המחברים רוצים להודות לצוות מתקן הטיפול בבעלי חיים NINDS על תמיכתם. עבודה זו נתמכה על ידי האגף למחקר אינטרמורלי של NIH, NINDS (דוח שנתי מספר 1ZIANS003129). התוכן הוא באחריותם הבלעדית של המחברים ואינו מייצג בהכרח את הדעות הרשמיות של המכונים הלאומיים לבריאות.

טיפולים מבוססי AAV באמצעות הזרקה תוך ורידית במודלים פרה-קליניים של עכברים

<ol>
	<li>Tisdale, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+ideas+initiative:+Pilot+study+to+assess+the+impact+of+rare+diseases+on+patients+and+healthcare+systems.">The ideas initiative: Pilot study to assess the impact of rare diseases on patients and healthcare systems.</a> Orphanet J Rare Dis. 16 (1), 429 (2021).</li><li>Condo, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rare+monogenic+diseases:+Molecular+pathophysiology+and+novel+therapies.">Rare monogenic diseases: Molecular pathophysiology and novel therapies.</a> Int J Mol Sci. 23 (12), 6525 (2022).</li><li>Vaisitti, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+frequency+of+rare+and+monogenic+diseases+in+pediatric+organ+transplant+recipients+in+italy.">The frequency of rare and monogenic diseases in pediatric organ transplant recipients in italy.</a> Orphanet J Rare Dis. 16 (1), 374 (2021).</li><li>Bulcha, J. T., Wang, Y., Ma, H., Tai, P. W. L., Gao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+vector+platforms+within+the+gene+therapy+landscape.">Viral vector platforms within the gene therapy landscape.</a> Signal Transduct Target Ther. 6 (1), 53 (2021).</li><li>Lundstrom, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+vectors+in+gene+therapy:+Where+do+we+stand+in+2023.">Viral vectors in gene therapy: Where do we stand in 2023.</a> Viruses. 15 (3), 698 (2023).</li><li>Wang, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+non-viral+vectors+for+gene+delivery.">Emerging non-viral vectors for gene delivery.</a> J Nanobiotechnology. 21 (1), 272 (2023).</li><li>Naso, M. F., Tomkowicz, B., Perry, W. L., Strohl, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adeno-associated+virus+(aav)+as+a+vector+for+gene+therapy.">Adeno-associated virus (aav) as a vector for gene therapy.</a> BioDrugs. 31 (4), 317-334 (2017).</li><li>Ghosh, S., Brown, A. M., Jenkins, C., Campbell, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+vector+systems+for+gene+therapy:+A+comprehensive+literature+review+of+progress+and+biosafety+challenges.">Viral vector systems for gene therapy: A comprehensive literature review of progress and biosafety challenges.</a> Appl Biosaf. 25 (1), 7-18 (2020).</li><li>Wang, D., Tai, P. W. L., Gao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adeno-associated+virus+vector+as+a+platform+for+gene+therapy+delivery.">Adeno-associated virus vector as a platform for gene therapy delivery.</a> Nat Rev Drug Discov. 18 (5), 358-378 (2019).</li><li>Srivastava, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rationale+and+strategies+for+the+development+of+safe+and+effective+optimized+aav+vectors+for+human+gene+therapy.">Rationale and strategies for the development of safe and effective optimized aav vectors for human gene therapy.</a> Mol Ther Nucleic Acids. 32, 949-959 (2023).</li><li>Mukherjee, P., Roy, S., Ghosh, D., Nandi, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+animal+models+in+biomedical+research:+A+review.">Role of animal models in biomedical research: A review.</a> Lab Anim Res. 38 (1), 18 (2022).</li><li>Jucker, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+benefits+and+limitations+of+animal+models+for+translational+research+in+neurodegenerative+diseases.">The benefits and limitations of animal models for translational research in neurodegenerative diseases.</a> Nat Med. 16 (11), 1210-1214 (2010).</li><li>Vandamme, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+rodents+as+models+of+human+diseases.">Use of rodents as models of human diseases.</a> J Pharm Bioallied Sci. 6 (1), 2-9 (2014).</li><li>Anders, H. J., Vielhauer, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identifying+and+validating+novel+targets+with+in+vivo+disease+models:+Guidelines+for+study+design.">Identifying and validating novel targets with in vivo disease models: Guidelines for study design.</a> Drug Discov Today. 12 (11-12), 446-451 (2007).</li><li>Turner, P. V., Brabb, T., Pekow, C., Vasbinder, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Administration+of+substances+to+laboratory+animals:+Routes+of+administration+and+factors+to+consider.">Administration of substances to laboratory animals: Routes of administration and factors to consider.</a> J Am Assoc Lab Anim Sci. 50 (5), 600-613 (2011).</li><li>Prabhakar, S., Lule, S., Da Hora, C. C., Breakefield, X. O., Cheah, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aav9+transduction+mediated+by+systemic+delivery+of+vector+via+retro-orbital+injection+in+newborn,+neonatal+and+juvenile+mice.">Aav9 transduction mediated by systemic delivery of vector via retro-orbital injection in newborn, neonatal and juvenile mice.</a> Exp Anim. 70 (4), 450-458 (2021).</li><li>Hauff, P., Nebendahl, K., Kiessling, F., Pichler, B. J., Hauff, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drug+administration.">Drug administration.</a> Small Animal Imaging: Basics and Practical. , 127-152 (2017).</li><li>Saleem, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+best+practice+for+validating+tail+vein+injections+in+rat+with+near-infrared-labeled+agents.">A new best practice for validating tail vein injections in rat with near-infrared-labeled agents.</a> J Vis Exp. (146), (2019).</li><li>Resch, M., Neels, T., Tichy, A., Palme, R., Rulicke, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+assessment+of+tail-vein+injection+in+mice+using+a+modified+anaesthesia+induction+chamber+versus+a+common+restrainer+without+anaesthesia.">Impact assessment of tail-vein injection in mice using a modified anaesthesia induction chamber versus a common restrainer without anaesthesia.</a> Lab Anim. 53 (2), 190-201 (2019).</li><li>Glascock, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+therapeutic+agents+through+intracerebroventricular+(icv)+and+intravenous+(iv)+injection+in+mice.">Delivery of therapeutic agents through intracerebroventricular (icv) and intravenous (iv) injection in mice.</a> J Vis Exp. (56), 2968 (2011).</li><li>Grames, M. S., Jackson, K. L., Dayton, R. D., Stanford, J. A., Klein, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+and+tips+for+intravenous+administration+of+adeno-associated+virus+to+rats+and+evaluation+of+central+nervous+system+transduction.">Methods and tips for intravenous administration of adeno-associated virus to rats and evaluation of central nervous system transduction.</a> J Vis Exp. (126), 55994 (2017).</li><li>Yano, J., Lilly, E. A., Noverr, M. C., Fidel, P. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+contemporary+warming/restraining+device+for+efficient+tail+vein+injections+in+a+murine+fungal+sepsis+model.">A contemporary warming/restraining device for efficient tail vein injections in a murine fungal sepsis model.</a> J Vis Exp. (165), 61961 (2020).</li><li>Warren, J. S. A., Feustel, P. J., Lamar, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combined+use+of+tail+vein+metastasis+assays+and+real-time+in+vivo+imaging+to+quantify+breast+cancer+metastatic+colonization+and+burden+in+the+lungs.">Combined use of tail vein metastasis assays and real-time in vivo imaging to quantify breast cancer metastatic colonization and burden in the lungs.</a> J Vis Exp. (154), 60687 (2019).</li><li>JoVE Science Education Database. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Lab Animal Research. Compound administration I. , (2023).</li><li>UCSF Office of Research, Institutional Animal Care and Use Program. Lateral tail vein injection in mice and rats (preferred technique for vascular access in mice Available from: <a target="_blank" href="https://iacuc.ucsf.edu/sites/g/files/tkssra751/f/wysiwyg/STD%20PROCEDURE%20-%20Misc%20Rodent%20Procedures%20-%20Lateral%20Tail%20Vein%20Injection%20in%20Mice%20and%20Rats.pdf">https://iacuc.ucsf.edu/sites/g/files/tkssra751/f/wysiwyg/STD%20PROCEDURE%20-%20Misc%20Rodent%20Procedures%20-%20Lateral%20Tail%20Vein%20Injection%20in%20Mice%20and%20Rats.pdf</a> (2023)</li><li>Jones, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tail+vein+injections+in+the+mouse+and+rat+sop.">Tail vein injections in the mouse and rat sop.</a> UBC Animal Care Guidelines SOP: ACC-2012-Tech03. , (2012).</li><li>Liadaki, K., Luth, E. S., Kunkell, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Co-detection+of+gfp+and+dystrophin+in+skeletal+muscle+tissue+sections.">Co-detection of gfp and dystrophin in skeletal muscle tissue sections.</a> Biotechniques. 42 (6), 699-700 (2007).</li><li>Burr, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allometric-like+scaling+of+aav+gene+therapy+for+systemic+protein+delivery.">Allometric-like scaling of aav gene therapy for systemic protein delivery.</a> Mol Ther Methods Clin Dev. 27, 368-379 (2022).</li><li>Lang, J. F., Toulmin, S. A., Brida, K. L., Eisenlohr, L. C., Davidson, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Standard+screening+methods+underreport+aav-mediated+transduction+and+gene+editing.">Standard screening methods underreport aav-mediated transduction and gene editing.</a> Nat Commun. 10 (1), 3415 (2019).</li><li>Rodriguez-Estevez, L., Asokan, P., Borras, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transduction+optimization+of+aav+vectors+for+human+gene+therapy+of+glaucoma+and+their+reversed+cell+entry+characteristics.">Transduction optimization of aav vectors for human gene therapy of glaucoma and their reversed cell entry characteristics.</a> Gene Ther. 27 (3-4), 127-142 (2020).</li><li>Hatakeyama, S., Yamamoto, H., Ohyama, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+formation+assays.">Tumor formation assays.</a> Methods Enzymol. 479, 397-411 (2010).</li></ol>

