저자는 NINDS 동물 보호 시설 직원들의 지원에 감사드립니다. 이 연구는 미국 국립보건원(NIH)의 교내 연구부(Division of Intramural Research, NINDS, 연례 보고서 번호 1ZIANS003129)의 지원을 받았습니다. 이 내용은 전적으로 저자의 책임이며 미국 국립보건원(National Institutes of Health)의 공식 견해를 반드시 나타내는 것은 아닙니다.

전임상 마우스 모델에서 정맥 주사를 통한 AAV 기반 요법

<ol>
	<li>Tisdale, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+ideas+initiative:+Pilot+study+to+assess+the+impact+of+rare+diseases+on+patients+and+healthcare+systems.">The ideas initiative: Pilot study to assess the impact of rare diseases on patients and healthcare systems.</a> Orphanet J Rare Dis. 16 (1), 429 (2021).</li><li>Condo, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rare+monogenic+diseases:+Molecular+pathophysiology+and+novel+therapies.">Rare monogenic diseases: Molecular pathophysiology and novel therapies.</a> Int J Mol Sci. 23 (12), 6525 (2022).</li><li>Vaisitti, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+frequency+of+rare+and+monogenic+diseases+in+pediatric+organ+transplant+recipients+in+italy.">The frequency of rare and monogenic diseases in pediatric organ transplant recipients in italy.</a> Orphanet J Rare Dis. 16 (1), 374 (2021).</li><li>Bulcha, J. T., Wang, Y., Ma, H., Tai, P. W. L., Gao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+vector+platforms+within+the+gene+therapy+landscape.">Viral vector platforms within the gene therapy landscape.</a> Signal Transduct Target Ther. 6 (1), 53 (2021).</li><li>Lundstrom, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+vectors+in+gene+therapy:+Where+do+we+stand+in+2023.">Viral vectors in gene therapy: Where do we stand in 2023.</a> Viruses. 15 (3), 698 (2023).</li><li>Wang, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+non-viral+vectors+for+gene+delivery.">Emerging non-viral vectors for gene delivery.</a> J Nanobiotechnology. 21 (1), 272 (2023).</li><li>Naso, M. F., Tomkowicz, B., Perry, W. L., Strohl, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adeno-associated+virus+(aav)+as+a+vector+for+gene+therapy.">Adeno-associated virus (aav) as a vector for gene therapy.</a> BioDrugs. 31 (4), 317-334 (2017).</li><li>Ghosh, S., Brown, A. M., Jenkins, C., Campbell, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+vector+systems+for+gene+therapy:+A+comprehensive+literature+review+of+progress+and+biosafety+challenges.">Viral vector systems for gene therapy: A comprehensive literature review of progress and biosafety challenges.</a> Appl Biosaf. 25 (1), 7-18 (2020).</li><li>Wang, D., Tai, P. W. L., Gao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adeno-associated+virus+vector+as+a+platform+for+gene+therapy+delivery.">Adeno-associated virus vector as a platform for gene therapy delivery.</a> Nat Rev Drug Discov. 18 (5), 358-378 (2019).</li><li>Srivastava, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rationale+and+strategies+for+the+development+of+safe+and+effective+optimized+aav+vectors+for+human+gene+therapy.">Rationale and strategies for the development of safe and effective optimized aav vectors for human gene therapy.</a> Mol Ther Nucleic Acids. 32, 949-959 (2023).</li><li>Mukherjee, P., Roy, S., Ghosh, D., Nandi, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+animal+models+in+biomedical+research:+A+review.">Role of animal models in biomedical research: A review.</a> Lab Anim Res. 38 (1), 18 (2022).</li><li>Jucker, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+benefits+and+limitations+of+animal+models+for+translational+research+in+neurodegenerative+diseases.">The benefits and limitations of animal models for translational research in neurodegenerative diseases.</a> Nat Med. 16 (11), 1210-1214 (2010).</li><li>Vandamme, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+rodents+as+models+of+human+diseases.">Use of rodents as models of human diseases.</a> J Pharm Bioallied Sci. 6 (1), 2-9 (2014).</li><li>Anders, H. J., Vielhauer, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identifying+and+validating+novel+targets+with+in+vivo+disease+models:+Guidelines+for+study+design.">Identifying and validating novel targets with in vivo disease models: Guidelines for study design.</a> Drug Discov Today. 12 (11-12), 446-451 (2007).</li><li>Turner, P. V., Brabb, T., Pekow, C., Vasbinder, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Administration+of+substances+to+laboratory+animals:+Routes+of+administration+and+factors+to+consider.">Administration of substances to laboratory animals: Routes of administration and factors to consider.</a> J Am Assoc Lab Anim Sci. 50 (5), 600-613 (2011).</li><li>Prabhakar, S., Lule, S., Da Hora, C. C., Breakefield, X. O., Cheah, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aav9+transduction+mediated+by+systemic+delivery+of+vector+via+retro-orbital+injection+in+newborn,+neonatal+and+juvenile+mice.">Aav9 transduction mediated by systemic delivery of vector via retro-orbital injection in newborn, neonatal and juvenile mice.</a> Exp Anim. 70 (4), 450-458 (2021).</li><li>Hauff, P., Nebendahl, K., Kiessling, F., Pichler, B. J., Hauff, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drug+administration.">Drug administration.</a> Small Animal Imaging: Basics and Practical. , 127-152 (2017).</li><li>Saleem, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+best+practice+for+validating+tail+vein+injections+in+rat+with+near-infrared-labeled+agents.">A new best practice for validating tail vein injections in rat with near-infrared-labeled agents.</a> J Vis Exp. (146), (2019).</li><li>Resch, M., Neels, T., Tichy, A., Palme, R., Rulicke, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+assessment+of+tail-vein+injection+in+mice+using+a+modified+anaesthesia+induction+chamber+versus+a+common+restrainer+without+anaesthesia.">Impact assessment of tail-vein injection in mice using a modified anaesthesia induction chamber versus a common restrainer without anaesthesia.</a> Lab Anim. 53 (2), 190-201 (2019).</li><li>Glascock, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+therapeutic+agents+through+intracerebroventricular+(icv)+and+intravenous+(iv)+injection+in+mice.">Delivery of therapeutic agents through intracerebroventricular (icv) and intravenous (iv) injection in mice.</a> J Vis Exp. (56), 2968 (2011).</li><li>Grames, M. S., Jackson, K. L., Dayton, R. D., Stanford, J. A., Klein, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+and+tips+for+intravenous+administration+of+adeno-associated+virus+to+rats+and+evaluation+of+central+nervous+system+transduction.">Methods and tips for intravenous administration of adeno-associated virus to rats and evaluation of central nervous system transduction.</a> J Vis Exp. (126), 55994 (2017).</li><li>Yano, J., Lilly, E. A., Noverr, M. C., Fidel, P. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+contemporary+warming/restraining+device+for+efficient+tail+vein+injections+in+a+murine+fungal+sepsis+model.">A contemporary warming/restraining device for efficient tail vein injections in a murine fungal sepsis model.</a> J Vis Exp. (165), 61961 (2020).</li><li>Warren, J. S. A., Feustel, P. J., Lamar, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combined+use+of+tail+vein+metastasis+assays+and+real-time+in+vivo+imaging+to+quantify+breast+cancer+metastatic+colonization+and+burden+in+the+lungs.">Combined use of tail vein metastasis assays and real-time in vivo imaging to quantify breast cancer metastatic colonization and burden in the lungs.</a> J Vis Exp. (154), 60687 (2019).</li><li>JoVE Science Education Database. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Lab Animal Research. Compound administration I. , (2023).</li><li>UCSF Office of Research, Institutional Animal Care and Use Program. Lateral tail vein injection in mice and rats (preferred technique for vascular access in mice Available from: <a target="_blank" href="https://iacuc.ucsf.edu/sites/g/files/tkssra751/f/wysiwyg/STD%20PROCEDURE%20-%20Misc%20Rodent%20Procedures%20-%20Lateral%20Tail%20Vein%20Injection%20in%20Mice%20and%20Rats.pdf">https://iacuc.ucsf.edu/sites/g/files/tkssra751/f/wysiwyg/STD%20PROCEDURE%20-%20Misc%20Rodent%20Procedures%20-%20Lateral%20Tail%20Vein%20Injection%20in%20Mice%20and%20Rats.pdf</a> (2023)</li><li>Jones, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tail+vein+injections+in+the+mouse+and+rat+sop.">Tail vein injections in the mouse and rat sop.</a> UBC Animal Care Guidelines SOP: ACC-2012-Tech03. , (2012).</li><li>Liadaki, K., Luth, E. S., Kunkell, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Co-detection+of+gfp+and+dystrophin+in+skeletal+muscle+tissue+sections.">Co-detection of gfp and dystrophin in skeletal muscle tissue sections.</a> Biotechniques. 42 (6), 699-700 (2007).</li><li>Burr, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allometric-like+scaling+of+aav+gene+therapy+for+systemic+protein+delivery.">Allometric-like scaling of aav gene therapy for systemic protein delivery.</a> Mol Ther Methods Clin Dev. 27, 368-379 (2022).</li><li>Lang, J. F., Toulmin, S. A., Brida, K. L., Eisenlohr, L. C., Davidson, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Standard+screening+methods+underreport+aav-mediated+transduction+and+gene+editing.">Standard screening methods underreport aav-mediated transduction and gene editing.</a> Nat Commun. 10 (1), 3415 (2019).</li><li>Rodriguez-Estevez, L., Asokan, P., Borras, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transduction+optimization+of+aav+vectors+for+human+gene+therapy+of+glaucoma+and+their+reversed+cell+entry+characteristics.">Transduction optimization of aav vectors for human gene therapy of glaucoma and their reversed cell entry characteristics.</a> Gene Ther. 27 (3-4), 127-142 (2020).</li><li>Hatakeyama, S., Yamamoto, H., Ohyama, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+formation+assays.">Tumor formation assays.</a> Methods Enzymol. 479, 397-411 (2010).</li></ol>

