עבודה זו נתמכה בחלקה על ידי פרס הפיתוח המוסדי של רוד איילנד (IDeA) רשת מצוינות במחקר ביו-רפואי מהמכון הלאומי למדעי הרפואה הכלליים של המכונים הלאומיים לבריאות תחת מענק מספר P20GM103430 ומרכז בריאנט לבריאות ומדעי ההתנהגות.

לכידת קונפורמציה של כרומוזומים (3C) למחקר והוראה לתואר ראשון

<ol>
	<li>McBryant, S. J., Adams, V. H., Hansen, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+architectural+proteins.">Chromatin architectural proteins.</a> Chromosome Research. 14 (1), 39-51 (2006).</li><li>Nalabothula, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chromatin+architectural+proteins+HMGD1+and+H1+bind+reciprocally+and+have+opposite+effects+on+chromatin+structure+and+gene+regulation.">The chromatin architectural proteins HMGD1 and H1 bind reciprocally and have opposite effects on chromatin structure and gene regulation.</a> BMC Genomics. 15, 92 (2014).</li><li>John, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+accessibility+pre-determines+glucocorticoid+receptor+binding+patterns.">Chromatin accessibility pre-determines glucocorticoid receptor binding patterns.</a> Nature Genetics. 43 (3), 264-268 (2011).</li><li>Fawcett, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+occurrence+of+a+fibrous+lamina+on+the+inner+aspect+of+the+nuclear+envelope+in+certain+cells+of+vertebrates.">On the occurrence of a fibrous lamina on the inner aspect of the nuclear envelope in certain cells of vertebrates.</a> The American Journal of Anatomy. 119 (1), 129-145 (1966).</li><li>Reddy, K. L., Zullo, J. M., Bertolino, E., Singh, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+repression+mediated+by+repositioning+of+genes+to+the+nuclear+lamina.">Transcriptional repression mediated by repositioning of genes to the nuclear lamina.</a> Nature. 452 (7184), 243-247 (2008).</li><li>Finlan, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recruitment+to+the+nuclear+periphery+can+alter+expression+of+genes+in+human+cells.">Recruitment to the nuclear periphery can alter expression of genes in human cells.</a> PLoS Genetics. 4 (3), e1000039 (2008).</li><li>Chambeyron, S., Da Silva, N. R., Lawson, K. A., Bickmore, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+re-organisation+of+the+Hoxb+complex+during+mouse+embryonic+development.">Nuclear re-organisation of the Hoxb complex during mouse embryonic development.</a> Development. 132 (9), 2215-2223 (2005).</li><li>Chambeyron, S., Bickmore, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+decondensation+and+nuclear+reorganization+of+the+HoxB+locus+upon+induction+of+transcription.">Chromatin decondensation and nuclear reorganization of the HoxB locus upon induction of transcription.</a> Genes and Development. 18 (10), 1119-1130 (2004).</li><li>Mahy, N. L., Perry, P. E., Gilchrist, S., Baldock, R. A., Bickmore, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+organization+of+active+and+inactive+genes+and+noncoding+DNA+within+chromosome+territories.">Spatial organization of active and inactive genes and noncoding DNA within chromosome territories.</a> The Journal of Cell Biology. 157 (4), 579-589 (2002).</li><li>Mahy, N. L., Perry, P. E., Bickmore, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+density+and+transcription+influence+the+localization+of+chromatin+outside+of+chromosome+territories+detectable+by+FISH.">Gene density and transcription influence the localization of chromatin outside of chromosome territories detectable by FISH.</a> The Journal of Cell Biology. 159 (5), 753-763 (2002).</li><li>Li, B., Carey, M., Workman, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+chromatin+during+transcription.">The role of chromatin during transcription.</a> Cell. 128 (4), 707-719 (2007).</li><li>Chen, A., Chen, D., Chen, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+of+DNase-seq+for+mapping+active+gene+regulatory+elements+across+the+genome+in+animals.">Advances of DNase-seq for mapping active gene regulatory elements across the genome in animals.</a> Gene. 667, 83-94 (2018).</li><li>Hughes, A. L., Rando, O. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+underlying+nucleosome+positioning+in+vivo.">Mechanisms underlying nucleosome positioning in vivo.</a> Annual Review of Biophysics. 43, 41-63 (2014).</li><li>Weiner, A., Hughes, A., Yassour, M., Rando, O. J., Friedman, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+nucleosome+mapping+reveals+transcription-dependent+promoter+packaging.">High-resolution nucleosome mapping reveals transcription-dependent promoter packaging.</a> Genome Research. 20 (1), 90-100 (2010).</li><li>Hughes, A. L., Jin, Y., Rando, O. J., Struhl, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+functional+evolutionary+approach+to+identify+determinants+of+nucleosome+positioning:+A+unifying+model+for+establishing+the+genome-wide+pattern.">A functional evolutionary approach to identify determinants of nucleosome positioning: A unifying model for establishing the genome-wide pattern.</a> Molecular Cell. 48 (1), 5-15 (2012).</li><li>Dekker, J., Rippe, K., Dekker, M., Kleckner, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capturing+chromosome+conformation.">Capturing chromosome conformation.</a> Science. 295 (5558), 1306-1311 (2002).</li><li>van Berkum, N. L., Dekker, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determining+spatial+chromatin+organization+of+large+genomic+regions+using+5C+technology.">Determining spatial chromatin organization of large genomic regions using 5C technology.</a> Methods in Molecular Biology. 567, 189-213 (2009).</li><li>Smith, E. M., Lajoie, B. R., Jain, G., Dekker, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Invariant+TAD+boundaries+constrain+cell-type-specific+looping+interactions+between+promoters+and+distal+elements+around+the+CFTR+locus.">Invariant TAD boundaries constrain cell-type-specific looping interactions between promoters and distal elements around the CFTR locus.</a> American Journal of Human Genetics. 98 (1), 185-201 (2016).</li><li>Crane, E. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+inputs+into+C.+elegans+dosage+compensation:+Chromosome+conformation+and+the+miRNA-specific+argonaute+ALG-2.">Two inputs into C. elegans dosage compensation: Chromosome conformation and the miRNA-specific argonaute ALG-2.</a> University of California, Berkeley. , (2012).</li><li>Bell, A. C., West, A. G., Felsenfeld, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+protein+CTCF+is+required+for+the+enhancer+blocking+activity+of+vertebrate+insulators.">The protein CTCF is required for the enhancer blocking activity of vertebrate insulators.</a> Cell. 98 (3), 387-396 (1999).</li><li>Cuadrado, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+contributions+of+cohesin-SA1+and+cohesin-SA2+to+TADs+and+polycomb+domains+in+embryonic+stem+cells.">Specific contributions of cohesin-SA1 and cohesin-SA2 to TADs and polycomb domains in embryonic stem cells.</a> Cell Reports. 27 (12), 3500-3510 (2019).</li><li>Sarro, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disrupting+the+three-dimensional+regulatory+topology+of+the+Pitx1+locus+results+in+overtly+normal+development.">Disrupting the three-dimensional regulatory topology of the Pitx1 locus results in overtly normal development.</a> Development. 145 (7), (2018).</li><li>Tolhuis, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+among+polycomb+domains+are+guided+by+chromosome+architecture.">Interactions among polycomb domains are guided by chromosome architecture.</a> PLoS Genetics. 7 (3), e1001343 (2011).</li><li>Splinter, E., de Wit, E., van de Werken, H. J. G., Klous, P., de Laat, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determining+long-range+chromatin+interactions+for+selected+genomic+sites+using+4C-seq+technology:+From+fixation+to+computation.">Determining long-range chromatin interactions for selected genomic sites using 4C-seq technology: From fixation to computation.</a> Methods. 58 (3), 221-230 (2012).</li><li>Fern&#225;ndez-Mi&#241;&#225;n, A., Bessa, J., Tena, J. J., G&#243;mez-Skarmeta, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+21+-+Assay+for+transposase-accessible+chromatin+and+circularized+chromosome+conformation+capture,+two+methods+to+explore+the+regulatory+landscapes+of+genes+in+zebrafish.">Chapter 21 - Assay for transposase-accessible chromatin and circularized chromosome conformation capture, two methods to explore the regulatory landscapes of genes in zebrafish.</a> Methods in Cell Biology. 135, 413-430 (2016).</li><li>Dekker, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+three+&amp;#34;C&amp;#34;+s+of+chromosome+conformation+capture:+controls,+controls,+controls.">The three &amp;#34;C&amp;#34; s of chromosome conformation capture: controls, controls, controls.</a> Nature Methods. 3 (1), 17-21 (2006).</li><li>Hag&#232;ge, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+chromosome+conformation+capture+assays+(3C-qPCR).">Quantitative analysis of chromosome conformation capture assays (3C-qPCR).</a> Nature Protocols. 2 (7), 1722-1733 (2007).</li><li>Lajoie, B. R., van Berkum, N. L., Sanyal, A., Dekker, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=My5C:+Webtools+for+chromosome+conformation+capture+studies.">My5C: Webtools for chromosome conformation capture studies.</a> Nature Methods. 6 (10), 690-691 (2009).</li><li>Han, M., Wei, G., McManus, C. E., Hillier, L. W., Reinke, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolated+C.+elegans+germ+nuclei+exhibit+distinct+genomic+profiles+of+histone+modification+and+gene+expression.">Isolated C. elegans germ nuclei exhibit distinct genomic profiles of histone modification and gene expression.</a> BMC Genomics. 20 (1), 500 (2019).</li></ol>

