pituitary proteins mixed with an adjuvant into susceptible mice1. Mouse ...

Imunologia e Infecção

Seven Steps to Stellate Cells

Hepatic stellate cells are liver-resident cells of star-like morphology and are located in the space of Disse between liver sinusoidal endothelial cells and hepatocytes1,2. Stellate cells are derived from bone marrow precursors and store up to 80% of the total body vitamin A1, 2. Upon activation, stellate cells differentiate into myofibroblasts to produce extracellular matrix, thus contributing to liver fibrosis3. Based on their ability to contract, myofibroblastic stellate cells can regulate the vascular tone associated with portal hypertension4. Recently, we demonstrated that hepatic stellate cells are potent antigen presenting cells and can activate NKT cells as well as conventional T lymphocytes5. 

 Here we present a method for the efficient preparation of hepatic stellate cells from mouse liver. Due to their perisinusoidal localization, the isolation of hepatic stellate cells is a multi-step process. In order to render stellate cells accessible to isolation from the space of Disse, mouse livers are perfused in situ with the digestive enzymes Pronase E and Collagenase P. Following perfusion, the liver tissue is subjected to additional enzymatic treatment with Pronase E and Collagenase P in vitro. Subsequently, the method takes advantage of the massive amount of vitamin A-storing lipid droplets in hepatic stellate cells. This feature allows the separation of stellate cells from other hepatic cell types by centrifugation on an 8% Nycodenz gradient. The protocol described here yields a highly pure and homogenous population of stellate cells. Purity of preparations can be assessed by staining for the marker molecule glial fibrillary acidic protein (GFAP), prior to analysis by fluorescence microscopy or flow cytometry. Further, light microscopy reveals the unique appearance of star-shaped hepatic stellate cells that harbor high amounts of lipid droplets. 


 Taken together, we present a detailed protocol for the efficient isolation of hepatic stellate cells, including representative images of their morphological appearance and GFAP expression that help to define the stellate cell entity.

Here we describe a method for the isolation of hepatic stellate cells from mouse liver. For stellate cell purification, mouse livers are digested in situ and in vitro by pronase-collagenase treatment prior to density gradient centrifugation. This technique yields highly pure hepatic stellate cells.

Sete Passos para Stellate Células

Hepatic stellate cells are liver-resident  cells of star-like morphology and are located in the space of Disse between  liver sinusoidal endothelial cells ...

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of Listeria, which results in systemic infection2. After injection, Listeria quickly disseminates to the spleen and liver due to uptake by CD8&alpha;+ dendritic cells and Kupffer cells3,4. Once phagocytosed, various bacterial proteins enable Listeria to escape the phagosome, survive within the cytosol, and infect neighboring cells5. During the first three days of infection, different innate immune cells (e.g. monocytes, neutrophils, NK cells, dendritic cells) mediate bactericidal mechanisms that minimize Listeria proliferation. CD8+ T cells are subsequently recruited and responsible for the eventual clearance of Listeria from the host, typically within 10 days of infection6.
Successful clearance of Listeria from infected mice depends on the appropriate onset of host immune responses6	. There is a broad range of sensitivities amongst inbred mouse strains7,8. Generally, mice with increased susceptibility to Listeria infection are less able to control bacterial proliferation, demonstrating increased bacterial load and/or delayed clearance compared to resistant mice. Genetic studies, including linkage analyses and knockout mouse strains, have identified various genes for which sequence variation affects host responses to Listeria infection6,8-14. Determination and comparison of infection kinetics between different mouse strains is therefore an important method for identifying host genetic factors that contribute to immune responses against Listeria. Comparison of host responses to different Listeria strains is also an effective way to identify bacterial virulence factors that may serve as potential targets for antibiotic therapy or vaccine design.
We describe here a straightforward method for measuring bacterial load (colony forming units [CFU] per tissue) and preparing single-cell suspensions of the liver and spleen for FACS analysis of immune responses in Listeria-infected mice. This method is particularly useful for initial characterization of Listeria infection in novel mouse strains, as well as comparison of immune responses between different mouse strains infected with Listeria. We use the Listeria monocytogenes EGD strain15 that, when cultured on blood agar, exhibits a characteristic halo zone around each colony due to &beta;-hemolysis1 (Figure 1). Bacterial load and immune responses can be determined at any time-point after infection by culturing tissue homogenate on blood agar plates and preparing tissue cell suspensions for FACS analysis using the protocols described below. We would note that individuals who are immunocompromised or pregnant should not handle Listeria, and the relevant institutional biosafety committee and animal facility management should be consulted before work commences.