저자는 이 기사에 게시된 작업과 관련된 공개를 가지고 있지 않습니다.

AAV 기반 치료법은 유전자 치료 벡터로서 AAV의 다양성으로 인해 단일 유전자 장애에 대한 큰 잠재력을 가지고 있으며, 이를 통해 다양한 질환의 다양한 전달 요구를 충족시키기 위해 AAV를 맞춤화할 수 있습니다 4,5,7,9. AAV는 일반적으로 잠재적 치료제의 안전성과 효능을 테스트하기 위해 전임상 마우스 모델에서 IV 주입을 통해 투여됩니다16. 상이한 주입된 AAV 투여량은 실험 결과에서 현저한 차이를 초래할 수 있으므로, 실험자가 생성된 생체 내 데이터의 타당성 및 견고성을 보장하기 위해 의도된 AAV 투여량을 일관되게 주입할 수 있는 것이 중요하다28. IV 주사는 널리 사용되지만, 기술적으로 까다롭기 때문에 지속적으로 성공적인 주사를 보장하는 기술 수준을 개발하고 유지하기 위해 광범위한 교육과 지속적인 연습이 필요하다 16,17,18,19. AAV를 정확하게 주입하는 것 외에도, 주입된 AAV의 생체 분포 및 표적 조직 또는 세포에 대한 전달 효율을 평가하기 위해 분석을 사용하는 것이 일반적으로 바람직하다(29,30).
이 프로토콜은 7-9주 된 진정되지 않은 마우스에서 AAV를 투여하기 위해 최적화된 IV 주입 프로토콜의 세부 사항을 철저히 설명함으로써 실험자가 IV 주입을 성공적이고 일관되게 쉽게 수행할 수 있도록 돕는 것을 목표로 합니다. 여기에 사용된 연령 범위에서 야생형 마우스보다 현저하게 작거나 큰 마우스는 정맥의 가시성이 감소하거나 이 방법에 사용된 억제제와의 비호환성으로 인해 더 큰 도전을 제시할 수 있다는 점에 유의하는 것이 중요합니다. tail IV 주사는 혈관 크기가31인 작은 때문에 생후 6주 미만의 마우스에서 시약을 정맥 투여하는 데 적합하지 않다는 것이 이전에 보고된 바 있습니다. 가능하기는 하지만, 체중이 22.0g 미만인 마우스를 성공적으로 주입하는 것은 어려울 수 있습니다. 비정형 크기의 마우스를 사용하는 조사자는 절차에 적응해야 할 수 있습니다. 또한 이 프로토콜은 AAV 생체내 분포 및 transduction 효율성을 평가하는 데 사용할 수 있는 여러 분석법을 간략하게 설명합니다.
이 프로토콜을 따르는 동안 몇 가지 중요한 점을 염두에 두어야 합니다. 주입하는 동안 29G 바늘은 바늘이 정맥 내부에 있지 않은 경우 더 큰 저항을 제공합니다. 이는 실패한 주입 시도 동안 우발적인 용액의 혈관 주위 주입으로 손실되는 부피를 줄입니다. 인슐린 주사기는 일반 주사기보다 사체량이 작습니다. 여기에 나열된 것과 다른 주사기 및/또는 바늘을 사용하는 경우 더 큰 데드 스페이스 부피를 설명하기 위해 프로토콜 단계 1.1.3.3에서 추가 주입 부피를 준비해야 할 수 있습니다(예: 의도한 용량에 15μL 대신 30μL 추가).
AAV 투여량을 주사기로 흡입하는 동안 주사기 측면에 미세한 흡인으로 인한 기포가 형성되면 주사기를 주사기 위로 천천히 당겨 넣습니다. 이렇게 하면 대부분의 작은 기포가 제거됩니다. 주입할 의도된 부피에 최소 10-15μL의 AAV를 추가로 로드합니다. 이 추가 부피는 기포를 배출하거나 잠재적인 주입 시도 실패 중에 손실될 수 있는 부피를 설명하기 위한 것입니다. (예: 주입할 목표 부피가 150μL인 경우 주사기에 165μL를 로드합니다(주사기 스케일에서 160μL와 170μL 표시 사이의 중간). 바늘이 정맥 내부에 올바르게 배치되고 주사기의 부피가 성공적인 주입 시도 직전에 165μL인 경우 주사기에 15μL가 남을 때까지(10μL와 20μL 표시 사이의 중간) 시약을 전달하여 150μL(165μL - 150μL= 15μL)를 전달합니다. 베벨 루멘(베벨이 위쪽을 향함)을 주사기 스케일에 맞추면 주입 중에 전달된 부피를 추적할 수 있습니다.
일부 실험자는 발을 딛고 있는 쥐에 비해 정맥 중 하나가 직선이고 쉽게 접근할 수 있도록 쥐를 옆으로 눕히는 것을 선호할 수 있습니다. 그러나 옆으로 눕힌 마우스의 꼬리는 마우스 크기에 따라 다른 각도로 기울어지기 때문에 크기가 다른 마우스를 주입할 때 주입 각도 조정이 필요합니다. 이는 절차의 성공 일관성에 부정적인 영향을 미칠 수 있습니다. 초기 연습 시도 중에 실험자는 선호하는 접근 방식을 결정하기 위해 두 가지 마우스 구속 방향을 모두 시도할 수 있습니다. 마우스를 발에 딛고 있으면 양쪽 꼬리 정맥에 빠르고 쉽게 접근할 수 있습니다. 이렇게 하면 주사 시도가 여러 번 실패한 경우 두 정맥에 대한 접근이 필요한 구속 시간을 줄일 수 있습니다.
측면 정맥을 꼬리 기저부에 가까운(마우스 몸에 더 가까운) 주입하는 경우(특히 체중이 >30g인 마우스의 경우) 꼬리 기저부의 정맥이 원위보다 약간 깊기 때문에 정맥과 평행한 곳에서 정맥에 대해 5°-10°로 주입 각도를 조정합니다.
여기에 나열된 RNase 분해 및 RNA 오염 검사 프로토콜은 20 μL에 총 175-700 ng의 핵산을 함유한 신선 냉동 간 조직에서 분리한 DNA 샘플에서 검증되었습니다. RNase 분해 프로토콜은 또한 RNase 분해 후 벡터 게놈과 마우스 게놈의 존재를 확인하기 위해 신선 냉동 간 조직과 FACS 분류 세포에서 분리한 DNA 샘플에 대해 테스트되었습니다. 결과는 타겟 앰플리콘의 종말점 PCR 증폭의 아가로스 겔 전기영동을 사용하여 시각화되었습니다.
설명된 방법론을 따르면 IV 주입을 마스터하는 데 필요한 교육 및 연습 시간을 줄이고 주입 성공률을 높여 시약을 절약할 수 있습니다. 이 프로토콜은 쉽게 사용할 수 없는 고급 장비나 설정 없이 간단하고 일반적으로 사용되는 도구를 사용합니다. 또한, 여기에 나열된 IV 주입 단계는 안티센스 올리고뉴클레오티드(ASO)와 같이 정맥 주사가 필요한 광범위한 주사제에 적용할 수 있으며, 주사제에 따라 주사제 준비 단계를 적절하게 수정하여 적용할 수 있습니다.