המחברים מצהירים כי אין ניגודי עניינים.

3C היא טכניקה רבת עוצמה המושרשת בטכניקות מולקולריות בסיסיות. זהו הבסיס הזה של כלים בסיסיים שהופך את 3C לטכניקה מסקרנת כל כך לשימוש עם סטודנטים לתואר ראשון. עם כל כך הרבה מחקרים עדכניים המתבוננים בדינמיקה של כרומטין בקנה מידה רחב כל כך, שימוש בתוצאות אלה כדי לתכנן ניסוי ממוקד צר על גן יחיד או אזור גנומי יש פוטנציאל ליצור ניסוי ייחודי ומשפיע במחקר לתואר ראשון. לעתים קרובות, ניסויים כאלה נחשבים מתקדמים מדי עבור סטודנטים לתואר ראשון, אבל עם תכנון זהיר, הם ניתנים להשגה בקלות. חשוב לציין כי הבדיקות שנועדו לחקור את קשרי הכרומטין שנלכדו על ידי ספריית 3C יכולות להשתנות מ- PCR כמותי למחצה לריצוף גנום שלם. למעשה, נתונים מנייר 3C הראשון16 נוצרו מ- qPCR. ניתן להשתמש במגוון רחב זה של בדיקות מכיוון שכל טכנולוגיות ה-3C מייצרות את אותו מוצר – ספרייה של מקטעי דנ"א המייצגים קשרים תלת-ממדיים בגרעין.
מוצג כאן התאמה של פרוטוקול גמיש יותר ומתאים יותר שמתאים יותר לחוקרים לתואר ראשון. תקופות ההשהיה המפורטות לעיל מרמזות על עיכובים של לילה; עם זאת, הפסקות אלה יכולות להימשך על פני סופי שבוע, ובמקרה של התאים והגרעינים, במשך שבועות. השיקול החשוב ביותר הוא מתי העבודה תתבצע. לעתים קרובות בפרוטוקולים, ישנם שלבים תלויי זמן כאשר השהיה אינה אופציה. מלבד כמה נקודות (יום 1 ויום 2), ישנם מקומות רבים לעצור ולהקפיא את הדגימה. אלה קריטיים כאשר עובדים עם סטודנטים לתואר ראשון, שבו לוחות הזמנים והתזמונים של עבודת המעבדה צריכים להיות גמישים. בנוסף להנדסת תחנות אלה לתוך הפרוטוקול, סטודנטים לתואר ראשון מעודדים לעבוד בזוגות או אפילו בקבוצות קטנות של שלושה או ארבעה. קבוצות עובדות היטב עבור פרוטוקול זה, מכיוון שהתלמידים יכולים לתמוך זה בזה וליצור מערכת חברים כך שכולם עובדים בבטחה. עבודת מעבדה היא גם מהנה יותר עם אחרים המעורבים. עם קבוצות, התלמידים יכולים גם לעבוד על מגוון רחב של שאלות המתמקדות בארגון הכרומטין תוך ביצוע אותו פרוטוקול. לכן, גם בזמן שהתלמידים עובדים על פרויקטים נפרדים, הפרוטוקול מקשר בין מאמציהם, ובגלל זה, הם יכולים לתמוך זה בזה.
התאמות אחרות נועדו לעקוף את העובדה שכלים וציוד מיוחדים מסוימים אינם נמצאים בהכרח בכל המוסדות לתואר ראשון. פריטי ציוד אלה כוללים אך אינם מוגבלים לתרמוסייקלרים qPCR, מערכות תיעוד ג'ל וספקטרומטרים של ננו נפח. ואכן, חלקים אלה של ציוד הם נוחים אבל הם לא דרישה. כאן, השיטה הקלאסית של 3C מתוארת גם בחלק עיצוב פריימר; זה כרוך בזיהוי מוקד עניין גנומי, ומתוך כך, הערכת מוקדים גנומיים אחרים עבור נקודות מגע כרומטין רחוקות יותר. טכניקה זו פועלת היטב גם אם נעשה שימוש במערך נתונים שפורסם, כגון מערך נתונים המשתמש ב- Hi-C, שבו מזוהים אתרים חיוביים (מתחברים) ושליליים ידועים (שאינם מתחברים). תכנון ניסויים באמצעות מערכי נתונים אלה שפורסמו הוא התאמה נהדרת נוספת עבור מעבדות הוראה, שכן הסיכוי לזיהוי מוצלח של קשרי כרומטין הוא בדרך כלל גדול יותר. בנוסף, ניתן לדון במאמר המחקר בכיתה ולשמש כאסמכתא.
פרוטוקול זה משתמש בגישת qPCR שונה כדי להמחיש את היווצרות המוצר 3C. בקרות חיוניות להצלחת טכניקת 3C. כל ניסוי משתמש הן בפקדי דגימה והן בבקרות פריימר כדי לקבוע את השלמת הליך 3C. בקרות הדגימה כוללות בקרה לא מעוכלת (DNA גנומי) ובקרה מעוכלת. הבקרה הלא מעוכלת קובעת את האות הבסיסי עבור ערכות הפריימר ומשמשת עם בקרת העיכול הצולבת כדי לקבוע את יעילות העיכול צפוי שתהיה ירידה במוצר עבור כל פריימר המופנה דרך אתר הגבלה. השוואת ערך זה לבקרה הלא מעוכלת מספקת אינדיקציה לכמה טוב הדגימה עוכלה.
הפריימרים ל-PCR כוללים פריימר בקרה ופריימרים לבדיקה. פריימר הבקרה הוא ערכת פריימר הקרובה לאזור הגנומי הנבדק ואינה מכילה אתר הגבלה. זה מספק את הבסיס לקביעת השפע של מוצרי PCR פריימר בדיקה. פריימרים לבדיקה הם פריימרים קדימה ואחורה שמאגפים אתר הגבלה עבור מוקד עניין גנומי מסוים (איור 3). תגובות באמצעות ערכות פריימר אלה מושוות כדי לקבוע את יעילות העיכול, כמו שפע המוצר צריך לרדת אם אתר ההגבלה נחתך. בקביעת ארגון הכרומטין, פריימר בדיקה אחד מלוקוס אחד מזווג עם פריימר בדיקה אחר ממוקד גנומי אחר כדי לקבוע אם שני מוקדים אלה קרובים זה לזה במרחב תלת-ממדי. במקרה כזה, הציפייה היא שמוצר PCR יימצא רק באמצעות דגימת 3C כתבנית.