למחברים אין גילויים רלוונטיים לעבודה שפורסמה במאמר זה.

טיפולים מבוססי AAV טומנים בחובם פוטנציאל גדול להפרעות מונוגניות בשל הרבגוניות של AAV כווקטור ריפוי גנטי, המאפשר להתאים אישית AAVs כדי לענות על צרכי המסירה השונים של הפרעות שונות 4,5,7,9. AAVs ניתנים בדרך כלל באמצעות הזרקת IV במודלים פרה-קליניים של עכברים כדי לבדוק את הבטיחות והיעילות של טיפולים פוטנציאליים16. מכיוון שמינונים שונים של AAV מוזרקים יכולים לגרום להבדלים ניכרים בתוצאות הניסוי, זה קריטי עבור הנסיינים להיות מסוגלים להזריק באופן עקבי את מינון ה- AAV המיועד כדי להבטיח את התוקף והחוסן של נתוני ה- in vivo שנוצרו28. זריקות IV נמצאות בשימוש נרחב, אך הן מאתגרות מבחינה טכנית ודורשות הכשרה מקיפה ותרגול מתמשך כדי לפתח ולשמור על רמת מיומנות המבטיחה זריקות מוצלחות באופן עקבי 16,17,18,19. בנוסף להזרקה נכונה של AAV, בדרך כלל רצוי להשתמש בבדיקות כדי להעריך את יעילות ההפצה הביולוגית והאספקה של AAV המוזרק לרקמות היעד או לתאים29,30.
פרוטוקול זה נועד לסייע לנסיינים לבצע בקלות זריקות IV בהצלחה ובעקביות על ידי תיאור יסודי של הפרטים של פרוטוקול הזרקת IV אופטימלי למתן AAV בעכברים בני 7-9 שבועות, ללא הרדמה. חשוב לציין כי עכברים קטנים או גדולים משמעותית מעכברי בר בטווח הגילאים המשמש כאן עשויים להוות אתגר גדול יותר בשל ראות מופחתת של הוורידים או חוסר התאמה עם המעצורים המשמשים בשיטה זו. בעבר דווח כי זריקות IV זנב אינן מתאימות למתן ריאגנטים תוך ורידי בעכברים מתחת לגיל 6 שבועות בשל גודל כלי הדם הקטן31. למרות שניתן, ייתכן שיהיה קשה להזריק באופן עקבי עכברים במשקל של פחות מ-22.0 גרם בהצלחה. חוקרים המשתמשים בעכברים בגודל לא טיפוסי עשויים להזדקק לבצע התאמות להליך. פרוטוקול זה גם מתאר מספר בדיקות שניתן להשתמש בהן כדי להעריך את יעילות ההפצה הביולוגית והטרנסדוקציה של AAV.
יש לזכור כמה נקודות קריטיות בעת ביצוע פרוטוקול זה. במהלך ההזרקה, מחטי 29 G מספקות התנגדות גדולה יותר אם המחט אינה בתוך הווריד. פעולה זו מפחיתה את הנפח שאבד מהזרקה פריווסקולרית בשוגג של התמיסה במהלך ניסיונות הזרקה כושלים. מזרקי אינסולין הם בעלי נפחים מתים קטנים יותר מאשר מזרקים רגילים. אם משתמשים במזרק ו/או מחט שונים מאלה המפורטים כאן, ייתכן שיהיה צורך להכין נפח הזרקה נוסף בשלבי פרוטוקול 1.1.3.3 כדי לקחת בחשבון נפח שטח מת גדול יותר (למשל, להוסיף 30 μL למינון המיועד במקום 15 μL).
אם נוצרות בועות אוויר עדינות הנובעות משאיפה בדפנות המזרק תוך כדי שאיפת מנת AAV לתוך המזרק, משכו לאט את ההזרקה הלאה במעלה המזרק. פעולה זו תסיר את רוב בועות האוויר הקטנות. טען לפחות 10-15 μL נוספים של AAV לנפח המיועד להזרקה. נפח נוסף זה אמור לקחת בחשבון כל נפח שעלול ללכת לאיבוד במהלך סילוק בועות אוויר או ניסיונות הזרקה כושלים פוטנציאליים. (למשל, אם נפח היעד להזרקה הוא 150 μL, טען 165 μL לתוך המזרק (באמצע הדרך בין 160 μL ו 170 μL סימנים על סולם מזרק). אם המחט ממוקמת כראוי בתוך הווריד, והנפח במזרק הוא ב 165 μL מיד לפני ניסיון ההזרקה המוצלח, לספק את מגיב עד 15 μL נשארים מזרק (באמצע הדרך בין 10 μL ו 20 μL סימנים), ובכך לספק 150 μL (165 μL - 150 μL = 15 μL)). יישור לומן משופע (משופע הפונה כלפי מעלה) עם סולם המזרק מאפשר מעקב אחר הנפח המועבר במהלך ההזרקה.
חלק מהנסיינים יעדיפו למקם את העכבר על צדו כך שאחד הוורידים שלו יהיה ישר ונגיש בקלות בהשוואה לעכבר על רגליו. עם זאת, זנב העכבר על צדו יהיה משופע בזוויות שונות בהתאם לגודל העכבר הדורש התאמת זווית הזרקה בעת הזרקת עכברים בגדלים שונים. הדבר עלול להשפיע לרעה על עקביות הצלחת ההליך. במהלך ניסיונות תרגול ראשוניים, הנסיינים יכולים לנסות את שני כיווני ריסון העכבר כדי לקבוע את הגישה המועדפת עליהם. עמידת העכבר על רגליו מאפשרת גישה מהירה וקלה לשני ורידי הזנב הרוחביים. זה מקטין את זמן הריסון כאשר יש צורך בגישה לשני הוורידים במקרה של ניסיונות הזרקה כושלים מרובים.
אם מזריקים את הווריד הצידי קרוב לבסיס הזנב (קרוב יותר לגוף העכבר) (במיוחד עבור עכברים במשקל >30 גרם), יש להתאים את זווית ההזרקה מהמקביל לווריד ל-5°-10° לווריד מכיוון שהוריד בבסיס הזנב מעט עמוק יותר מאשר הוא דיסטלי.
פרוטוקולי בדיקת העיכול והזיהום של RNase המפורטים כאן אומתו על דגימות DNA שבודדו מרקמות כבד קפואות טריות המכילות סך של 175-700 ננוגרם של חומצות גרעין ב-20 מיקרוליטר. פרוטוקול העיכול של RNase נבדק גם על דגימות DNA שבודדו מרקמות כבד קפואות טריות ותאים ממוינים ב-FACS כדי לאשר את נוכחות הגנום הווקטורי והגנום של העכבר לאחר עיכול RNase. התוצאות הודגמו באמצעות אלקטרופורזה של ג'ל אגרוז של הגברת PCR בנקודת הקצה של מגברי המטרה.
ביצוע המתודולוגיה המתוארת יכול להפחית את זמן האימון והתרגול הדרוש כדי לשלוט בזריקות IV ולגרום לשיעור הזרקות מוצלח גבוה יותר, אשר יחסוך ריאגנטים. פרוטוקול זה משתמש בכלים פשוטים ונפוצים ללא צורך בציוד מתקדם או הגדרות שייתכן שלא יהיו זמינות. יתר על כן, שלבי ההזרקה בעירוי המפורטים כאן יכולים להיות מיושמים על מגוון רחב של זריקות שיש לתת תוך ורידי, כגון אוליגונוקלאוטידים אנטיסנס (ASOs), עם השינויים המתאימים שבוצעו בשלבי הכנת ההזרקה בהתאם להזרקה.