단일 유전자 질환은 희귀 질환의 80%를 차지하며, 전 세계적으로 3억 명이 앓고 있습니다 1,2. 현재 이러한 크게 쇠약해지는 희귀 질환의 대다수에 대해 승인된 치료법은 없습니다 1,2,3. 그러나 단일 유전자 장애는 역기능 유전자를 대체, 보충, 교정 또는 침묵시킬 수 있는 유전자 치료의 이상적인 후보입니다 4,5. 현재 여러 벡터가 개발되어 특정 세포 유형에 유전자 치료를 전달하는 데 사용되고 있습니다 4,6. 이러한 벡터 중 하나는 아데노 관련 바이러스(AAV)입니다. AAV는 비병원성 파보바이러스(non-pathogenic parvovirus)로, 유전자 치료 벡터로 점점 더 많이 사용되고 있다7. 다른 바이러스 벡터와 비교했을 때, AAV는 면역원성이 낮고, 숙주 게놈에 통합될 가능성이 낮으며, 다양한 조직에서 분열 및 비분열 세포를 효율적으로 transduction할 수 있는 능력을 가지고 있습니다 7,8. 또한, 특정 조직 영양성 또는 더욱 감소된 면역원성과 같은 바람직한 특성을 가진 AAV를 엔지니어링하고 식별하기 위한 여러 접근법이 개발되었으며, 이는 다양한 적응증에 대한 바이러스 벡터로서 AAV의 다양성을 크게 향상시킵니다9. 이러한 요인들로 인해 AAV는 널리 연구되는 유전자 치료 벡터가 되었으며, FDA가 승인한 여러 AAV 기반 유전자 치료법의 개발로 이어졌습니다10.
마우스 모델은 일반적으로 생체 내에서 잠재적인 유전자 치료법을 테스트하고 단일 유전자 질환의 병리 메커니즘을 더 잘 이해하는 데 사용됩니다. 이는 마우스 모델이 다양한 조건의 병리학을 재현하고, 인간 게놈과 게놈의 유사성, 마우스 취급, 유지 관리 및 생성의 상대적 용이성 때문입니다 11,12,13. In vivo testing은 근육 이영양증과 같이 신체의 여러 시스템 또는 영역에 영향을 미치는 장애를 연구할 때 특히 중요합니다. 이러한 질환의 경우, 체외 검사는 전신 투여 후 다양한 신체 부위에 도달하도록 의도된 치료제의 안전성, 효능, 약동학 및 약력학을 종합적으로 평가하기에 충분하지 않을 수 있다14.
약물을 전달하기 위해 다양한 전신 투여 경로를 사용할 수 있습니다. 각 경로에는 장점, 단점, 연구 대상 동물모델 및 약물과의 호환성 정도가 있다15. 정맥 주사(IV) 측면 꼬리 정맥 주입은 마우스16에서 AAV의 전신 전달을 위해 일반적으로 사용되는 경로입니다. 측면 꼬리-정맥 주사는 주사액을 마우스 혈류에 빠르고 직접 투여할 수 있게 하여 전신 순환에서 높은 약물 생체이용률을 보장한다17. 또한 비교적 간단하고 일반적으로 사용 가능한 도구를 수행해야 합니다. 그러나 주로 꼬리 정맥 직경이 작고 정맥을 찾기 어렵기 때문에 외측 꼬리 정맥 주사는 기술적으로 까다롭고 주사 시도 실패 또는 불완전한 용량 전달을 피하기 위해 높은 수준의 기술과 지속적인 연습이 필요합니다 16,17,18,19. 이로 인해 값비싼 시약이 손실되거나 부정확한 결과가 발생할 수 있으며, 특히 주입을 수행하는 동안 불완전한 주입이 인식되지 않는 경우 더욱 그렇습니다. 여기에 요약된 우리의 경험은 우리의 사용에 맞게 조정한 잘 문서화된 기사에 보고된 프로토콜을 기반으로 하며, 일관되게 성공적인 주입을 보장하기 위해 측면 꼬리 정맥 주입 절차의 다양한 단계를 최적화합니다 20,21,22,23,24,25,26,27.
여기에서는 간단하고 일반적으로 사용 가능한 도구를 사용하여 진정되지 않은 7-9주 된 마우스에 AAV를 전달하기 위해 최적화된 측면 꼬리 정맥 주입 프로토콜에 대해 자세히 설명합니다. 또한, 당사는 AAV 전달 및 생체 분포를 평가하는 데 사용되는 방법에 대한 프로토콜을 제공합니다. 이러한 프로토콜은 주입 후 조직 수집, 조직 고정, DNA 추출 및 이배체 게놈(vg/dg)당 디지털 중합효소 연쇄 반응(dPCR) 벡터 게놈을 다룹니다. 여기에 제공된 IV 주입 프로토콜 및 지침은 측면 꼬리 정맥 주입을 성공적으로 수행하는 용이성을 향상시키는 것을 목표로 합니다. 이는 주입 기술을 습득하는 데 필요한 시간을 줄이는 동시에 주입의 정확성과 일관성을 향상시키는 데 잠재적으로 도움이 될 것입니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.22 &#181;m syringe filter</td>
			<td>Millipore</td>
			<td>SLGVM33RS</td>
			<td></td>
		</tr>
		<tr>
			<td>0.3 mL insulin syringes with 29G needle</td>
			<td>BD Biosciences</td>
			<td>324702</td>
			<td></td>
		</tr>
		<tr>
			<td>1.7 mL microcentrifuge&#160; tube</td>
			<td>Crystalgen</td>
			<td>23-2051</td>
			<td></td>
		</tr>
		<tr>
			<td>10 mL syringe</td>
			<td>BD Biosciences</td>
			<td>302995</td>
			<td></td>
		</tr>
		<tr>
			<td>100% EtOH</td>
			<td>The Warner Graham Company</td>
			<td>201096</td>
			<td></td>
		</tr>
		<tr>
			<td>10x phosphate-buffered saline (PBS)</td>
			<td>Corning</td>
			<td>46-013-CM</td>
			<td>Used to prepare 1x PBS for tissue fixation</td>
		</tr>
		<tr>
			<td>15 mL conical tube</td>
			<td>Corning</td>
			<td>430766</td>
			<td></td>
		</tr>
		<tr>
			<td>15 mL conical tube holder</td>
			<td>Multiple sources</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>190 proof ethyl alcohol</td>
			<td>The Warner Graham Company</td>
			<td>6810-01-113-7320</td>
			<td>Used to prepare 70% ethanol</td>
		</tr>
		<tr>
			<td>1x sterile PBS</td>
			<td>Gibco</td>
			<td>10010023</td>
			<td></td>
		</tr>
		<tr>
			<td>2 mL microcentrifuge tissue storage tubes</td>
			<td>Eppendorf</td>
			<td>022363344</td>
			<td></td>
		</tr>
		<tr>
			<td>4% paraformaldehyde (PFA)</td>
			<td>Electron Microscopy Sciences</td>
			<td>157-4</td>
			<td></td>
		</tr>
		<tr>
			<td>Adeno-associated virus (AAV)</td>
			<td>Charles River</td>
			<td>N/A</td>
			<td>Single-stranded DNA (ssDNA) AAV was packaged to deliver Cre recombinase as the transgene driven by CMV promoter</td>
		</tr>
		<tr>
			<td>Alcohol swab</td>
			<td>BD Biosciences</td>
			<td>326895</td>
			<td></td>
		</tr>
		<tr>
			<td>Bead lysis tube</td>
			<td>Next Advance</td>
			<td>GREENE5</td>
			<td></td>
		</tr>
		<tr>
			<td>BsuRI (HaeIII) restriction enzyme</td>
			<td>Thermo Fisher Scientific</td>
			<td>ER0151&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Bullet blender</td>
			<td>Next Advance</td>
			<td>BBX24B</td>
			<td></td>
		</tr>
		<tr>
			<td>Ai14-derived mice from JAX 007914 strain (genetic background: C57BL/6J)</td>
			<td>N/A</td>
			<td>N/A</td>