חשוב לציין שגם לפריימרים מתוקפים יש נטייה להיכשל (איור 4: סט פריימר r14). בנוסף, תוצרי PCR מזוהים לעיתים קרובות בתגובות בקרה ובתגובות בהן לא צפוי קשר כרומטין (כגון הבקרה המעוכלת, שכן היא אינה קשורה). מופעים אלה רצפים ונכשלים ב-Sanger QC או חוזרים ללא רצף מוגדר (איור 5). בנוסף, ניסויי 3C מסורתיים יוצרים "תבנית בקרה", דגימת דנ"א לא מוצלבת, מעוכלת וקשורה, המייצגת את כל המקטעים הקשורים האפשריים שניתן לייצר עם כמות נתונה של דנ"א. "תבנית הבקרה" ממלאת תפקיד חשוב בהשוואת העוצמות של אותות qPCR בין שני אתרים גנומיים כדי לקבוע אם האות מייצג אינטראקציה אמיתית או רק אסוציאציה אקראית. יצירת "תבנית בקרה" יכולה להיות בעייתית, מכיוון שחלק גדול מהכרומטין הנבדק חייב להילכד בצורה של כרומוזום מלאכותי ולעבד יחד עם דגימות 3C. אבטחת מבנה כזה עשויה להיות בלתי ישימה, ויצירתו יכולה להיות מחוץ לתחום של פרויקט סמסטריאלי. בשל קשיים אלה, אנו ממליצים להשתמש בפריימר בקרה. פריימר הבקרה אינו מחליף את כל הפונקציונליות של "תבנית הבקרה", אך עדיין מספק את ההזדמנות לנתח את הנתונים כדי לקבל החלטות "נוכחות" או "היעדרות".
בעת ביצוע qPCR, שימוש בכמויות שוות של המדגם חשוב. יש לקבוע זאת, גם אם משתמשים בננו-ספקטרופוטומטר כגון ננו-טיפה, על ידי יצירת עקומה סטנדרטית מדנ"א גנומי בריכוז ידוע והתאמת דגימות 3C לקו זה. יש לרשום כמויות אלה ולהשתמש בהן בבדיקות PCR עוקבות. איכות תגובת ה-PCR חשובה גם היא. כאשר ה-PCR פועל ב-qPCR, שפע המוצר נמדד באמצעות פלואורסצנטיות ונרשם. הקלטה זו נגישה בחלקת ההגברה. לאחר סיום התוכנית, חשוב לבדוק את תרשים ההגברה ולוודא שלתגובות (למעט פקדי ה- No Template) יש שלושה שלבים: קו בסיס, שלב מעריכי ושלב מישור/רוויה. חשוב לבדוק שלתגובות יש פאזה אקספוננציאלית, בפרט לקביעת הסף (ראו בהמשך). בנוסף, עבור דגימות בדילול סדרתי, צריך להיות שינוי בערכי Ct בהתאם לדילול המדגם (הריכוז הגבוה ביותר יהיה בעל ערכי ה- Ct הנמוכים ביותר, ואילו הריכוז הנמוך ביותר יהיה בעל ערכי ה- Ct הגבוהים ביותר). דגימות שאינן משקפות שינוי זה בתרשים ההגברה דורשות דילול חדש או מצביעות על בעיה גדולה יותר בהיווצרות דגימת 3C. לבסוף, תוך יצירת העקומה הסטנדרטית, תוכנת ה- PCR תחשב את יעילות ה- PCR ואת ערך R2 . יעילות ה- PCR צריכה להיות גדולה מ- 90%, וערך R2 צריך להיות גדול מ- 0.99. אם אחד מהתנאים הללו אינו מתקיים, סביר להניח שמשהו לא בסדר במדגם או בפריימרים של PCR.
לאחר qPCR, אחוז העיכול ואת הנוכחות של אינטראקציות 3C ניתן לחשב באמצעות qPCR Ct עבור כל תגובה. כדי לקבוע זאת, ראשית, יש לקבוע את הסף לתגובת PCR. זה נעשה בדרך כלל באמצעות התוכנה שמגיעה עם מכונת qPCR. קביעת הסף תגדיר את ריכוז מוצר ה-PCR שישמש להשוואת ערכי ה-Ct המדגם. הסף צריך לחצות את עקומות ההגברה של תגובות ה-PCR בשלב המעריכי של ההגברה. ניתן להשוות רק תגובות PCR עם הגברה מעריכית (במקרה זה, פריימר הבקרה ותגובות פריימר הבדיקה), מכיוון שזו הדרך היחידה להבטיח שהתגובות מגבירות DNA באותו קצב וניתן להשוות אותן נאמנה. כאשר מנתחים את הגרפים של 3C, תגובות חיוביות מותנות מזוהות כתגובות עם יותר תוצר על פני דגימות הביקורת, הבקרה הגנומית ובקרת העיכול (איור 4B). עם זאת, דגימות אלה חייבות להיות מאומתות עוד יותר באמצעות ריצוף Sanger לאחר טיהור הג'ל של מוצר ה- PCR.
לאחר ריצוף Sanger, ניתן לנתח דגימות שעוברות את ה- QC באמצעות Blat. מטרת ניתוח זה היא לקבוע אם לדגימה יש את הרצף של שני המוקדים הגנומיים של המטרה הצמודים לאתר ההגבלה (DpnII במקרה של פרוטוקול זה). אם שני הרצפים מזוהים, אז קטע 3C יכול להיחשב מאומת. אם התוצאות של Blat אינן מחזירות את הרצף הצפוי, הדבר עשוי להצביע על כך שפריימר אחד או שניהם אינם אופטימליים, וכתוצאה מכך תוצאת qPCR חיובית שגויה. קבצי המעקב עבור הדגימות החיוביות הכוזבות יהיו בעלי שיאי בסיס לא מוגדרים, ודוחות Seq יכילו בעיקר קריאות בסיס "n".
אימות Sanger הוא חיוני, מכיוון שתוצאות חיוביות שגויות מהיווצרות מוצר PCR מלאכותי אפשריות. ניתן לזהות את התוצאות החיוביות הכוזבות האלה כאשר לתוצרי הריצוף אין את רצף המטרה הצפוי או אתר DpnII האופייני למקטע 3C תקין (איור 5). ריצוף מקטעי ה-PCR מספק גם נקודת נתונים נוספת לניסוי ומסביר לתלמידים כי טכניקת ה-3C מזהה מוקדים גנומיים מרוחקים המתאחדים במרחב תלת-ממדי בתוך הגרעינים.
טכניקת 3C מספקת שפע של טכניקות מולקולריות בסיסיות לסטודנטים לתואר ראשון בהליך גמיש ופשוט. טכניקת 3C זו היא גם נקודת השקה לטכניקות 3C אחרות המשלבות ריצוף מהדור הבא (NGS). ניסויים מסוג זה יכולים לחשוף סטודנטים לתואר ראשון להיבטים חשובים של ביואינפורמטיקה והם מושרשים בעקרונות הבסיסיים המתוארים כאן. ניסיון ומעורבות לתואר ראשון הם המפתח להצלחתם ולהתפתחותם כמדענים צעירים. על ידי מתן הזדמנויות אלה, סטודנטים לתואר ראשון יכולים לחזק את הבנתם של עקרונות בסיסיים תוך בניית הביטחון שלהם להתמודד עם טכניקות חדשניות ושאלות.