הפרעות מונוגניות מהוות 80% מהמחלות הנדירות, אשר משפיעות באופן קולקטיבי על 300 מיליון אנשים ברחבי העולם 1,2. כיום אין טיפולים מרפאים מאושרים לרוב ההפרעות הנדירות המתישות הללו 1,2,3. עם זאת, הפרעות מונוגניות הן מועמדות אידיאליות לטיפולים גנטיים שיכולים להחליף, להשלים, לתקן או להשתיק גנים לא מתפקדים 4,5. כיום, וקטורים מרובים מפותחים ומשמשים להעברת טיפולים גנטיים לסוגי תאים ספציפיים 4,6. אחד מאותם וקטורים הוא וירוס הקשור לאדנו (AAV). AAV הוא נגיף פרוו לא פתוגני המשמש יותר ויותר כווקטור ריפוי גנטי7. בהשוואה לווקטורים נגיפיים אחרים, ל-AAV יש אימונוגניות נמוכה יותר, פוטנציאל נמוך יותר להשתלב בגנום המארח, ויכולת להתמיר ביעילות תאים מתחלקים ולא מתחלקים ברקמות שונות 7,8. בנוסף, פותחו גישות רבות כדי להנדס ולזהות AAVs עם מאפיינים רצויים כגון טרופיזם רקמות ספציפי או אימונוגניות מופחתת נוספת, אשר משפר מאוד את הרבגוניות של AAV כווקטור ויראלי עבור אינדיקציות שונות9. גורמים אלה הפכו את AAV לווקטור ריפוי גנטי שנחקר באופן נרחב והובילו לפיתוח טיפולים גנטיים מבוססי AAV10 שאושרו על ידי ה- FDA.
מודלים של עכברים משמשים בדרך כלל כדי לבחון טיפולים גנטיים פוטנציאליים in vivo ולהבין טוב יותר את הפתומנגנונים של הפרעות מונוגניות. הסיבה לכך היא שחזור הפתולוגיות של מודלים עכבריים של מצבים שונים, הדמיון של הגנום שלהם לגנום האנושי, והקלות היחסית של טיפול, תחזוקה ודור 11,12,13 של עכברים. בדיקת In vivo חשובה במיוחד כאשר חוקרים הפרעות המשפיעות על מערכות או אזורים מרובים בגוף, כגון ניוון שרירים. עבור הפרעות אלה, בדיקות חוץ גופיות עשויות שלא להספיק כדי להעריך באופן מקיף את הבטיחות, היעילות, הפרמקוקינטיקה והפרמקודינמיקה של טיפולים המיועדים להגיע לאזורי גוף שונים לאחר מתן מערכתי14.
ניתן להשתמש בנתיבי ניהול מערכתיים שונים כדי לספק תרופות. לכל מסלול יש יתרונות, חסרונות ומידת התאמה למודל החייתי ולתרופה הנחקרת15. הזרקה תוך ורידית (IV) לרוחב וריד הזנב היא דרך נפוצה להעברה מערכתית של AAV בעכברים16. הזרקות רוחביות לווריד הזנב מאפשרות ניהול מהיר וישיר של ההזרקה לזרם הדם של העכבר ומבטיחות זמינות ביולוגית גבוהה של התרופה במחזור הדם המערכתי17. הם גם דורשים כלים פשוטים יחסית וזמינים בדרך כלל כדי להתבצע. עם זאת, בעיקר בשל קוטר וריד הזנב הקטן והקושי באיתור הווריד, זריקות רוחביות של וריד הזנב הן מאתגרות מבחינה טכנית ודורשות רמה גבוהה של מיומנות ותרגול מתמיד כדי להימנע מניסיונות הזרקה כושלים או מתן מינון לא שלם 16,17,18,19. אלה יכולים לגרום לאובדן ריאגנטים יקרים או תוצאות לא מדויקות, במיוחד אם הזריקה הלא שלמה אינה מזוהה בעת ביצוע ההזרקה. הניסיון שלנו המסוכם כאן מבוסס על פרוטוקולים שדווחו במאמרים מתועדים היטב שהתאמנו לשימושנו, תוך אופטימיזציה של שלבים שונים של הליך הזרקת וריד הזנב הצידי כדי להבטיח זריקות מוצלחות באופן עקבי20,21,22,23,24,25,26,27.
במאמר זה, אנו מתארים פרוטוקול מפורט זה של הזרקת ורידי זנב לרוחב כדי לספק AAV לעכברים לא מורדמים בני 7-9 שבועות באמצעות כלים פשוטים וזמינים בדרך כלל. בנוסף, אנו מספקים את הפרוטוקולים לשיטות המשמשות להערכת אספקת AAV והפצה ביולוגית. פרוטוקולים אלה מכסים איסוף רקמות לאחר הזרקה, קיבוע רקמות, מיצוי DNA וגנום וקטורי של תגובת שרשרת פולימראז דיגיטלית (dPCR) לכימות גנום דיפלואידי (vg/dg). פרוטוקול הזרקת העירוי והמצביעים המסופקים כאן נועדו לשפר את הקלות של ביצוע מוצלח של הזרקות לרוחב ורידי הזנב. זה עשוי לעזור להפחית את הזמן הדרוש כדי לשלוט במיומנויות ההזרקה ובו זמנית לשפר את הדיוק והעקביות של הזרקות.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.22 &#181;m syringe filter</td>
			<td>Millipore</td>
			<td>SLGVM33RS</td>
			<td></td>
		</tr>
		<tr>
			<td>0.3 mL insulin syringes with 29G needle</td>
			<td>BD Biosciences</td>
			<td>324702</td>
			<td></td>
		</tr>
		<tr>
			<td>1.7 mL microcentrifuge&#160; tube</td>
			<td>Crystalgen</td>
			<td>23-2051</td>
			<td></td>
		</tr>
		<tr>
			<td>10 mL syringe</td>
			<td>BD Biosciences</td>
			<td>302995</td>
			<td></td>
		</tr>
		<tr>
			<td>100% EtOH</td>
			<td>The Warner Graham Company</td>
			<td>201096</td>
			<td></td>
		</tr>
		<tr>
			<td>10x phosphate-buffered saline (PBS)</td>
			<td>Corning</td>
			<td>46-013-CM</td>
			<td>Used to prepare 1x PBS for tissue fixation</td>
		</tr>
		<tr>
			<td>15 mL conical tube</td>
			<td>Corning</td>
			<td>430766</td>
			<td></td>
		</tr>
		<tr>
			<td>15 mL conical tube holder</td>
			<td>Multiple sources</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>190 proof ethyl alcohol</td>
			<td>The Warner Graham Company</td>
			<td>6810-01-113-7320</td>
			<td>Used to prepare 70% ethanol</td>
		</tr>
		<tr>
			<td>1x sterile PBS</td>
			<td>Gibco</td>
			<td>10010023</td>
			<td></td>
		</tr>
		<tr>
			<td>2 mL microcentrifuge tissue storage tubes</td>
			<td>Eppendorf</td>
			<td>022363344</td>
			<td></td>
		</tr>
		<tr>
			<td>4% paraformaldehyde (PFA)</td>
			<td>Electron Microscopy Sciences</td>
			<td>157-4</td>
			<td></td>
		</tr>
		<tr>
			<td>Adeno-associated virus (AAV)</td>
			<td>Charles River</td>
			<td>N/A</td>
			<td>Single-stranded DNA (ssDNA) AAV was packaged to deliver Cre recombinase as the transgene driven by CMV promoter</td>
		</tr>
		<tr>
			<td>Alcohol swab</td>
			<td>BD Biosciences</td>