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Listeria monocytogenes is a model organism for studying immune responses and genetic susceptibility to intracellular bacteria in mice. This method enables one to measure bacterial load and generate single-cell suspensions of the liver and spleen from mice for FACS analysis to determine changes in immune cells due to Listeria infection.

Medir a carga bacteriana e resposta imune em camundongos infectados com Listeria monocytogenes</em

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of ...

Right Ventricular Systolic Pressure Measurements in Combination with Harvest of Lung and Immune Tissue Samples in Mice

The function of the right heart is to pump blood through the lungs, thus linking right heart physiology and pulmonary vascular physiology. Inflammation is a common modifier of heart and lung function, by elaborating cellular infiltration, production of cytokines and growth factors, and by initiating remodeling processes 1.
Compared to the left ventricle, the right ventricle is a low-pressure pump that operates in a relatively narrow zone of pressure changes. Increased pulmonary artery pressures are associated with increased pressure in the lung vascular bed and pulmonary hypertension 2. Pulmonary hypertension is often associated with inflammatory lung diseases, for example chronic obstructive pulmonary disease, or autoimmune diseases 3. Because pulmonary hypertension confers a bad prognosis for quality of life and life expectancy, much research is directed towards understanding the mechanisms that might be targets for pharmaceutical intervention 4. The main challenge for the development of effective management tools for pulmonary hypertension remains the complexity of the simultaneous understanding of molecular and cellular changes in the right heart, the lungs and the immune system.
Here, we present a procedural workflow for the rapid and precise measurement of pressure changes in the right heart of mice and the simultaneous harvest of samples from heart, lungs and immune tissues. The method is based on the direct catheterization of the right ventricle via the jugular vein in close-chested mice, first developed in the late 1990s as surrogate measure of pressures in the pulmonary artery5-13. The organized team-approach facilitates a very rapid right heart catheterization technique. This makes it possible to perform the measurements in mice that spontaneously breathe room air. The organization of the work-flow in distinct work-areas reduces time delay and opens the possibility to simultaneously perform physiology experiments and harvest immune, heart and lung tissues.
The procedural workflow outlined here can be adapted for a wide variety of laboratory settings and study designs, from small, targeted experiments, to large drug screening assays. The simultaneous acquisition of cardiac physiology data that can be expanded to include echocardiography5,14-17 and harvest of heart, lung and immune tissues reduces the number of animals needed to obtain data that move the scientific knowledge basis forward. The procedural workflow presented here also provides an ideal basis for gaining knowledge of the networks that link immune, lung and heart function. The same principles outlined here can be adapted to study other or additional organs as needed.

A specific and rapid protocol to simultaneously investigate right heart function, lung inflammation, and the immune response is described as a learning tool. Video and figures describe physiology and microdissection techniques in an organized team-approach that is adaptable to be used for small to large sized studies.

Sistólica do ventrículo direito Medição de Pressão em combinação com colheita de amostras de tecido pulmonar e imunológica em ratos

The function of the right heart is to pump blood through the lungs, thus linking right heart physiology and pulmonary vascular physiology. Inflammation is ...

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. Conversely, viruses have evolved intricate strategies to evade and exploit host immune signaling for survival and propagation. Viral immune evasion, entailing host defense and viral evasion, provides one of the most fascinating and dynamic interfaces to discern the host-virus interaction. These studies advance our understanding in innate immune regulation and pave our way to develop novel antiviral therapies.
Murine &#947;HV68 is a natural pathogen of murine rodents. &#947;HV68 infection of mice provides a tractable small animal model to examine the antiviral response to human KSHV and EBV of which perturbation of in vivo virus-host interactions is not applicable. Here we describe a protocol to determine the antiviral cytokine production. This protocol can be adapted to other viruses and signaling pathways.
Recently, we have discovered that &#947;HV68 hijacks MAVS and IKK&#946;, key innate immune signaling components downstream of the cytosolic RIG-I and MDA5, to abrogate NF&#922;B activation and antiviral cytokine production. Specifically, &#947;HV68 infection activates IKK&#946; and that activated IKK&#946; phosphorylates RelA to accelerate RelA degradation. As such, &#947;HV68 efficiently uncouples NF&#922;B activation from its upstream activated IKK&#946;, negating antiviral cytokine gene expression. This study elucidates an intricate strategy whereby the upstream innate immune activation is intercepted by a viral pathogen to nullify the immediate downstream transcriptional activation and evade antiviral cytokine production.