הגנום של אורגניזם מכיל לא רק את כל הגנים הדרושים לתפקוד, אלא גם את כל ההוראות כיצד ומתי להשתמש בהם. זה הופך את ויסות הגישה לגנום לאחד התפקידים החשובים ביותר של התא. ישנם מנגנונים רבים לשליטה בתפקוד הגנים; עם זאת, ברמת הבסיס שלו, בקרת גנים מסתכמת ביכולתם של גורמי שעתוק רגולטוריים (טרנס-פקטורים) להיקשר לרצפי הדנ"א הספציפיים שלהם (רצפי CIS-Regulatory ). זו אינה יכולת מולדת; במקום זאת, הוא נשלט על ידי הארגון/המבנה של הגנום בגרעין, אשר שולט על זמינות/חשיפה של רצפי CIS-regulatory לגורמים טרנס-פקטוריים 1,2,3. אם הגורמים הטרנס-פקטוריים אינם יכולים למצוא את הרצפים הרגולטוריים שלהם, אז הטרנס-פקטורים אינם יכולים לבצע את משימות הרגולציה שלהם. עובדה זו הפכה את הבנת האופן שבו גנומים מאורגנים בגרעין למקור חשוב לחקירה.
מקובל שבמהלך שלב הביניים, כרומוזומים אאוקריוטים בגרעין תופסים תחום משלהם המעוגן ללמינה הגרעינית ולמטריצה הגרעינית (איור 1), מה שהופך את הכרומוזום לדומה יותר לפרוסת פיצה, ולא לאטריות על צלחת ספגטי. הכרומוזומים מעובים חלקית על ידי אינטראקציות חלבון-דנ"א (כרומטין) המסובבות ולולאות חלקים של הכרומוזום. באמצעות מיקרוסקופ אלקטרונים, פלואורסצנטיות DNA תלת-ממדית בהכלאה באתרו (FISH), וטכניקות תיוג DNA (כלומר, מתילציה פלואורסצנטית ומלאכותית של DNA), נמצאו תחומים לא פעילים של כרומטין דחוסים בצפיפות לאורך הפריפריה הגרעינית 4,5,6, בעוד חלקים של כרומטין פעיל ופחות מעובה נמצאים בחלק הפנימי של הגרעין 7,8,9, 10. ניסויים אלה מספקים זווית ראייה רחבה של דינמיקת הכרומוזומים, אך עושים מעט כדי ללכוד את השינויים המתרחשים באופן מקומי סביב מנועי הגן שנצפו במחקרי DNase11,12 ונוקלאוזומים13,14,15.
המפתח לשחרור דינמיקת כרומטין ברזולוציה גבוהה יותר היה ניסוח טכניקת מיפוי הכרומוזומים התלת-ממדית, 3C. טכניקת 3C עצמה כוללת ארבעה שלבים עיקריים: קישור צולב של כרומטין, עיכול כרומטין על-ידי אנזימי הגבלה, קשירת כרומטין וטיהור דנ"א (איור 2). לאחר מכן ניתן לאפיין את מקטעי הדנ"א המלאכותיים החדשים שנוצרו בתהליך זה כדי לחשוף את הקשר הפיזיקלי ההדוק בין פיסות דנ"א מרוחקות ליניארית16. טכניקת 3C הפכה לבסיס ליצירת טכניקות ספין-אוף מרובות המשתמשות בשלבים הראשונים של 3C כדי לשאול שאלות רחבות יותר ברחבי הגנום (למשל, Hi-C, 4C, ChIP-C). משפחה זו של טכניקות 3C זיהתה כי כרומוזומים מאורגנים במספר יחידות בדידות הנקראות תחומים הקשורים טופולוגית (TADs). TADs מקודדים בגנום ומוגדרים על ידי לולאות כרומטין שמשני צדיהן גבולות לא לולאתיים 16,17,18,19. גבולות TAD נשמרים על ידי שני גורמים שמורים אבולוציונית הנמצאים בכל מקום, כולל גורם קשירת CCCT (CTCF) ולכידות, המונעים מלולאות בתוך TADs נפרדים מאינטראקציה16,20. הלולאות מתווכות על ידי אינטראקציה של טרנס-פקטורים עם הרצפים הרגולטוריים שלהם, כמו גם CTCF ולכידות21.
למרות שמחקרים רבים המשתמשים בטכנולוגיות 3C שואלים שאלות רחבות היקף בגנום ומשתמשים בטכניקות איסוף דגימות מסובכות, ניסוח טכניקת 3C מבוסס על טכניקות בסיסיות של ביולוגיה מולקולרית. זה הופך את 3C למסקרן לפריסה הן במעבדות מחקר לתואר ראשון והן במעבדות הוראה. ניתן להשתמש בטכניקת 3C עבור שאלות ממוקדות קטנות יותר והיא גמישה מטבעה להרחבה או למטה (גנים בודדים22, כרומוזומים16 ו / או גנומים18) בהתאם למיקוד ולכיוון של השאלות שנשאלו. טכניקה זו יושמה גם על מגוון רחב של מערכות מודל 7,16,19,23 והוכחה להיות תכליתי בשימוש בו. זה עושה 3C טכניקה מצוינת עבור סטודנטים לתואר ראשון כי התלמידים יכולים לצבור ניסיון בטכניקות ביולוגיה מולקולרית משותפת תוך גם צובר ניסיון רב ערך לענות על שאלות מכוונות.
מוצג כאן פרוטוקול מותאם להכנת ספריית 3C המבוסס על פרוטוקולים 24,25,26,27 שפורסמו בעבר. פרוטוקול זה עבר אופטימיזציה לכ- 1 × 107 תאים, אם כי הוא יצר ספריות 3C עם מעט כמו 1 × 105 תאים. פרוטוקול זה הוכח כרב-תכליתי ושימש ליצירת ספריות 3C מעוברים של דגי זברה, קווי תאים של דגי זברה ותולעת עגולה (Caenorhabditis elegans) של מבוגרים צעירים (YA). הפרוטוקול צריך להתאים גם לשורות תאים של יונקים, ועם הסתגלות נוספת, שמרים.
מטרת התאמות אלה היא להפוך את 3C לנגיש יותר עבור סטודנטים לתואר ראשון. הקפיד להשתמש בטכניקות דומות לאלה שניתן להשיג במעבדת הוראה לתואר ראשון. טכניקת 3C מספקת הזדמנויות למידה רבות לסטודנטים לתואר ראשון ללמוד טכניקות ביולוגיה מולקולרית בסיסיות שיועילו להתפתחותם על הספסל, בכיתה ובמאמציהם לאחר סיום הלימודים.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>37% Formaldehyde&#160;</td>
			<td>Millapore-Sigma</td>
			<td>F8775</td>
			<td></td>
		</tr>
		<tr>
			<td>100% Ethanol</td>
			<td>Millapore-Sigma</td>
			<td>E7023</td>
			<td></td>
		</tr>
		<tr>
			<td>CaCl2</td>
			<td>MP Biomedical</td>
			<td>215350280</td>
			<td></td>
		</tr>
		<tr>
			<td>chloroform</td>
			<td>Millapore-Sigma</td>
			<td>C0549</td>
			<td></td>
		</tr>
		<tr>
			<td>cOmplete, EDTA-free Protease Inhibitor Cocktail</td>
			<td>Millapore-Sigma</td>
			<td>COEDTAF-RO</td>
			<td>mixed to 50x in water. Diluted to 1x in Sucrose buffer and GB buffer fresh</td>
		</tr>
		<tr>
			<td>Dithiothreitol (DTT)</td>
			<td>Millapore-Sigma</td>
			<td>D0632</td>
			<td>1 M stock diluted to 500 &#181;M in Sucrose buffer and GB buffer fresh</td>
		</tr>
		<tr>
			<td>DpnII</td>
			<td>NEB</td>
			<td>R0543M</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Millapore-Sigma</td>
			<td>G9012</td>
			<td></td>
		</tr>
		<tr>
			<td>glycine</td>
			<td>Millapore-Sigma</td>
			<td>G8898</td>
			<td></td>
		</tr>
		<tr>
			<td>glycogen</td>
			<td>Millapore-Sigma</td>
			<td>10901393001</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Millapore-Sigma</td>
			<td>H3375</td>
			<td></td>
		</tr>
		<tr>
			<td>KCl</td>
			<td>Millapore-Sigma</td>
			<td>P3911</td>
			<td></td>
		</tr>
		<tr>
			<td>KH2PO4</td>
			<td>Millapore-Sigma</td>
			<td>P5655</td>
			<td></td>
		</tr>
		<tr>
			<td>methyl green pyronin&#160;&#160;</td>
			<td>Millapore-Sigma</td>
			<td>HT70116</td>
			<td></td>
		</tr>
		<tr>
			<td>MgAc2</td>
			<td>Thermoscientific</td>
			<td>1222530</td>
			<td></td>
		</tr>
		<tr>
			<td>Na2HPO4</td>
			<td>Millapore-Sigma</td>
			<td>S5136</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Millapore-Sigma</td>
			<td>S9888</td>
			<td></td>
		</tr>
		<tr>
			<td>phenol-chloroform&#160;</td>
			<td>Millapore-Sigma</td>
			<td>P3803</td>
			<td></td>
		</tr>
		<tr>
			<td>Pronase</td>
			<td>Millapore-Sigma</td>
			<td>11459643001</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>IBI Scientific</td>
			<td>IB05406</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR Ready mix (Phire Taq etc)</td>
			<td>Millapore-Sigma</td>
			<td>KCQS07</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase A&#160;</td>
			<td>Millapore-Sigma</td>
			<td>R6148</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Acetate</td>
			<td>Millapore-Sigma</td>
			<td>S2889</td>
			<td></td>
		</tr>
		<tr>
			<td>sodium dodecyl sulfate (SDS)</td>
			<td>Millapore-Sigma</td>
			<td>L3771</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>Millapore-Sigma</td>
			<td>S0389</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA Ligase</td>
			<td>Promega</td>
			<td>M1804</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl</td>
			<td>Millapore-Sigma</td>
			<td>108319</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Millapore-Sigma</td>
			<td>T9284</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin-EDTA&#160;</td>
			<td>Millapore-Sigma</td>
			<td>T4049</td>
			<td></td>
		</tr>
	</tbody>
</table>