			<td>326895</td>
			<td></td>
		</tr>
		<tr>
			<td>Bead lysis tube</td>
			<td>Next Advance</td>
			<td>GREENE5</td>
			<td></td>
		</tr>
		<tr>
			<td>BsuRI (HaeIII) restriction enzyme</td>
			<td>Thermo Fisher Scientific</td>
			<td>ER0151&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Bullet blender</td>
			<td>Next Advance</td>
			<td>BBX24B</td>
			<td></td>
		</tr>
		<tr>
			<td>Ai14-derived mice from JAX 007914 strain (genetic background: C57BL/6J)</td>
			<td>N/A</td>
			<td>N/A</td>
			<td>Mice containing Ai14 Cre-reporter allele were purchased from JAX (catalog number: 007914)</td>
		</tr>
		<tr>
			<td>Disposable absorbent pads</td>
			<td>Fisherbrand</td>
			<td>1420662</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissection forceps</td>
			<td>Fine Science Tools (F.S.T)</td>
			<td>11251-35</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissection scissors</td>
			<td>Fine Science Tools (F.S.T)</td>
			<td>14085-08</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA degradation reagent (DNAZap)</td>
			<td>Invitrogen</td>
			<td>AM9890</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA-Extraction RNase A</td>
			<td>Qiagen</td>
			<td>19101</td>
			<td>For RNA digestion during nucleic acid extraction</td>
		</tr>
		<tr>
			<td>DNase-free RNase for DNA cleanup</td>
			<td>&#160;F. Hoffmann-La Roche</td>
			<td>11119915001</td>
			<td>For RNA digestion after nucleic acid extraction</td>
		</tr>
		<tr>
			<td>dPCR Probe PCR Kit</td>
			<td>Qiagen</td>
			<td>250102</td>
			<td></td>
		</tr>
		<tr>
			<td>dPCR software&#160;</td>
			<td>Qiagen&#160;</td>
			<td>N/A&#160;</td>
			<td>QIAcuity Software Suite&#160;</td>
		</tr>
		<tr>
			<td>Elevated platform</td>
			<td>Multiple sources</td>
			<td>N/A</td>
			<td>An empty pipette tips box was used to elevate the mouse restrainer during tail warming up</td>
		</tr>
		<tr>
			<td>Fluorescence microscope</td>
			<td>Multiple sources</td>
			<td>N/A</td>
			<td>Model used here: Nikon Eclipse Ti</td>
		</tr>
		<tr>
			<td>Fluorescence microscope software&#160;</td>
			<td>Multiple sources&#160;</td>
			<td>N/A&#160;</td>
			<td>Software used here: NIS-Elements&#160;</td>
		</tr>
		<tr>
			<td>Gauze</td>
			<td>Covidien</td>
			<td>9022</td>
			<td></td>
		</tr>
		<tr>
			<td>Heat block</td>
			<td>Eppendorf</td>
			<td>Thermomixer 5350</td>
			<td></td>
		</tr>
		<tr>
			<td>High-speed centrifuge</td>
			<td>Eppendorf</td>
			<td>22620689</td>
			<td></td>
		</tr>
		<tr>
			<td>Metal container</td>
			<td>Vollrath</td>
			<td>80125</td>
			<td></td>
		</tr>
		<tr>
			<td>Methylbutane</td>
			<td>J.T. Baker</td>
			<td>Q223-08</td>
			<td></td>
		</tr>
		<tr>
			<td>Molecular grade water</td>
			<td>Quality Biological</td>
			<td>351-029-131</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse tube restrainer</td>
			<td>Braintree Scientific</td>
			<td>TV-RED-150-STD</td>
			<td></td>
		</tr>
		<tr>
			<td>Myfuge mini centrifuge</td>
			<td>Benchmark Scientific</td>
			<td>C1012</td>
			<td></td>
		</tr>
		<tr>
			<td>Polymerase chain reaction thermal cycler</td>
			<td>Bio-Rad Laboratories</td>
			<td>1851148</td>
			<td>Model: C1000 Touch</td>
		</tr>
		<tr>
			<td>Precision wipes</td>
			<td>Kimberly-Clark Professional</td>
			<td>7552</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Qiagen</td>
			<td>19131</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAcuity dPCR Nanoplate 26k 24-well</td>
			<td>Qiagen</td>
			<td>250001</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAcuity One dPCR system</td>
			<td>Qiagen</td>
			<td>911020</td>
			<td></td>
		</tr>
		<tr>
			<td>Qiagen DNeasy Blood &#38; Tissue Kit</td>
			<td>Qiagen</td>
			<td>69504</td>
			<td>Used for DNA extraction from tissues</td>
		</tr>
		<tr>
			<td>Qiagen QIAamp DNA Micro Kit</td>
			<td>Qiagen</td>
			<td>56304</td>
			<td>Used for cleanup of genomic DNA, and the isolation of DNA from small volumes of blood prtocotol was used for DNA extraction from FACS-sorted cells</td>
		</tr>
		<tr>
			<td>Rodent restrainer cone</td>
			<td>Braintree Scientific</td>
			<td>MDC-200</td>
			<td></td>
		</tr>
		<tr>
			<td>Scale</td>
			<td>Ohaus</td>
			<td>72212663</td>
			<td></td>
		</tr>
		<tr>
			<td>Styrofoam box</td>
			<td>Multiple sources</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>Sigma-Aldrich</td>
			<td>S9378-1kg</td>
			<td></td>
		</tr>
		<tr>
			<td>Surface cleaner and disinfectant</td>
			<td>Peroxigard</td>
			<td>29101&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Timer</td>
			<td>Multiple sources</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Transfer forceps</td>
			<td>Fine Science Tools (F.S.T)</td>
			<td>91113-10</td>
			<td></td>
		</tr>
		<tr>
			<td>Vortex</td>
			<td>Daigger &#38; Company</td>
			<td>22220A</td>
			<td>Model: Daigger Vortex Genie 2</td>
		</tr>
	</tbody>
</table>