			<td>Mice containing Ai14 Cre-reporter allele were purchased from JAX (catalog number: 007914)</td>
		</tr>
		<tr>
			<td>Disposable absorbent pads</td>
			<td>Fisherbrand</td>
			<td>1420662</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissection forceps</td>
			<td>Fine Science Tools (F.S.T)</td>
			<td>11251-35</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissection scissors</td>
			<td>Fine Science Tools (F.S.T)</td>
			<td>14085-08</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA degradation reagent (DNAZap)</td>
			<td>Invitrogen</td>
			<td>AM9890</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA-Extraction RNase A</td>
			<td>Qiagen</td>
			<td>19101</td>
			<td>For RNA digestion during nucleic acid extraction</td>
		</tr>
		<tr>
			<td>DNase-free RNase for DNA cleanup</td>
			<td>&#160;F. Hoffmann-La Roche</td>
			<td>11119915001</td>
			<td>For RNA digestion after nucleic acid extraction</td>
		</tr>
		<tr>
			<td>dPCR Probe PCR Kit</td>
			<td>Qiagen</td>
			<td>250102</td>
			<td></td>
		</tr>
		<tr>
			<td>dPCR software&#160;</td>
			<td>Qiagen&#160;</td>
			<td>N/A&#160;</td>
			<td>QIAcuity Software Suite&#160;</td>
		</tr>
		<tr>
			<td>Elevated platform</td>
			<td>Multiple sources</td>
			<td>N/A</td>
			<td>An empty pipette tips box was used to elevate the mouse restrainer during tail warming up</td>
		</tr>
		<tr>
			<td>Fluorescence microscope</td>
			<td>Multiple sources</td>
			<td>N/A</td>
			<td>Model used here: Nikon Eclipse Ti</td>
		</tr>
		<tr>
			<td>Fluorescence microscope software&#160;</td>
			<td>Multiple sources&#160;</td>
			<td>N/A&#160;</td>
			<td>Software used here: NIS-Elements&#160;</td>
		</tr>
		<tr>
			<td>Gauze</td>
			<td>Covidien</td>
			<td>9022</td>
			<td></td>
		</tr>
		<tr>
			<td>Heat block</td>
			<td>Eppendorf</td>
			<td>Thermomixer 5350</td>
			<td></td>
		</tr>
		<tr>
			<td>High-speed centrifuge</td>
			<td>Eppendorf</td>
			<td>22620689</td>
			<td></td>
		</tr>
		<tr>
			<td>Metal container</td>
			<td>Vollrath</td>
			<td>80125</td>
			<td></td>
		</tr>
		<tr>
			<td>Methylbutane</td>
			<td>J.T. Baker</td>
			<td>Q223-08</td>
			<td></td>
		</tr>
		<tr>
			<td>Molecular grade water</td>
			<td>Quality Biological</td>
			<td>351-029-131</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse tube restrainer</td>
			<td>Braintree Scientific</td>
			<td>TV-RED-150-STD</td>
			<td></td>
		</tr>
		<tr>
			<td>Myfuge mini centrifuge</td>
			<td>Benchmark Scientific</td>
			<td>C1012</td>
			<td></td>
		</tr>
		<tr>
			<td>Polymerase chain reaction thermal cycler</td>
			<td>Bio-Rad Laboratories</td>
			<td>1851148</td>
			<td>Model: C1000 Touch</td>
		</tr>
		<tr>
			<td>Precision wipes</td>
			<td>Kimberly-Clark Professional</td>
			<td>7552</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Qiagen</td>
			<td>19131</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAcuity dPCR Nanoplate 26k 24-well</td>
			<td>Qiagen</td>
			<td>250001</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAcuity One dPCR system</td>
			<td>Qiagen</td>
			<td>911020</td>
			<td></td>
		</tr>
		<tr>
			<td>Qiagen DNeasy Blood &#38; Tissue Kit</td>
			<td>Qiagen</td>
			<td>69504</td>
			<td>Used for DNA extraction from tissues</td>
		</tr>
		<tr>
			<td>Qiagen QIAamp DNA Micro Kit</td>
			<td>Qiagen</td>
			<td>56304</td>
			<td>Used for cleanup of genomic DNA, and the isolation of DNA from small volumes of blood prtocotol was used for DNA extraction from FACS-sorted cells</td>
		</tr>
		<tr>
			<td>Rodent restrainer cone</td>
			<td>Braintree Scientific</td>
			<td>MDC-200</td>
			<td></td>
		</tr>
		<tr>
			<td>Scale</td>
			<td>Ohaus</td>
			<td>72212663</td>
			<td></td>
		</tr>
		<tr>
			<td>Styrofoam box</td>
			<td>Multiple sources</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>Sigma-Aldrich</td>
			<td>S9378-1kg</td>
			<td></td>
		</tr>
		<tr>
			<td>Surface cleaner and disinfectant</td>
			<td>Peroxigard</td>
			<td>29101&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Timer</td>
			<td>Multiple sources</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Transfer forceps</td>
			<td>Fine Science Tools (F.S.T)</td>
			<td>91113-10</td>
			<td></td>
		</tr>
		<tr>
			<td>Vortex</td>
			<td>Daigger &#38; Company</td>
			<td>22220A</td>
			<td>Model: Daigger Vortex Genie 2</td>
		</tr>
	</tbody>
</table>