getting an a with the 3cs: chromosome conformation capture for undergraduates

לכידת קונפורמציה של כרומוזומים (3C) היא כלי רב עוצמה שהוליד משפחה של טכניקות דומות (למשל, Hi-C, 4C ו-5C, המכונות כאן טכניקות 3C) המספקות מידע מפורט על הארגון התלת-ממדי של כרומטין. טכניקות 3C שימשו במגוון רחב של מחקרים, החל מניטור השינויים בארגון הכרומטין בתאים סרטניים ועד לזיהוי מגעים משפרים שנעשו עם מקדמי גנים. בעוד שרבים מהמחקרים המשתמשים בטכניקות אלה שואלים שאלות גדולות ברחבי הגנום עם סוגי דגימות מורכבים (כלומר, אנליזה של תא יחיד), מה שהולך לאיבוד לעתים קרובות הוא שטכניקות 3C מבוססות על שיטות ביולוגיה מולקולרית בסיסיות הישימות למגוון רחב של מחקרים. על ידי התייחסות לשאלות ממוקדות היטב של ארגון הכרומטין, ניתן להשתמש בטכניקה חדשנית זו כדי לשפר את חוויית המחקר וההוראה לתואר ראשון. מאמר זה מציג פרוטוקול 3C ומספק התאמות ונקודות דגש ליישום במוסדות לתואר ראשון בעיקר בהתנסויות מחקר והוראה לתואר ראשון.