consistent delivery of adeno-associated virus via lateral tail-vein injection in adult mice

הפרעות רבות משפיעות על איברים מרובים או מערבות אזורים שונים בגוף, ולכן קריטי לספק טיפולים באופן מערכתי כדי להתמקד בתאים הפגועים הממוקמים באתרים שונים. הזרקה תוך ורידית היא נתיב אספקה מערכתי נפוץ במחקרים פרה-קליניים המעריכים טיפולים המיועדים למתן בכל הגוף. בעכברים בוגרים, זה כרוך ניהול תוך ורידי של סוכן טיפולי לתוך ורידים זנב לרוחב של העכבר. כאשר שולטים בהן, זריקות ורידים בזנב הן בטוחות ומהירות, ודורשות רק כלים פשוטים וזמינים בדרך כלל. עם זאת, זריקות ורידים זנב הן מאתגרות מבחינה טכנית ודורשות הכשרה מקיפה ותרגול מתמשך כדי להבטיח את המסירה המדויקת של המינון המיועד.
כאן אנו מתארים פרוטוקול הזרקה מפורט, אופטימלי ורוחבי של ורידים בזנב שפיתחנו בהתבסס על הניסיון שלנו ועל המלצות שדווחו בעבר על ידי קבוצות אחרות. מלבד ריסוני עכברים ומזרקי אינסולין, פרוטוקול זה דורש רק ריאגנטים וציוד הזמינים ברוב המעבדות. מצאנו כי ביצוע פרוטוקול זה מביא להעברה מוצלחת באופן עקבי תוך ורידי של וירוס הקשור באדנו (AAV) לתוך ורידי הזנב של עכברים לא מורדמים בני 7-9 שבועות. בנוסף, אנו מתארים את הפרוטוקולים הממוטבים לזיהוי היסטולוגי של חלבוני כתב פלואורסצנטיים וגנום וקטורי לכימות גנום דיפלואידי (vg/dg) המשמשים להערכת התמרה והפצה ביולוגית של AAV. מטרת פרוטוקול זה היא לסייע לנסיינים לבצע בקלות זריקות ורידים בזנב בהצלחה ובעקביות, מה שיכול להפחית את זמן התרגול הדרוש כדי לשלוט בטכניקה.