consistent delivery of adeno-associated virus via lateral tail-vein injection in adult mice

많은 질환이 여러 장기에 영향을 미치거나 신체의 다른 부위를 침범하기 때문에 서로 다른 부위에 위치한 영향을 받은 세포를 표적으로 하기 위해 전신적으로 치료제를 제공하는 것이 중요합니다. 정맥 주사는 전신 투여를 목적으로 하는 치료법을 평가하는 전임상 연구에서 널리 사용되는 전신 전달 경로입니다. 성체 마우스의 경우, 치료제를 마우스의 측면 꼬리 정맥에 정맥 투여하는 것을 포함합니다. 숙달되면 꼬리 정맥 주사는 안전하고 빠르며 간단하고 일반적으로 사용 가능한 도구만 있으면 됩니다. 그러나 꼬리 정맥 주사는 기술적으로 까다로우며 의도한 용량의 정확한 전달을 보장하기 위해 광범위한 교육과 지속적인 연습이 필요합니다.
여기에서 우리는 우리의 경험과 이전에 다른 그룹에서 보고한 권장 사항을 기반으로 개발한 상세하고 최적화된 측면 꼬리 정맥 주사 프로토콜에 대해 설명합니다. 마우스 억제 장치와 인슐린 주사기를 제외하고 이 프로토콜에는 대부분의 실험실에서 쉽게 구할 수 있는 시약과 장비만 필요합니다. 우리는 이 프로토콜을 따르면 진정되지 않은 7-9주 된 마우스의 꼬리 정맥으로 아데노 관련 바이러스(AAV)가 일관되게 성공적으로 전달된다는 것을 발견했습니다. 또한 AAV transduction 및 biodistribution을 평가하는 데 사용되는 이배체 게놈(vg/dg)당 벡터 게놈 및 형광 리포터 단백질의 조직학적 검출을 위한 최적화된 프로토콜에 대해 설명합니다. 이 프로토콜의 목표는 실험자가 꼬리 정맥 주입을 성공적이고 일관되게 쉽게 수행할 수 있도록 도와 기술을 마스터하는 데 필요한 연습 시간을 줄일 수 있도록 돕는 것입니다.