An organism&#39;s genome not only holds all the genes required for function but also all the instructions on how and when to use them. This makes regulating access to the genome one of the most important functions of the cell. There are many mechanisms to control gene function; however, at its base level, gene regulation comes down to the ability of regulatory transcription factors (trans-factors) to bind to their specific DNA sequences (cis-regulatory sequences). This is not an innate ability; instead, it is governed by the organization/structure of the genome in the nucleus, which controls the availability/exposure of the cis-regulatory sequences to the trans-factors1,2,3. If the trans-factors cannot find their cis-regulatory sequences, then the trans-factors cannot perform their regulatory tasks. This has made understanding how genomes are organized in the nucleus an important source of inquiry.
It is widely accepted that during interphase, eukaryotic chromosomes in the nucleus occupy their own domain anchored to the nuclear lamina and nuclear matrix (Figure 1), thus making the chromosome more like a slice of pizza, rather than a noodle on a plate of spaghetti. Chromosomes are partially condensed by protein-DNA interactions (chromatin) that twist and loop portions of the chromosome. Through electron microscopy, three-dimensional DNA fluorescence in situ hybridization (FISH), and DNA tagging techniques (i.e., fluorescent and artificial DNA methylation), inactive domains of chromatin have been found to be packed tightly along the nuclear periphery4,5,6, while portions of active, less condensed chromatin are found in the interior of the nucleus7,8,9,10. These experiments provide a wide-angle view of chromosome dynamics but do little to capture the changes that occur locally around the gene promotors observed in DNase11,12 and nucleosome13,14,15 studies.
The key to unlocking higher-resolution chromatin dynamics was the formulation of the 3D chromosome mapping technique, 3C. The 3C technique itself comprises four main steps: crosslinking of chromatin, chromatin digestion by restriction enzymes, chromatin ligation, and DNA purification (Figure 2). The new artificial DNA fragments generated by this process can then be characterized to reveal the close physical association between linearly distant pieces of DNA16. The 3C technique became the basis for the creation of multiple spin-off techniques that utilize the initial steps of 3C to ask broader genome-wide questions (e.g., Hi-C, 4C, ChIP-C). This family of 3C techniques has identified that chromosomes are organized into multiple discrete units termed topologically associated domains (TADs). TADs are encoded in the genome and are defined by chromatin loops flanked by unlooped boundaries16,17,18,19. The TAD boundaries are maintained by two evolutionarily conserved and ubiquitous factors, including CCCT binding factor (CTCF) and cohesion, which prevent loops within separate TADs from interacting16,20. The loops are mediated by the interaction of trans-factors with their regulatory sequences, as well as CTCF and cohesion21.
Though many studies using 3C technologies ask broad genome-wide questions and employ complicated sample collection techniques, the formulation of the 3C technique is based on basic molecular biology techniques. This makes 3C intriguing for deployment in both undergraduate research and teaching labs. The 3C technique can be employed for smaller focused questions and is inherently flexible to scaling up or down (single genes22, chromosomes16, and/or genomes18) depending on the focus and direction of the questions asked. This technique has also been applied to a wide range of model systems7,16,19,23 and has been proven to be versatile in its use. This makes 3C an excellent technique for undergraduates in that students can gain experience in common molecular biology techniques while also gaining valuable experience in answering directed questions.
Presented here is an adapted protocol for 3C library preparation based on previously published protocols24,25,26,27. This protocol has been optimized for approximately 1 &#215; 107 cells, though it has generated 3C libraries with as little as 1 &#215; 105 cells. This protocol has proven to be versatile and has been used to generate 3C libraries from zebrafish embryos, zebrafish cell lines, and young-adult (YA) Caenorhabditis elegans (roundworm). The protocol should also be appropriate for mammalian cell lines and, with further adaptation, yeast.
The goal of these adaptations is to make 3C more accessible for undergraduates. Care has been taken to use techniques that are similar to those that can be accomplished in an undergraduate teaching laboratory. The 3C technique provides many learning opportunities for undergraduates to learn basic molecular biology techniques that will benefit their development at the bench, in the classroom, and in their endeavors after graduation.

מחבר זרקור: מקבל A עם 3Cs: לכידת קונפורמציה כרומוזומים עבור סטודנטים לתואר ראשון  

קבלת A עם 3Cs: לכידת קונפורמציה כרומוזומים לסטודנטים לתואר ראשון

Our research aims to uncover how chromatin organization controls gene expression. The focus is on determining what factors regulate chromatin at the gene level to control gene activity. Currently, technologies similar to chromosome confirmation capture, or 3C, are used to make progress in this field.Investments in sample collection and sequencing technologies have pushed us what the 3C techniques can show us. The greatest experimental challenge currently is collecting samples having uniform chromatin architecture. Heterogeneity in samples leads to confounding results.In the future, we'll be focusing on how changes in chromatin organization play a role in cancer.