Monogenic disorders make up 80% of rare diseases, which collectively affect 300 million individuals worldwide1,2. There are currently no approved curative therapies for the majority of these greatly debilitating rare disorders1,2,3. However, monogenic disorders are ideal candidates for gene therapies that can replace, supplement, correct, or silence dysfunctional genes4,5. Currently, multiple vectors are being developed and used to deliver gene therapies to specific cell types4,6. One of those vectors is adeno-associated virus (AAV). AAV is a non-pathogenic parvovirus that is increasingly being used as a gene therapy vector7. Compared to other viral vectors, AAV has lower immunogenicity, lower potential to integrate into the host genome, and the ability to efficiently transduce dividing and non-dividing cells in various tissues7,8. Additionally, multiple approaches have been developed to engineer and identify AAVs with desirable characteristics such as specific tissue tropism or further reduced immunogenicity, which greatly enhances AAV&#39;s versatility as a viral vector for different indications9. These factors have made AAV a widely investigated gene therapy vector and led to the development of multiple FDA-approved AAV-based gene therapies10.
Mouse models are commonly used to test potential gene therapies in vivo and better understand the pathomechanisms of monogenic disorders. This is due to the mouse models&#39; recapitulation of the pathologies of different conditions, their genome&#39;s similarity to the human genome, and the relative ease of mouse handling, maintenance, and generation11,12,13. In vivo testing is particularly important when studying disorders that affect multiple systems or regions of the body, such as muscular dystrophies. For these disorders, in vitro testing might not be sufficient to comprehensively assess the safety, efficacy, pharmacokinetics, and pharmacodynamics of therapeutics intended to reach different body regions after systemic administration14.
Various systemic administration routes can be used to deliver drugs. Each route has its advantages, drawbacks, and degree of compatibility with the animal model and drug being investigated15. Intravenous (IV) lateral tail-vein injection is a commonly used route for systemic delivery of AAV in mice16. Lateral tail-vein injections allow fast and direct administration of the injectate into the mouse bloodstream ensuring high drug bioavailability in systemic circulation17. They also require relatively simple and commonly available tools to be performed. However, mainly due to the small tail vein diameter and difficulty in locating the vein, lateral tail-vein injections are technically challenging and require a high degree of skill and constant practice to avoid failed injection attempts or incomplete dose delivery16,17,18,19. These can result in the loss of expensive reagents or inaccurate results, especially if the incomplete injection is not recognized while performing the injection. Our experience summarized here is based on protocols reported in well-documented articles that we have adapted for our use, optimizing various steps of the lateral tail-vein injection procedure to ensure consistently successful injections20,21,22,23,24,25,26,27.
Here, we describe this detailed optimized lateral tail-vein injection protocol to deliver AAV into unsedated 7-9-week-old mice using simple and commonly available tools. Additionally, we provide the protocols for methods used to assess AAV delivery and biodistribution. These protocols cover post injection tissue collection, tissue fixation, DNA extraction, and digital polymerase chain reaction (dPCR) vector genome per diploid genome (vg/dg) quantification. The IV injection protocol and pointers provided here aim to enhance the ease of successfully performing lateral tail-vein injections. This will potentially help reduce the time needed to master the injection skills while simultaneously improving the accuracy and consistency of injections.

מחבר זרקור: פיתוח טיפולים גנטיים לניוון שרירים והפרעות נוירומוסקולריות

אספקה עקבית של וירוס הקשור לאדנו באמצעות הזרקת וריד זנב לרוחב בעכברים בוגרים

We work on developing gene therapies for congenital and early onset muscular dystrophies and neuromuscular disorders. And to accomplish this, we use different gene therapy modalities to address the underlying genetic causes of those disorders. The continuous development of viral and non-viral gene therapy vectors has been very important to our field.As the new improved viral and non-viral gene therapy vectors allow safer and more efficient gene therapies to be developed, this in turn enhances the safety and reduces the time to get those therapies ready for the patients. In this protocol, we provide thorough and detailed optimized steps of performing mouse lateral tail vein injections, and the aim of this protocol is to assist experimenters in consistently performing the injection procedures successfully.

