Gli autori sono finanziati dalla Corus, immissione di cella medsys, CATENA e progetti Resina.

Il protocollo è riassunto in fig. 4. 1. Raccolta di campioni di sangue <ol><li> Raccogliere almeno 3 ml di sangue in EDTA al sito clinico. </li><li> I campioni possono essere conservati fino ad una settimana a 4 ° C. </li><li> Inviare i campioni di sangue EDTA quanto prima al laboratorio per posta ordinaria. </li></ol> 2. Isolamento di HIV RNA e / o DNA <ol><li> Ottenere l&#39;RNA virale e / o DNA a partire da 1000 microlitri di sangue intero, siero o plasma, utilizzando il MagNA Pure isolamento degli acidi nucleici Compact I kit di Io e il MagNA Pure System Compact. </li><li> Eluire l&#39;acquisita RNA o DNA in 50 microlitri tampone TE. In alternativa, altri procedimenti di purificazione di acidi nucleici possono essere utilizzati. </li></ol> 3. Amplificazione della regione env Amplificare la regione env (figg. 2 e 4) sia da RNA o DNA provirale plasma. A-1245 bp lungo prodotto, comprendente la maggior parte della proteina Env (nt 6556-7811 according di HXB2) viene generato. <ol><li> I campioni di RNA: RT-PCR di reazione <ol><li> RNA virale presenta una struttura molto complessa secondaria (Fig. 4) che possono ostacolare la reazione RT. Per evitare questo problema, incubare RNA 10 pl a 65 ° C per 10 minuti (già nel tubo PCR e nella macchina PCR) e quindi ridurre la temperatura a 50 ° C. </li><li> Aggiungere 40 ml di PCR Master Mix compreso il primer Env-F e Env-R. Master Mix per RT-PCR In-House-System: <table border="1"><tbody><tr><td></td><td> Volume / reazione (pl) </td><td> concentrazione finale </td></tr><tr><td> RNasi-free H 2 O </td><td> 14,4 </td><td></td></tr><tr><td> Buffer 5x (Qiagen OneStep RT-PCR Kit) </td><td> 10 </td><td> 1x </td></tr><tr><td> 5x Q-Solution </td><td> 10 </td><td> 1x </td></tr><tr><td> dNTP Mix (10 mM ciascuno) </td> &lt;td&gt; 2 </td><td> 400 uM di ciascun dNTP </td></tr><tr><td> Enzym-Mix (Qiagen OneStep RT-PCR Kit) </td><td> 2 </td><td></td></tr><tr><td> Primer Env-F (100 pM) </td><td> 0,3 </td><td> 0,6 micron </td></tr><tr><td> Primer Env-R (100 pM) </td><td> 0,3 </td><td> 0,6 micron </td></tr><tr><td> RNase Inhibitor (RNasin) </td><td> 1 </td><td> 5 unità / reazione </td></tr></tbody></table> Env-F: 5&#39;-CAAAGCCTAAAGCCATGTGTAAA -3 &#39;(nt 6556 → 6586 secondo HXB2) Env-R: 5&#39;-AGTGCTTCCTGCTGCTCCTAAGAACCC -3 &#39;(nt 7785 ← 7811) </li><li> Eseguire la reazione di RT a 50 ° C per 30 minuti. </li><li> Eseguire la prima PCR come segue: <table border="1"><tbody><tr><td> 95 ° C, 15 min </td><td> 1 x </td></tr><tr><td> 95 ° C, 30 sec 50 ° C, 30 sec 72 ° C, 2 min </td&gt; <td> 1 x </td></tr><tr><td> 95 ° C, 30 sec 56 ° C, 30 sec 72 ° C, 2 min </td><td> 38 x </td></tr><tr><td> 72 ° C, 10 min 4 ° C ∞ </td><td></td></tr></tbody></table></li></ol></li><li> I campioni di