We describe a protocol to measure the antiviral cytokine production in mice infected with a model herpesvirus, murine gamma herpesvirus 68 (&#947;HV68) that is closely-related to human Kaposi&#8217;s sarcoma-associated herpesvirus (KSHV) and Epstein-Barr virus (EBV). Utilizing genetically modified mouse strains and mouse embryonic fibroblasts (MEFs), we assessed the antiviral cytokine production both in vivo and ex vivo. &#8220;Reconstituting&#8221; the expression of innate immune components in knockout embryonic fibroblasts by lentiviral transduction, we further pinpoint specific innate immune molecules and dissect the key signaling events that differentially regulate the antiviral cytokine production.

Dissecando imunitário inatas Sinalização em Evasion Viral da produção de citocinas

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages and disadvantages. We describe here an experimental colitis model that is initiated by adoptive transfer of syngeneic splenic CD4+CD45RBhigh T cells into T and B cell deficient recipient mice. The CD4+CD45RBhigh T cell population that largely consists of na&#239;ve effector cells is capable of inducing chronic intestinal inflammation, closely resembling key aspects of human IBD. This method can be manipulated to study aspects of disease onset and progression. Additionally it can be used to study the function of innate, adaptive, and regulatory immune cell populations, and the role of environmental exposures, i.e., the microbiota, in intestinal inflammation. In this article we illustrate the methodology for inducing colitis with a step-by-step protocol. This includes a video demonstration of key technical aspects required to successfully develop this murine model of experimental colitis for research purposes.

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Here, we present a protocol to induce colonic inflammation in mice by adoptive transfer of syngeneic CD4+CD45RBhigh T cells into T and B cell deficient recipients. Clinical and histopathological features mimic human inflammatory bowel diseases. This method allows the study of the initiation of colonic inflammation and progression of disease.

Indução de Murino inflamação intestinal por transferência adotiva de Effector CD4<sup&gt; +</sup&gt; CD45RB<sup&gt; Alta</sup&gt; Células T em imunodeficientes Mice

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages ...

Isolation of Leukocytes from the Murine Tissues at the Maternal-Fetal Interface

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing fetus. This tolerance is initiated during coitus, established during fecundation and implantation, and maintained throughout pregnancy. Active cellular and molecular mediators of maternal-fetal tolerance are enriched at the site of contact between fetal and maternal tissues, known as the maternal-fetal interface, which includes the placenta and the uterine and decidual tissues. This interface is comprised of stromal cells and infiltrating leukocytes, and their abundance and phenotypic characteristics change over the course of pregnancy. Infiltrating leukocytes at the maternal-fetal interface include neutrophils, macrophages, dendritic cells, mast cells, T cells, B cells, NK cells, and NKT cells that together create the local micro-environment that sustains pregnancy. An imbalance among these cells or any inappropriate alteration in their phenotypes is considered a mechanism of disease in pregnancy. Therefore, the study of leukocytes that infiltrate the maternal-fetal interface is essential in order to elucidate the immune mechanisms that lead to pregnancy-related complications. Described herein is a protocol that uses a combination of gentle mechanical dissociation followed by a robust enzymatic disaggregation with a proteolytic and collagenolytic enzymatic cocktail to isolate the infiltrating leukocytes from the murine tissues at the maternal-fetal interface. This protocol allows for the isolation of high numbers of viable leukocytes (&#62;70%) with sufficiently conserved antigenic and functional properties. Isolated leukocytes can then be analyzed by several techniques, including immunophenotyping, cell sorting, imaging, immunoblotting, mRNA expression, cell culture, and in vitro functional assays such as mixed leukocyte reactions, proliferation, or cytotoxicity assays.

Described herein is a protocol to isolate and analyze the infiltrating leukocytes of tissues at the maternal-fetal interface (uterus, decidua, and placenta) of mice. This protocol maintains the integrity of most cell surface markers and yields enough viable cells for downstream applications including flow cytometry analysis.

Isolamento de Leucócitos a partir de tecidos de murino na interface materno-fetal

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing ...

Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) resulting in cognitive and motor impairment. Experimental autoimmune encephalomyelitis (EAE) is a useful animal model of MS, because it is also characterized by lesion formation in the CNS, motor impairment and is also driven by autoimmune and inflammatory reactions. One of the EAE models is induced with a peptide derived from the myelin oligodendrocyte protein (MOG)35-55 in mice. The EAE mice develop a progressive disease course. This course is divided into three phases: the preclinical phase (day 0 - 9), the disease onset (day 10 - 11) and the acute phase (day 12 - 14). MS and EAE are induced by autoreactive T cells that infiltrate the CNS. These T cells secrete chemokines and cytokines which lead to the recruitment of further immune cells. Therefore, the immune cell distribution in the spinal cord during the three disease phases was investigated. To highlight the time point of the disease at which the activation/proliferation/accumulation of T cells, B cells and monocytes starts, the immune cell distribution in lymph nodes, spleen and blood was also assessed. Furthermore, the levels of several cytokines (IL-1&#946;, IL-6, IL-23, TNF&#945;, IFN&#947;) in the three disease phases were determined, to gain insight into the inflammatory processes of the disease. In conclusion, the data provide an overview of the functional profile of immune cells during EAE pathology.

This manuscript describes the methods for induction and scoring of the experimental autoimmune encephalomyelitis (EAE) model, together with the assessment of immune cell distribution and mRNA cytokine levels in lymph nodes, spleen, blood and spinal cord using flow cytometry and quantitative PCR, respectively, at various disease phases.

Indução de encefalomielite autoimune experimental em camundongos e avaliação da distribuição da doença dependente de células imunes em vários tecidos

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) ...

Human Placental and Decidual Organ Cultures to Study Infections at the Maternal-fetal Interface

The placenta shows a large degree of interspecies anatomic variability. To best understand biology and pathophysiology of the human placenta, it is imperative to design experiments using human cells and tissues. An advantage of organ culture is maintenance of three-dimensional (3D) structural organization and extracellular matrix. The goal of the method described here is successful establishment of ex vivo human gestational tissue organ cultures and their healthy culture maintenance for 72-96 hr. The protocol details the immediate processing of research-consented, placental and decidual specimens fresh from the operating suite. These are abundant specimens that would otherwise be discarded. Detailed instructions on the sterile collection of these samples, including morphologic details on how to select appropriate tissues to establish 3D organ cultures, is provided. Placental villous and decidual tissues are microdissected into 2-3 mm3 pieces and placed separately on matrix-lined transwell filters and cultured for several days. Villous and decidual organ cultures are well suited for the study of human host-pathogen interaction. As compared to other model organisms, these human cultures are particularly advantageous to examine mechanism of infection for pathogens that demonstrate variable patterns of host specificity. As an example, we demonstrate infection of placental and decidual organ cultures with the clinically relevant, facultative intracellular bacterial pathogen Listeria monocytogenes.

A simple method to establish primary human placental (villous) and decidual organ cultures is described. Villous and decidual organ cultures are invaluable tools for studying pathogenesis at the human maternal-fetal interface. Infection with the facultative intracellular bacterium Listeria monocytogenes is demonstrated.

Culturas placentária e Decidual órgão humano para estudar Infecções na interface materno-fetal

The placenta shows a large degree of interspecies anatomic variability. To best understand biology and pathophysiology of the human placenta, it is ...

Determining Immune System Suppression versus CNS Protection for Pharmacological Interventions in Autoimmune Demyelination

A major hallmark of the autoimmune demyelinating disease multiple sclerosis (MS) is immune cell infiltration into the brain and spinal cord resulting in myelin destruction, which not only slows conduction of nerve impulses, but causes axonal injury resulting in motor and cognitive decline. Current treatments for MS focus on attenuating immune cell infiltration into the central nervous system (CNS). These treatments decrease the number of relapses, improving quality of life, but do not completely eliminate relapses so long-term disability is not improved. Therefore, therapeutic agents that protect the CNS are warranted. In both animal models as well as human patients with MS, T cell entry into the CNS is generally considered the initiating inflammatory event. In order to assess if a drug protects the CNS, any potential effects on immune cell infiltration or proliferation in the periphery must be ruled out. This protocol describes how to determine whether CNS protection observed after drug intervention is a consequence of attenuating CNS-infiltrating immune cells or blocking death of CNS cells during inflammatory insults. The ability to examine MS treatments that are protective to the CNS during inflammatory insults is highly critical for the advancement of therapeutic strategies since current treatments reduce, but do not completely eliminate, relapses (i.e., immune cell infiltration), leaving the CNS vulnerable to degeneration.

This protocol describes how to determine whether pharmacological treatments for experimental autoimmune encephalomyelitis show CNS protection as a consequence of suppressing immune cell infiltration or are neuroprotective during the onslaught of immune cell infiltration.

Determinar a supressão imune Sistema contra CNS Proteção para farmacológicos intervenções na desmielinização auto-imune

A major hallmark of the autoimmune demyelinating disease multiple sclerosis (MS) is immune cell infiltration into the brain and spinal cord resulting in ...