Monogenic disorders make up 80% of rare diseases, which collectively affect 300 million individuals worldwide1,2. There are currently no approved curative therapies for the majority of these greatly debilitating rare disorders1,2,3. However, monogenic disorders are ideal candidates for gene therapies that can replace, supplement, correct, or silence dysfunctional genes4,5. Currently, multiple vectors are being developed and used to deliver gene therapies to specific cell types4,6. One of those vectors is adeno-associated virus (AAV). AAV is a non-pathogenic parvovirus that is increasingly being used as a gene therapy vector7. Compared to other viral vectors, AAV has lower immunogenicity, lower potential to integrate into the host genome, and the ability to efficiently transduce dividing and non-dividing cells in various tissues7,8. Additionally, multiple approaches have been developed to engineer and identify AAVs with desirable characteristics such as specific tissue tropism or further reduced immunogenicity, which greatly enhances AAV&#39;s versatility as a viral vector for different indications9. These factors have made AAV a widely investigated gene therapy vector and led to the development of multiple FDA-approved AAV-based gene therapies10.
Mouse models are commonly used to test potential gene therapies in vivo and better understand the pathomechanisms of monogenic disorders. This is due to the mouse models&#39; recapitulation of the pathologies of different conditions, their genome&#39;s similarity to the human genome, and the relative ease of mouse handling, maintenance, and generation11,12,13. In vivo testing is particularly important when studying disorders that affect multiple systems or regions of the body, such as muscular dystrophies. For these disorders, in vitro testing might not be sufficient to comprehensively assess the safety, efficacy, pharmacokinetics, and pharmacodynamics of therapeutics intended to reach different body regions after systemic administration14.
Various systemic administration routes can be used to deliver drugs. Each route has its advantages, drawbacks, and degree of compatibility with the animal model and drug being investigated15. Intravenous (IV) lateral tail-vein injection is a commonly used route for systemic delivery of AAV in mice16. Lateral tail-vein injections allow fast and direct administration of the injectate into the mouse bloodstream ensuring high drug bioavailability in systemic circulation17. They also require relatively simple and commonly available tools to be performed. However, mainly due to the small tail vein diameter and difficulty in locating the vein, lateral tail-vein injections are technically challenging and require a high degree of skill and constant practice to avoid failed injection attempts or incomplete dose delivery16,17,18,19. These can result in the loss of expensive reagents or inaccurate results, especially if the incomplete injection is not recognized while performing the injection. Our experience summarized here is based on protocols reported in well-documented articles that we have adapted for our use, optimizing various steps of the lateral tail-vein injection procedure to ensure consistently successful injections20,21,22,23,24,25,26,27.
Here, we describe this detailed optimized lateral tail-vein injection protocol to deliver AAV into unsedated 7-9-week-old mice using simple and commonly available tools. Additionally, we provide the protocols for methods used to assess AAV delivery and biodistribution. These protocols cover post injection tissue collection, tissue fixation, DNA extraction, and digital polymerase chain reaction (dPCR) vector genome per diploid genome (vg/dg) quantification. The IV injection protocol and pointers provided here aim to enhance the ease of successfully performing lateral tail-vein injections. This will potentially help reduce the time needed to master the injection skills while simultaneously improving the accuracy and consistency of injections.

저자 스포트라이트: 근이영양증 및 신경근 질환에 대한 유전자 치료법 개발

성체 마우스에서 측면 꼬리 정맥 주입을 통한 아데노 관련 바이러스의 일관된 전달

We work on developing gene therapies for congenital and early onset muscular dystrophies and neuromuscular disorders. And to accomplish this, we use different gene therapy modalities to address the underlying genetic causes of those disorders. The continuous development of viral and non-viral gene therapy vectors has been very important to our field.As the new improved viral and non-viral gene therapy vectors allow safer and more efficient gene therapies to be developed, this in turn enhances the safety and reduces the time to get those therapies ready for the patients. In this protocol, we provide thorough and detailed optimized steps of performing mouse lateral tail vein injections, and the aim of this protocol is to assist experimenters in consistently performing the injection procedures successfully.