DNA: reazione PCR Per i campioni di DNA provirale, nessuna reazione RT è necessaria, e la reazione di PCR può avviare direttamente. <ol><li> Aggiungere 40 ml di PCR Master Mix a 10 microlitri di DNA provial. Master Mix per PCR In-House-System: <table border="1"><tbody><tr><td></td><td> Volume / reazione (pl) </td><td> concentrazione finale </td></tr><tr><td> RNasi-free H 2 O </td><td> 15,4 </td><td></td></tr><tr><td> Buffer 5x (DNA Polymerase HotStarTaq) </td><td> 10 </td><td> 1x </td></tr><tr><td> 5x Q-Solution </td><td> 10 </td><td> 1x </td></tr><tr><td> dNTP Mix (10 mM ciascuno) </td><td> 2 </td><td> 400 uM di ciascun dNTP </td></tr><tr><td> Enzym-Mix (DNA polimerasi HotStarTaq) </td><td> 2 </td><td></td></tr><tr><td> Primer Env-F (100 pM) </td><td> 0,3 </td><td> 0,6 micron </td></tr><tr><td> Primer Env-R (100 pM) </td><td> 0,3 </td><td> 0,6 micron </td></tr></tbody></table> Env-F: 5&#39;-CAAAGCCTAAAGCCATGTGTAAA -3 &#39;(nt 6556 → 6586) Env-R: 5&#39;-AGTGCTTCCTGCTGCTCCTAAGAACCC -3 &#39;(nt 7785 ← 7811) </li><li> Eseguire le condizioni di PCR come descritto in precedenza per i campioni di RNA (Punto 3.1.4). </li></ol></li></ol> 4. Amplificazione della regione V3: nested PCR <ol><li> Per la nested PCR, utilizzare 5 microlitri dalla prima reazione di PCR (senza precedente analisi in gel di agarosio) come modello e aggiungere 95 ml di Mas PCRter Mix. Master Mix per Nested-PCR In-House <table border="1"><tbody><tr><td></td><td> Volume / reazione (pl) </td><td> concentrazione finale </td></tr><tr><td> H 2 O </td><td> 61,9 </td><td></td></tr><tr><td> 10x PCR Buffer </td><td> 10 </td><td> 1x </td></tr><tr><td> 5x Q-Solution </td><td> 20 </td><td> 1x </td></tr><tr><td> dNTP Mix (10 mM ciascuno) </td><td> 2 </td><td> 200 mM di ciascun dNTP </td></tr><tr><td> Primer Env-2F (100 mM) </td><td> 0,3 </td><td> 0,6 micron </td></tr><tr><td> Primer Env-2R (100 mM) </td><td> 0,3 </td><td> 0,6 micron </td></tr><tr><td> HotStarTaq DNA polimerasi </td><td> 0,5 </td><td> 2,5 unità / reazione </td></tr></tbody></table> Env-2F: 5&#39;-GTCCAAAGGTATCCTTTGAGCCAATTC -3 &#39;(nt 6838 → 6864) <strong&gt; Env-2R: 5&#39;-CACCACTCTTCTCTTTGCCTTGGTGGGTGC -3 &#39;(nt 7712 ← 7742) </li><li> Eseguire la PCR come segue: <table border="0"><tbody><tr><td> 93 ° C, 15 min </td><td> 1 x </td></tr><tr><td> 95 ° C, 30 sec 50 ° C, 30 sec 72 ° C, 90 sec </td><td> 1 x </td></tr><tr><td> 95 ° C, 30 sec 56 ° C, 30 sec 72 ° C, 90 sec </td><td> 43 x </td></tr><tr><td> 72 ° C, 10 min 4 ° C ∞ </td><td></td></tr></tbody></table></li><li> Analizzare il prodotto di PCR su un gel di agarosio 1% (Fig. 4). Il prodotto atteso è 902 bp di lunghezza. </li><li> Purificazione dei campioni di sequenziamento. <ol><li> Purificare il prodotto di PCR con il kit di purificazione PCR-Qiagen, utilizzando il protocollo, soluzioni e micro-colonne fornite dal