הליך זה יפיק דגימת 3C ניסיונית אחת ושתי דגימות ביקורת (לא מעוכלות ומעוכלות). באמצעות שלוש דגימות אלה, qPCR בוצע. מתוצאות אלה חושבה יעילות העיכול (משוואה 1) ונרשמה (טבלה 1). מחישובים אלה נקבע כי לדגימת 3C הייתה יעילות עיכול של כ-88% (ממוצע של טבלה 1) בשבעת האתרים הגנומיים שנבדקו.
לאחר מכן, הדגימות נבדקו לנוכחות של מגעי כרומטין ארוכי טווח בין האתרים הגנומיים השונים באמצעות שילובים של פריימרים ספציפיים ללוקי (טבלה 2) ו-qPCR. באמצעות תוצאות אלה חושבו כמויות המכפלה ביחס לערכת פריימר בקרה (משוואה 2) וגרפים להשוואה (איור 4). נתונים אלה הצביעו על כך ש-8 מתוך 10 התגובות היו חיוביות מותנות לאינטראקציות ארוכות טווח.
תגובות ה-PCR הופעלו אז על ג'ל אגרוז. מוצר ה-PCR הצפוי עבור שמונת החיוביים המותנים ותגובה שלילית אחת טוהר בג'ל ונשלח לריצוף סנגר. התוצאות עבור תגובות חיוביות מייצגות (חץ כחול, תיבה כחולה) ושליליות (חץ אדום, תיבה אדומה) מוצגות (איור 5).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65213/65213fig01.jpg"> איור 1: מבנה הכרומוזומים בגרעין. ארגון כרומוזומים היפותטי בתוך הגרעין. (א) מעטפת גרעינית, קווים שחורים; (ב) למינה גרעינית, כתומה; (C) הטרוכרומטין, קווים דחוסים; (D) אוכרומטין, לולאות רופפות. <a href="https://www.jove.com/files/ftp_upload/65213/65213fig01large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של איור זה.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65213/65213fig02.jpg"> איור 2: סכמה של פרוטוקול 3C. חלקים מרוחקים של כרומוזומים ליניאריים (כחול, צהוב וורוד) מתקרבים זה לזה בתוך הגרעין באמצעות לולאות רגולטוריות. (A) מבני הלולאה מתווכים על ידי גורמי שעתוק (עיגול אפור וכוכב שחור); אינטראקציות אלה נשמרות באמצעות הצלבה כימית. (B) הלולאות נשברות באמצעות עיכול אנזימטי (קווים שחורים). (C) חתיכות כרומטין מרוחקות קשורות זו לזו דרך הקצוות הדביקים שנוצרו על-ידי העיכול. (D) דנ"א מטוהר מחלבון. (E) הרצף בתוך המקטעים מזוהה וממופה חזרה לגנום. <a href="https://www.jove.com/files/ftp_upload/65213/65213fig02large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של איור זה.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65213/65213fig03.jpg"> איור 3: סכימת פריימר 3C. פריימרים 3C מתוכננים סביב אתרי הגבלה במרחקים משתנים מהמיקום הגנומי המעניין. החצים הוורודים מייצגים את ערכות הפריימר הניסיוניות המקיפות אתר DpnII. ניתן לערבב ולהתאים את הפריימרים הניסיוניים כדי להעריך את לולאת הכרומטין באזור. הפריימרים הכתומים מייצגים בקרה שלילית ללא אתר DpnII. <a href="https://www.jove.com/files/ftp_upload/65213/65213fig03large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של איור זה.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/65213/65213fig04.jpg"> איור 4: נתוני qPCR מייצגים עבור ניסוי 3C. שפע יחסי של ערכות פריימר מבחן 3C. (A) גרף בקרה המציג את השפע היחסי של המוצר בדגימת הבקרה הלא מעוכלת (כחול), בקרה מעוכלת (אפור) ודגימת 3C (כתום). (ב) ניסוי 3ג; השפע היחסי של המוצר משילובים של פריימרים לבדיקה בקבוצת הבקרה הלא מעוכלת (כחול), בקרה מעוכלת (אפור) ודגימת 3C (כתום). <a href="https://www.jove.com/files/ftp_upload/65213/65213fig04large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של איור זה.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/65213/65213fig05.jpg"> איור 5: הדמיה של מוצרי 3C qPCR. למעלה, ג'ל עם מוצרי נקודת הקצה qPCR עם הדגימות שצוינו. למטה, מייצג קבצי מעקב רצף Sanger עבור התגובות שצוינו. הדגימה הכתומה היא דוגמה לתוצאה חיובית כוזבת (ראו איור 4, r38/34), והמדגם הכחול הוא דוגמה לתוצאה חיובית אמיתית עם אתר DpnII המצוין מעל העקבות. <a href="https://www.jove.com/files/ftp_upload/65213/65213fig05large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של איור זה.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>אתר</td>
			<td>% עיכול</td>
		</tr><tr><td>₪100</td>
			<td>86.98</td>
		</tr><tr><td>₪3</td>
			<td>88.44</td>
		</tr><tr><td>₪100</td>
			<td>89.64</td>
		</tr><tr><td>₪83</td>
			<td>87.55</td>
		</tr><tr><td>₪83</td>
			<td>87.85</td>
		</tr><tr><td>₪33</td>
			<td>86.97</td>
		</tr><tr><td>₪103</td>
			<td>89.45</td>
		</tr></tbody></table>טבלה 1: יעילות עיכול מחושבת.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>שם</td>
			<td colspan="3">רצף</td>
			<td>אתרים גנומיים</td>
		</tr><tr><td>r3 FWD</td>
			<td colspan="3">ACGCAAGTAAAATTCTGGTTTTTGACC</td>
			<td>chrX:11361475</td>
		</tr><tr><td>r3 RVS</td>
			<td colspan="3">TTTCCTGAGCTCTAACCATGTTTGC</td>
			<td>chrX:11361561</td>
		</tr><tr><td>R38 FWD</td>
			<td colspan="3">TTACTTCTGAAGTAATCTTTTCTTATCCCC</td>
			<td>chrX:5859700</td>
		</tr><tr><td>R38 RVS</td>
			<td colspan="3">AGACGAGCTGATTAAAAGTAGTTGAGAG</td>
			<td>chrX:5859775</td>
		</tr><tr><td>R34 FWD</td>
			<td colspan="3">ATTTGTGGATTGCGTGGAGACG</td>
			<td>chrX:5429702</td>
		</tr><tr><td>R34 RVS</td>
			<td colspan="3">AATAATCCTCTTAACAAACGTGGCC</td>
			<td>chrX:5429777</td>
		</tr><tr><td>R33 FWD</td>
			<td colspan="3">AAGAGTTGTCCAAAATAAATTGAGCTAAC</td>
			<td>chrX:6296704</td>
		</tr><tr><td>R33 RVS</td>
			<td colspan="3">TTCAGAAAAGTAAACTTTGACTTGGAACG</td>
			<td>chrX:6296807</td>
		</tr><tr><td>r14 FWD</td>
			<td colspan="3">AATTATCGATTTTTCCATCGCGCAG</td>
			<td>chrX:8036367</td>
		</tr><tr><td>R14 RVS</td>
			<td colspan="3">ATTTCAATGAAAATGTAAAAATGTTCTCTC</td>
			<td>chrX:8036427</td>
		</tr><tr><td>R47 FWD</td>
			<td colspan="3">ATCTAGACTTGATAATATTTGTGTGTCCTC</td>
			<td>chrX:9464939</td>
		</tr><tr><td>R47 RVS</td>
			<td colspan="3">AAGTTCTGCAACTGTTAGATGAATAACAC</td>
			<td>chrX:9465064</td>
		</tr><tr><td>r8 FWD</td>
			<td colspan="3">GAGAATGTTGTGTGTAACTGAAAACTTG</td>
			<td>chrX:11094257</td>
		</tr><tr><td>r8 RVS</td>
			<td colspan="3">TTACGAAATTTGGTTTTTTGGACC</td>
			<td>chrX:11094362</td>
		</tr><tr><td>פריימר בקרה FWD</td>
			<td colspan="3">CAATCGTCTCGCTCACTTGTC</td>
			<td>chrX:7608049</td>
		</tr><tr><td>בקרת פריימר RVS</td>
			<td colspan="3">GATGTGAGCAACAAGGCACC</td>
			<td>chrX:7608166</td>
		</tr></tbody></table>טבלה 2: פריימרים לניסוי 3C מייצג.

Watch this Scientific Journal Video about Getting an A with the 3Cs: Chromosome Conformation Capture for Undergraduates at JoVE.com

כאן אנו מציגים בפירוט התאמה של טכניקת לכידת קונפורמציית הכרומוזומים (3C) עם דגש על מעורבות ולמידה לתואר ראשון.

Chromosome conformation capture (3C) is a powerful tool that has spawned a family of similar techniques (e.g., Hi-C, 4C, and 5C, referred to here as 3C ...

מטרת המחקר שלנו היא לחשוף כיצד ארגון הכרומטין שולט בביטוי גנים. ההתמקדות היא בקביעת הגורמים המווסתים את הכרומטין ברמת הגן כדי לשלוט בפעילות הגנים. כיום, טכנולוגיות דומות ללכידת אישור כרומוזומים, או 3C, משמשות כדי להתקדם בתחום זה.השקעות בטכנולוגיות איסוף וריצוף דגימות דחפו אותנו למה שטכניקות 3C יכולות להראות לנו. האתגר הניסיוני הגדול ביותר כיום הוא איסוף דגימות בעלות ארכיטקטורת כרומטין אחידה. הטרוגניות בדגימות מובילה לתוצאות מבלבלות.בעתיד, נתמקד באופן שבו שינויים בארגון הכרומטין משחקים תפקיד בסרטן.

getting-an-with-3cs-chromosome-conformation-capture-for

Research

JoVE Journal

Genetics

Getting an A with the 3Cs: Chromosome Conformation Capture for Undergraduates

2.1K Views.  Bryant University. מטרת המחקר שלנו היא לחשוף כיצד ארגון הכרומטין שולט בביטוי גנים. ההתמקדות היא בקביעת הגורמים המווסתים את הכרומטין ברמת הגן כדי לשלוט בפעילות הגנים. כיום, טכנולוגיות דומות ללכידת אישור כרומוזומים, או 3C, משמשות כדי להתקדם בתחום זה.השקעות בטכנולוגיות איסוף וריצוף דגימות ד?...