7-9주령의 수컷 마우스에 1.5 × 1012 vg/마우스에서 측면 꼬리 정맥 주입을 통해 AAV를 주입했습니다. 여기에 사용된 ssDNA AAV는 CMV 프로모터에 의해 구동되는 Cre 재조합효소 전이유전자를 전달하였다. 주입된 마우스는 Cre 리포터 Ai14 대립유전자에 대해 동형접합성이었습니다. Cre 재조합효소에 노출되면 Ai14 대립유전자 함유 세포가 형광 tdTomato 단백질을 발현합니다. tdTomato 발현은 Cre-유도 게놈 재조합에 의해 발생하기 때문에, tdTomato-발현 세포는 AAV에 의해 직접 transduction 되었거나 transducted cell의 자손 세포인 세포를 나타냅니다. 여기에 표시된 데이터는 1.5 × 1012 vg/mouse에서 AAV9-CMV-Cre를 주입한 마우스를 160 μL(5.8-5.9 × 1013 vg/kg)로 주입한 마우스의 데이터입니다. 마우스는 주입 후 28일 후에 희생하고, 조직을 상기한 바와 같이 수집하였다. 몇 개의 골격근과 간엽을 소화하고 FACS를 사용하여 세포를 수집했습니다. 핵산 추출을 위해 사전 냉각된 메틸부탄을 사용하여 몇 개의 간엽을 즉시 동결했습니다. 몇 개의 골격근과 간엽을 형광 tdTomato의 조직학적 이미징을 위해 고정 동결했습니다. tdTomato는 간(그림 2A)과 대퇴사두근(그림 2C) 전체에 걸쳐 확산적으로 발현되었으며, 이는 AAV9가 두 조직의 다른 영역에 광범위하게 도달하고 전달되었음을 나타냅니다.
신선 냉동 간 및 FACS 분류 세포에서 추출한 DNA를 사용하여 dPCR을 사용하여 vg/dg를 정량화했습니다. Vg/dg 정량화는 분석된 샘플에서 AAV의 주입 일관성과 transduction 효율성을 평가하는 데 사용할 수 있습니다. 신선 냉동 간 조직 샘플과 FACS 분류 세포의 1D 액적 산점도를 사용하여 분석의 유효성을 확인했습니다(그림 3A,C). 산점도는 양성 및 음극 분할의 존재, 검출 임계값을 정확하게 결정할 수 있는 양성 및 음극 분할 간의 명확한 분리, 양성 및 음극 분할 사이에 적적이 거의 없거나 적게 존재하여 dPCR 분석의 정확도를 감소시킬 수 있음을 보여주었습니다. 이러한 모든 기준을 충족하면 dPCR 분석 결과가 유효하다는 것을 나타냅니다. 각 샘플에서 Polr2a 유전자 카피의 수를 정량화하여 마우스 이배체 게놈의 수를 결정하고(2 Polr2a 유전자 카피/마우스 이배체 게놈), Cre recombinase 전이유전자 서열에 대한 프라이머/프로브를 사용하여 바이러스 게놈을 정량화하였다(1 transgene copy/viral genome, 표 1). 신선 냉동 간 조직 샘플과 FACS 분류 세포에 대해 vg/dg 값을 정량화하고 각 샘플에서 각각 187.7 vg/dg 및 4.7 vg/dg의 존재를 보여주었습니다(그림 3B, D). PBS 주입 마우스와 핵산을 함유하지 않은 비템플릿 대조군의 샘플을 음성 대조군으로 사용했습니다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/66934/66934fig01.jpg"> 그림 1: 정맥 주사 스테이션 개요. (A) IV 주입을 수행하는 데 필요한 도구. 여기에 표시된 것은 (1) 타이머, (2) 마우스 튜브 고정 장치, (3) 절단되지 않은 (4) 절단 플라스틱 고정 콘, (5) 알코올 면봉, (6) 마우스 튜브 고정 장치를 들어 올리는 플랫폼으로 사용되는 빈 피펫 팁 상자, (7) 일회용 흡수 패드, (8) 따뜻한 물이 담긴 15mL 원추형 튜브, (9) 15mL 튜브 홀더, (10) 거즈 및 (11) 인슐린 주사기입니다. (B) 마우스는 먼저 튜브 고정 장치 내부에 배치됩니다. 그런 다음, 마우스가 너무 작아서 튜브 고정 장치로만 구속할 수 없는 경우 절단 억제 원뿔을 삽입하여 마우스 주위에 구속 슬리브를 만듭니다. 마우스의 호흡이 구속기에 의해 방해받지 않는지 확인하십시오. 튜브 고정 장치는 따뜻한 물에 마우스 꼬리를 놓을 수 있도록 높은 플랫폼 위에 배치됩니다. (C) 주입을 수행하기 직전의 마우스 꼬리 위치 및 바늘 유지 각도. 꼬리를 뒤로 당겨 꼬리가 펴지고 주입 부위가 완전히 수평이 되도록 합니다. 바늘은 꼬리와 정맥과 평행하고 경사는 위쪽을 향합니다. <a href="https://www.jove.com/files/ftp_upload/66934/66934fig01large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/66934/66934fig02.jpg"> 그림 2: IV 주입 후 형광 리포터 단백질 검출. Cre 리포터 Ai14 대립유전자를 보유하고 있는 7-9주령 수컷 마우스에 1.5 × 1012 vg/mouse의 AAV9-CMV-Cre를 160 μL(5.8-5.9 ×10 13 vg/kg) 또는 PBS로 IV를 주입했습니다. Cre IV 주입을 전달하는 AAV9 이후의 마우스 (A) 간 또는 (C) 대퇴사두근 절편의 대표적인 형광 이미지. (B) PBS 주입 마우스의 간 또는 (D) 대퇴사두근 절편을 이미지화하여 음성 대조군으로 작용했습니다. 조직을 수집하여 IV 주입 후 28일 후에 고정-냉동했습니다. Cre 노출 후, 형광 tdTomato 단백질은 형질도입된 세포 및 형질도입된 세포의 자손 세포에서 발현됩니다. 10μm 두께의 단면을 10배 배율로 이미지화했습니다. 스케일 바 = 100 μm. <a href="https://www.jove.com/files/ftp_upload/66934/66934fig02large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/66934/66934fig03.jpg"> 그림 3: 이배체 게놈(vg/dg) 정량화에 따른 벡터 게놈. AAV9-CMV-Cre 또는 PBS가 주입된 마우스에서 수집된 (A) 간 조직 또는 (C) FACS 분류 세포에서 dPCR 벡터 게놈 정량화의 1D 산점도. 산점도는 양성 및 음수 dPCR 파티션과 샘플 전체의 수평선으로 표시된 검출 임계값을 보여줍니다. (B,D) (B) 간 조직 또는 (D) FACS 정렬 세포 샘플에서 마우스 이배체 게놈 및 벡터 게놈을 정량화한 후 vg/dg 정량화. 여기에 표시된 결과는 단일 AAV9 주입 마우스와 단일 PBS 주입 마우스에서 얻은 것이며 각 마우스에 대해 기술적 dPCR이 중복됩니다. 오차 막대는 각 표본에 대한 95% 신뢰 구간을 나타냅니다. 약어: NTC= Non-template control; dPCR = 디지털 PCR; FACS = 형광 활성화 세포 분류. <a href="https://www.jove.com/files/ftp_upload/66934/66934fig03large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>입문서</td>
			<td>순서</td>
		</tr><tr><td>Cre 포워드 프라이머</td>
			<td>CTGACGGTGGGAGAATGTTAAT</td>
		</tr><tr><td>Cre 리버스 프라이머</td>
			<td>CATCGCTCGACCAGTTTAGTT</td>
		</tr><tr><td>Cre 프로브</td>
			<td>/56-FAM/CGCAGGTGT/ZEN/AGAGAAGGCACTTAGC/3IABkFQ/</td>
		</tr><tr><td>Polr2a 포워드 프라이머</td>
			<td>GACTCCTTCACTCACTGTCTTC</td>
		</tr><tr><td>Polr2a 리버스 프라이머</td>
			<td>TCTTGCTAGGCAGTCCATTATC</td>
		</tr><tr><td>Polr2a 프로브</td>
			<td>/5HEX/ACGAGATGC/ZEN/TGAAAGAGCCAAGGT/3IABkFQ/</td>
		</tr></tbody></table>표 1: vg/dg 정량화에 사용되는 프라이머 및 프로브 시퀀스. Cre 프라이머와 프로브를 사용하여 벡터 게놈을 정량화했습니다. Polr2a 프라이머와 프로브를 사용하여 마우스 이배체 게놈을 정량화했습니다.