עכברים זכרים בני שבעה עד תשעה שבועות הוזרקו עם AAV באמצעות הזרקה צידית של וריד הזנב ב 1.5 × 1012 vg / עכבר שסופקו בנפח הזרקה של 150-200 μL. ה- ssDNA AAV המשמש כאן סיפק טרנסגן Cre recombinase המונע על ידי מקדם CMV. העכברים שהוזרקו היו הומוזיגוטיים לאלל Ai14 של כתב Cre. כאשר נחשפים ל-Cre recombinase, תאים המכילים אלל Ai14 מבטאים את החלבון הפלואורסצנטי tdTomato. מאחר שביטוי tdTomato נגרם על ידי רקומבינציה גנומית המושרה על ידי Cre, תאים המבטאים tdTomato מצביעים על תאים שהותמרו ישירות על ידי AAV או שהיו תאי צאצא של תאים מותמרים. הנתונים המוצגים כאן הם של עכברים שהוזרקו AAV9-CMV-Cre ב 1.5 × 1012 vg / עכבר נמסר ב 160 μL (5.8-5.9 × 1013 vg / kg). העכברים הוקרבו 28 יום לאחר ההזרקה, והרקמות נאספו כמתואר לעיל. כמה שרירי שלד ואונות כבד עוכלו, והתאים שלהם נאספו באמצעות FACS. כמה אונות כבד הוקפאו מיד באמצעות מתילבוטאן מראש למיצוי חומצות גרעין. כמה שרירי שלד ואונות כבד תוקנו-הוקפאו לצורך הדמיה היסטולוגית של tdTomato פלואורסצנטי. tdTomato התבטא באופן מפוזר ברחבי הכבד (איור 2A) והארבע ראשי (איור 2C), מה שמצביע על כך ש-AAV9 הגיע באופן נרחב לאזורים שונים בשתי הרקמות.
DNA שהופק מכבד קפוא טרי ותאים ממוינים FAC שימש לכימות vg/dg באמצעות dPCR. ניתן להשתמש בכימות Vg/dg כדי להעריך את עקביות ההזרקה ואת יעילות ההמרה של AAV במדגם המנותח. פיזור טיפות 1D מדגימת רקמת כבד טרייה קפואה ותאים ממוינים FAC שימשו כדי להבטיח את תקפות הבדיקה (איור 3A,C). תרשים הפיזור הראה נוכחות של מחיצות חיוביות ושליליות, הפרדה ברורה בין המחיצות החיוביות והשליליות המאפשרת קביעה מדויקת של סף הזיהוי, ונוכחות של טיפות בודדות בין המחיצות החיוביות והשליליות, מה שיכול להפחית את הדיוק של בדיקת dPCR. עמידה בכל הקריטריונים הללו הצביעה על כך שתוצאות בדיקת dPCR היו תקפות. מספר עותקי הגן Polr2a בכל דגימה כומת כדי לקבוע את מספר הגנומים הדיפלואידיים של עכברים (2 עותקי גן Polr2a/גנום דיפלואידי עכבר), ונעשה שימוש בפריימרים/בדיקה כנגד רצף הטרנסגנים Cre recombinase כדי לכמת את הגנום הנגיפי (עותק טרנסגני אחד/גנום נגיפי, טבלה 1). ערך vg/dg כומת עבור דגימת רקמת כבד טרייה קפואה ותאים ממוינים FACS, והראה נוכחות של 187.7 vg/dg ו-4.7 vg/dg בכל דגימה, בהתאמה (איור 3B,D). דגימות מעכברים שהוזרקו באמצעות PBS ובקרות שאינן מכילות חומצות גרעין שימשו כבקרות שליליות.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/66934/66934fig01.jpg"> איור 1: סקירה כללית של תחנת הזרקה תוך ורידית. (A) כלים הדרושים לביצוע הזרקה בעירוי. מוצג כאן הטיימר (1), (2) מרסן צינור עכבר, (3) לא חתוך ו (4) קונוסים מרסנים פלסטיים חתוכים, (5) ספוגית אלכוהול, (6) קופסת טיפים פיפטה ריקה המשמשת כפלטפורמה להרמת ריסון צינור העכבר, (7) רפידות סופגות חד פעמיות, (8) צינור חרוטי 15 מ"ל עם מים חמים, (9) מחזיק צינור 15 מ"ל, (10) גזה, ו (11) מזרק אינסולין. (B) העכבר ממוקם תחילה בתוך משנן הצינור. לאחר מכן, חרוט הריסון החתוך מוכנס כדי ליצור שרוול מרסן סביב העכבר, אם העכבר קטן מכדי להיות מרוסן על ידי משנן הצינור בלבד. ודא כי נשימתו של העכבר אינה מופרעת על ידי מרסנים. משנן הצינור ממוקם על גבי הפלטפורמה המוגבהת כדי לאפשר את מיקום זנב העכבר במים חמים. (C) מיקום זנב העכבר וזווית אחיזת המחט מיד לפני ביצוע ההזרקה. משוך לאחור את הזנב כך שהזנב נמתח, ואתר ההזרקה אופקי לחלוטין. המחט מקבילה לזנב ולווריד, והשיפוע פונה כלפי מעלה. <a href="https://www.jove.com/files/ftp_upload/66934/66934fig01large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של איור זה.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/66934/66934fig02.jpg"> איור 2: זיהוי חלבון פלואורסצנטי לאחר הזרקת IV. עכברים זכרים בני שבעה עד תשעה שבועות המכילים את האלל Ai14 של כתב Cre הוזרקו עם AAV9-CMV-Cre בעוצמה של 1.5 × 10,12 vg/mouse שנמסרו ב-160 μL (5.8-5.9 × 10,13 vg/kg) או PBS. תמונות פלואורסצנטיות מייצגות של עכבר (A) כבד או (C) חלקים ארבע ראשיים לאחר AAV9 מתן הזרקת Cre IV. (B) מקטעי כבד או (D) ארבע ראשי מעכברים שהזריקו PBS צולמו כדי לשמש כבקרות שליליות. הרקמות נאספו והוקפאו 28 יום לאחר הזרקת העירוי. לאחר חשיפה ל-Cre, חלבון tdTomato פלואורסצנטי מתבטא בתאים מותמרים ובתאי צאצאים של תאים מותמרים. חתכים בעובי 10 מיקרומטר צולמו בהגדלה של פי 10. פסי קנה מידה = 100 מיקרומטר. <a href="https://www.jove.com/files/ftp_upload/66934/66934fig02large.jpg" target="_blank">לחץ כאן כדי להציג גרסה גדולה יותר של איור זה.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/66934/66934fig03.jpg"> איור 3: כימות גנום וקטורי לכל גנום דיפלואידי (vg/dg). פיזור 1D של כימות גנום וקטורי dPCR ברקמת כבד (A) או (C) תאים ממוינים FACS שנאספו מעכברים שהוזרקו עם AAV9-CMV-Cre או PBS. תרשימי הפיזור מציגים את מחיצות dPCR החיוביות והשליליות, כמו גם את סף הזיהוי המצוין על ידי הקו האופקי על פני הדגימות. (B,D) כימות vg/dg לאחר כימות הגנום הדיפלואידי של העכבר והגנום הווקטורי ברקמת הכבד (B) או (D) דגימות תאים ממוינות FACS. התוצאות המוצגות כאן הן מעכבר מוזרק AAV9 יחיד ועכבר מוזרק PBS יחיד עם שכפול dPCR טכני עבור כל עכבר. קווי שגיאה מציינים רווח בר-סמך של 95% עבור כל דגימה. קיצורים: NTC= פקד שאינו תבנית; dPCR = PCR דיגיטלי; FACS = מיון תאים המופעלים על ידי פלואורסצנטיות. <a href="https://www.jove.com/files/ftp_upload/66934/66934fig03large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של איור זה.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>תחל</td>
			<td>רצף</td>
		</tr><tr><td>פריימר Cre קדימה</td>
			<td>CTGACGGTGGGAGAATGTTAAT</td>
		</tr><tr><td>פריימר הפוך Cre </td>
			<td>CATCGCTCGACCAGTTTAGTT</td>
		</tr><tr><td>בדיקת Cre </td>
			<td>/56-FAM/CGCAGGTGT/ZEN/AGAGAAGGCACTTAGC/3IABkFQ/</td>
		</tr><tr><td>פריימר קדמי Polr2a </td>
			<td>GACTCCTTCACTCACTGTCTTC</td>
		</tr><tr><td>פריימר הפוך Polr2a </td>
			<td>TCTTGCTAGGCAGTCCATTATC</td>
		</tr><tr><td>בדיקת Polr2a </td>
			<td>/5HEX/ACGAGATGC/ZEN/TGAAAGAGCCAAGGT/3IABkFQ/</td>
		</tr></tbody></table>טבלה 1: רצפים של פריימרים וגשושיות המשמשים לכימות vg/dg. פריימרים של Cre ובדיקה שימשו לכימות הגנום הווקטורי. פריימרים ובדיקה Polr2a שימשו לכימות הגנום הדיפלואידי של העכבר.