Video: מחבר זרקור: מקבל A עם 3Cs: לכידת קונפורמציה כרומוזומים עבור סטודנטים לתואר ראשון  

Chromosome conformation capture (3C) is a powerful tool that has spawned a family of similar techniques (e.g., Hi-C, 4C, and 5C, referred to here as 3C techniques) that provide detailed information of the three-dimensional organization of chromatin. The 3C techniques have been used in a wide range of studies, from monitoring the changes in chromatin organization in cancer cells to identifying enhancer contacts made with gene promoters. While many of the studies using these techniques are asking big genome-wide questions with intricate sample types (i.e., single-cell analysis), what is often lost is that the 3C techniques are grounded in basic molecular biology methods that are applicable to a broad range of studies. By addressing tightly focused questions of chromatin organization, this cutting-edge technique can be used to enhance the undergraduate research and teaching lab experience. This paper presents a 3C protocol and provides adaptations and points of emphasis for implementation at primarily undergraduate institutions in undergraduate research and teaching experiences.

Here, we present an adaption of the chromosome conformation capture (3C) technique in detail with an emphasis on undergraduate involvement and learning.

Generation and Purification of Chromosome Conformation Capture (3C) Library

On day one after chromatin cross-linking and nuclei collection from 5, 000 young adult Caenorhabditis Elegans worms, transfer the nuclei pellet re-suspended in 450 microliters of clean water to a clean 1.5 milliliter micro centrifuge tube. Then add 60 microliters of 10X DPN2 restriction enzyme buffer to it and mix well. Incubate the samples with 15 microliters of 10%sodium dodecyl sulfate at 37 degrees Celsius for one hour with agitation.Quench the reaction by adding 75 microliters of 20%triton X 100 and incubating as demonstrated previously. Aliquot 10 microliters from the sample, as the undigested control, and store it at four degrees Celsius. After adding 400 units of DPN 2 to the rest of the sample, incubate it overnight at 37 degrees Celsius with agitation for chromatin digestion.On day two, add an additional 200 units of DPN 2 to the sample. To complete the digestion of the cross-linked sample, incubate it at 37 degrees Celsius with agitation for four hours. Heat inactivate the restriction enzyme by incubating the sample for 20 minutes at 65 degrees Celsius.If the enzyme cannot be inactivated by heat, add 80 microliters of 10%sodium dodecyl sulfate and incubate. Then, add 375 microliters of 20%Triton X 100 to the sample and mix by swirling. Keep aside a 10 microliter aliquot from the sample as the digestion control.For chromatin ligation, transfer the sample to a clean 50 milliliter conical tube. Adjust the sample volume to 5.7 milliliters with molecular grade water and mix by swirling. Then, add 700 microliters of 10 X T4 ligase buffer, followed by 60 units of T4 DNA ligase, and incubate the sample overnight at 16 degrees Celsius.On day three, proceed with protein digestion and reverse cross-linking. Add 30 microliters of 10 milligrams per milliliter Proteinase K to the 3C sample and incubate at 65 degrees Celsius overnight with agitation. To begin purification of the 3C library on day four, add 30 microliters of 10 milligrams per milliliter RNase A to the sample and mix by swirling.After incubation, add seven milliliters of phenyl chloroform to the samples and mix by shaking. Centrifuge the sample for 15 minutes at 3, 270 G and room temperature. Collect and transfer the aqueous phase to a clean 50 milliliter conical tube.Add equal volumes of chloroform and mix the sample by shaking. After centrifuging the sample again as demonstrated, transfer the aqueous phase to another clean 50 milliliter conical tube. Add 7.5 milliliters of molecular grade water, 35 milliliters of 100%ethanol and seven microliters of one milligram per milliliter Glycogen.Freeze the properly mixed sample at minus 80 degrees Celsius. While the sample freezes, begin purifying the control samples by adjusting the volume of the controls to 500 microliters using molecular grade water. Add two microliters of 10 milligrams per milliliter RNase A and mix by flicking the tube.Next, add one milliliter of phenyl chloroform to the tubes containing the controls and mix by shaking. Centrifuge the tubes. After transferring the aqueous phase to a clean 1.5 milliliter micro centrifuge tube, add equal volumes of chloroform.Centrifuge as previously demonstrated before collecting the aqueous phase. To the collected aqueous phase, add one milliliter of ethanol and two microliters of one milligram per milliliter glycogen. After mixing the sample by shaking, incubate it at minus 80 degrees Celsius for 30 minutes.Next, centrifuge the sample for 15 minutes at 3, 270 G at four degrees Celsius. After removing the supernatant, add 750 microliters of chilled 70%ethanol and centrifuge. Re-suspend the air dried pellet in 50 microliters of molecular grade water.The suspension can be frozen here if not proceeding further immediately. To continue with the 3C sample purification, remove the sample from the freezer and centrifuge at 3, 270 G for 30 minutes. Add 10 milliliters of chilled 70%ethanol and break up the DNA pellet.After centrifuging and removing the supernatant, partially air dry the sample at room temperature. Re suspend the pellet in 150 microliters of 10 millimolar tris HCL at pH 7.5 by pipetting up and down to obtain the purified 3C library. QPCR performed on the one experimental and two control 3C samples helped generate the digestion efficiency data.The 3C sample had an approximately 88%digestion efficiency across the seven genomic loci tested.

יצירה וטיהור של ספריית לכידת קונפורמציה של כרומוזומים (3C)

Identification of the Chromosome Conformation Capture (3C) Products

Take the chromosome confirmation capture or 3C sample and controls, and perform QPCR. Excise the product bands corresponding to the expected fragment size. To perform gel extraction of the PCR products, use a commercial kit or follow the homemade protocol.For the latter, construct a homemade purification cartridge by poking a hole in the bottom of a 0.5 milliliter tube with a needle. Pack a small amount of cotton into the bottom of the tube with the hole, filling no more than half of the tube. Place the tube into a 1.5 milliliter tube, ensuring that the smaller tube rests on the lip of the bigger tube, and not in the tube.Carefully cut the gel fragment into smaller pieces, and place it in the small tube of the cartridge. Place the assembly in a minus 20 degrees Celsius freezer for five minutes. Then, spin the assembly for three minutes at 13, 000 G and room temperature.Discard the small tube containing the agoros debris, and keep the 1.5 milliliter tube with the extracted DNA in the buffer. The samples were tested for the presence of long range chromatin contacts between the different genomic loci, using combinations of loci-specific primers and QPCR. The product abundance is relative to a control primer set were calculated and graft for comparison.The data indicated that 8 of the 10 reactions were conditional positives. Gel purification and sequencing of the expected PCR product for the eight conditional positives and one negative reaction were gel purified and sequenced. The results for representative positive and negative reactions are shown.