여기에서는 성체 마우스에서 아데노 관련 바이러스(AAV)를 체계적으로 투여하기 위해 마우스 측면 꼬리 정맥 주입에 최적화된 프로토콜에 대해 자세히 설명합니다. 또한 AAV transduction을 평가하기 위해 일반적으로 사용되는 분석 프로토콜에 대해 설명합니다.

Many disorders affect multiple organs or involve different regions of the body, so it is critical to deliver therapeutics systemically to target the ...

consistent-delivery-adeno-associated-virus-via-lateral-tail-vein

Research

JoVE Journal

Medicine

Consistent Delivery of Adeno-Associated Virus via Lateral Tail-Vein Injection in Adult Mice

569 조회수.  National Institutes of Health. 우리는 선천성 및 조기 발병 근이영양증 및 신경근 질환에 대한 유전자 치료법을 개발하기 위해 노력하고 있습니다. 그리고 이를 달성하기 위해 우리는 이러한 장애의 근본적인 유전적 원인을 해결하기 위해 다양한 유전자 치료 방식을 사용합니다. 바이러스 및 비바이러스 유전자 치료 벡터의 지속적인 개발은 우리 분야에 매우 중요합니다.새?...

비디오: 저자 스포트라이트: 근이영양증 및 신경근 질환에 대한 유전자 치료법 개발

Many disorders affect multiple organs or involve different regions of the body, so it is critical to deliver therapeutics systemically to target the affected cells located in different sites. Intravenous injection is a widely used systemic delivery route in preclinical studies that assess treatments intended for body-wide administration. In adult mice, it involves the intravenous administration of the therapeutic agent into the mouse&#39;s lateral tail veins. When mastered, tail-vein injections are safe and fast, and only require simple and commonly available tools. However, tail-vein injections are technically challenging and require extensive training and continuous practice to ensure the accurate delivery of the intended dose.
Here we describe a detailed, optimized, lateral tail-vein injection protocol that we have developed based on our experience and on recommendations that had been previously reported by other groups. Other than the mouse restrainers and insulin syringes, this protocol requires only reagents and equipment that are readily available in most labs. We found that following this protocol results in consistently successful intravenous delivery of adeno-associated virus (AAV) into the tail veins of unsedated 7-9 week-old mice. Additionally, we describe the optimized protocols for the histological detection of fluorescent reporter proteins and vector genome per diploid genome (vg/dg) quantification used to assess AAV transduction and biodistribution. The goal of this protocol is to aid experimenters in easily performing tail-vein injections successfully and consistently, which can reduce the practice time needed to master the technique.

Here we detail an optimized protocol for mouse lateral tail-vein injection to systemically administer adeno-associated virus (AAV) in adult mice. Additionally, we describe protocols of commonly used assays to assess AAV transduction.

연구

의학

Lateral Tail-Vein Injection for Systemic Therapeutic Delivery of Adeno-Associated Virus in Mice

To begin, insert the mouse tail into the restrainer tube's top opening. Slowly pull the mouse into the tube and place the plug ahead of the mouse to prevent it from escaping. To make a restraining sleeve for a smaller mouse, cut at the nose end of the cone to ensure the mouse's nose is not obstructed and it has enough room to breathe.Then cut the back of the cone similar to the length of the mouse. Place the mouse in the tube restrainer as previously described. While holding the mouse's tail, let the mouse walk into the cone.Slide the restrainer cone into the tube. Ensure that the mouse's tail is all the way out of the back of the tube, and the mouse has room to breathe inside the cone. Secure the tube plug immediately in front of the cone's nose opening.Fill the 15-milliliters conical tube with warm water. Place the tube restrainer with the mouse inside it on the elevated platform. Dip the restrained mouse's tail in warm water for at least one minute until the lateral veins are clearly dilated and visible.Place the uncapped adeno-associated virus, or AAV, containing 1.7 milliliters micro centrifuge tube in the tube rack. With the dominant hand, insert the needle vertically into the tube. Once the needle is inside the tube, hold the tube with the non-dominant hand.Then raise the tube and the syringe simultaneously to eye-level, while ensuring the needle does not touch the tube wall. Rest both arms on the table and slowly pull the dose into the syringe. Expel air bubbles from the syringe over a disposable absorbent pad.Hold the injectant for 40 seconds to warm it up. After ensuring tail veins are clearly visible, remove the tube restrainer from the elevated platform and place it directly on the table. Position the mouse in the restrainer with its feet downwards for easy handling of the tail.Quickly wipe the tail with gauze to dry it. Then wipe the tail with an alcohol swab, and again dry it with dry gauze. Rotate the tail approximately 90 degrees to the left or the right so that one of the two lateral veins is facing upwards.Locate a suitable injection site within the middle-third of the tail. Hold the tail with the non-dominant hand using the thumb and index finger immediately distal to the injection site. Fold the tail over the index finger so the injection site lies flat on the index finger.Then pull back on the tail to stretch it and the injection site is completely horizontal. Hold the syringe using the index and middle fingers of the dominant hand on either side of the syringe's barrel flange while keeping the thumb ready at the plunger. Rest both hands on the table and place the needle directly on and parallel to the tail and the vein with the bevel facing upwards.Now apply downward pressure on the needle and slide it forward into the vein to inject the AAV solution into the vein. After administering the dose, slowly withdraw the needle and immediately apply pressure with gauze at the injection site for at least 10 seconds until the bleeding stops. Histological imaging of fluorescent reporter protein post-injection showed that tdTomato was expressed diffusely throughout the liver and quadriceps indicating that AAV9 broadly reached and transduced different regions of both tissues.