כאן אנו מפרטים פרוטוקול אופטימלי להזרקת וריד זנב רוחבי של עכבר לניהול מערכתי של וירוס הקשור לאדנו (AAV) בעכברים בוגרים. בנוסף, אנו מתארים פרוטוקולים של בדיקות נפוצות להערכת התמרה AAV.

Many disorders affect multiple organs or involve different regions of the body, so it is critical to deliver therapeutics systemically to target the ...

consistent-delivery-adeno-associated-virus-via-lateral-tail-vein

Research

JoVE Journal

Medicine

Consistent Delivery of Adeno-Associated Virus via Lateral Tail-Vein Injection in Adult Mice

548 Views.  National Institutes of Health. אנו עובדים על פיתוח טיפולים גנטיים לניוון שרירים מולד ומוקדם והפרעות נוירומוסקולריות. וכדי להשיג זאת, אנו משתמשים בשיטות שונות של ריפוי גנטי כדי לטפל בגורמים הגנטיים הבסיסיים של הפרעות אלה. ההתפתחות המתמשכת של וקטורי ריפוי גנטי נגיפיים ולא ויראליים היי?...

Video: מחבר זרקור: פיתוח טיפולים גנטיים לניוון שרירים והפרעות נוירומוסקולריות

Many disorders affect multiple organs or involve different regions of the body, so it is critical to deliver therapeutics systemically to target the affected cells located in different sites. Intravenous injection is a widely used systemic delivery route in preclinical studies that assess treatments intended for body-wide administration. In adult mice, it involves the intravenous administration of the therapeutic agent into the mouse&#39;s lateral tail veins. When mastered, tail-vein injections are safe and fast, and only require simple and commonly available tools. However, tail-vein injections are technically challenging and require extensive training and continuous practice to ensure the accurate delivery of the intended dose.
Here we describe a detailed, optimized, lateral tail-vein injection protocol that we have developed based on our experience and on recommendations that had been previously reported by other groups. Other than the mouse restrainers and insulin syringes, this protocol requires only reagents and equipment that are readily available in most labs. We found that following this protocol results in consistently successful intravenous delivery of adeno-associated virus (AAV) into the tail veins of unsedated 7-9 week-old mice. Additionally, we describe the optimized protocols for the histological detection of fluorescent reporter proteins and vector genome per diploid genome (vg/dg) quantification used to assess AAV transduction and biodistribution. The goal of this protocol is to aid experimenters in easily performing tail-vein injections successfully and consistently, which can reduce the practice time needed to master the technique.

Here we detail an optimized protocol for mouse lateral tail-vein injection to systemically administer adeno-associated virus (AAV) in adult mice. Additionally, we describe protocols of commonly used assays to assess AAV transduction.

Lateral Tail-Vein Injection for Systemic Therapeutic Delivery of Adeno-Associated Virus in Mice

To begin, insert the mouse tail into the restrainer tube's top opening. Slowly pull the mouse into the tube and place the plug ahead of the mouse to prevent it from escaping. To make a restraining sleeve for a smaller mouse, cut at the nose end of the cone to ensure the mouse's nose is not obstructed and it has enough room to breathe.Then cut the back of the cone similar to the length of the mouse. Place the mouse in the tube restrainer as previously described. While holding the mouse's tail, let the mouse walk into the cone.Slide the restrainer cone into the tube. Ensure that the mouse's tail is all the way out of the back of the tube, and the mouse has room to breathe inside the cone. Secure the tube plug immediately in front of the cone's nose opening.Fill the 15-milliliters conical tube with warm water. Place the tube restrainer with the mouse inside it on the elevated platform. Dip the restrained mouse's tail in warm water for at least one minute until the lateral veins are clearly dilated and visible.Place the uncapped adeno-associated virus, or AAV, containing 1.7 milliliters micro centrifuge tube in the tube rack. With the dominant hand, insert the needle vertically into the tube. Once the needle is inside the tube, hold the tube with the non-dominant hand.Then raise the tube and the syringe simultaneously to eye-level, while ensuring the needle does not touch the tube wall. Rest both arms on the table and slowly pull the dose into the syringe. Expel air bubbles from the syringe over a disposable absorbent pad.Hold the injectant for 40 seconds to warm it up. After ensuring tail veins are clearly visible, remove the tube restrainer from the elevated platform and place it directly on the table. Position the mouse in the restrainer with its feet downwards for easy handling of the tail.Quickly wipe the tail with gauze to dry it. Then wipe the tail with an alcohol swab, and again dry it with dry gauze. Rotate the tail approximately 90 degrees to the left or the right so that one of the two lateral veins is facing upwards.Locate a suitable injection site within the middle-third of the tail. Hold the tail with the non-dominant hand using the thumb and index finger immediately distal to the injection site. Fold the tail over the index finger so the injection site lies flat on the index finger.Then pull back on the tail to stretch it and the injection site is completely horizontal. Hold the syringe using the index and middle fingers of the dominant hand on either side of the syringe's barrel flange while keeping the thumb ready at the plunger. Rest both hands on the table and place the needle directly on and parallel to the tail and the vein with the bevel facing upwards.Now apply downward pressure on the needle and slide it forward into the vein to inject the AAV solution into the vein. After administering the dose, slowly withdraw the needle and immediately apply pressure with gauze at the injection site for at least 10 seconds until the bleeding stops. Histological imaging of fluorescent reporter protein post-injection showed that tdTomato was expressed diffusely throughout the liver and quadriceps indicating that AAV9 broadly reached and transduced different regions of both tissues.