fornitore. Eluire in 30-100 microlitri di buffer PE, dell&#39;intensità banda. </li><li> In alternativa, i campioni possono essere purificato utilizzando esonucleasiI e veloce AP (Thermo fosfatasi alcalina). A tale scopo, aggiungere 6 microlitri Exo-AP prodotto Mix a 15 microlitri PCR e incubare 15 minuti a 37 ° C. <table border="1"><tbody><tr><td> 580 microlitri H 2 O </td></tr><tr><td> 66 microlitri AP veloce </td></tr><tr><td> 13,4 microlitri I Exo </td></tr></tbody></table></li></ol></li></ol> 5. Reazione Sequenza dell&#39;amplicone V3 <ol><li> La reazione sequenza consiste in una reazione di PCR utilizzando una sola delle seguenti primers: Env-2: 5&#39;-GTACAATGYACACATGGAATTAGGC -3 (nt 6959 → 6980) Env-5: 5&#39;-AAAATTCCCCTCCACAATTA - 3 &#39;(nt 7352 ← 7371) Env-6: 5&#39;-GGCCAGTAGTATCAACTCAAC - 3 &#39;(nt 6979 → 7000) Env-7: 5&#39;-TGTCCACTGATGGGAGGGGC - 3 &#39;(nt 7530 ← 7549) Env-10: 5 &#39;- GCAGAATAAAACAAATTATAAACATGTGGC - 3&#39; (nt 7478 ← 7507) Env-11: 5 &#39;- TACATTGCTTTTCCTACTTTCTGCCAC - 3&#39; (nt 7638 ← 7664) Primer di prima scelta sono: Env-2, 6 o Env-Env-7, Env-11 </li><li> Utilizzare 1 microlitri dal amplicone V3 purificato come modello e aggiungere 9 ml di PCR master-mix. Sequencing Master Mix: <table border="1"><tbody><tr><td> 4 MIX sequenza microlitri (HIV-Genotipizzazione Kit) </td></tr><tr><td> 4 microlitri H 2 O </td></tr><tr><td> Primer 1 pl (100 pmol / pl) </td></tr></tbody></table></li><li> Eseguire la reazione di sequenza nel modo seguente: <table border="0"><tbody><tr><td> 96 ° C, 10 sec </td><td></td></tr><tr><td> 50 ° C, 10 sec </td><td> 36 x </td></tr><tr><td> 60 ° C, 45 sec </td><td></td></tr><tr><td> 4 ° C ∞ </td><td></td></tr></tbody></table></li></ol> 6. Purificazione dei campioni di sequenziamento Purify sequenze USIng Sephadex G-50 superfine. <ol><li> Riempire il numero appropriato di pozzi nel &quot;caricatore colonna&quot; con Sephadex G-50 superfine. Trasferire il Sephadex al MAHVN4510 piastra filtro girando. </li><li> Aggiungere 300 microlitri Milli-Q H 2 O in ciascun pozzetto nella piastra filtro, e incubare per almeno 3 ore a 2-8 ° C. </li><li> Centrifugare le piastre per 5 min a 910Xg e 4-15 ° C. Gettare il flow-through. </li><li> Aggiungere 10 ml H 2 O al prodotto sequenza e quindi la sequenza pipetta sulla piastra gonfiò Sephadex. </li><li> Per ottenere il prodotto purificato, centrifugare la piastra per 5 min. a 910Xg e 4-15 ° C e raccogliere il flusso passante. </li></ol> 7. Sequenziamento dei campioni purificati sul sequencer ABI Prism 3130 XL <ol><li> Prima di ciascuna serie, modificare il buffer e verificare la quantità del polimero (POP7). Se necessario, sostituire il vecchio pallone polimero con uno nuovo. </li><li> Utilizzare le condizioni di esecuzione salvate, tra cui un tempo di iniezione di 18 secondi. </li><li> In questa macchina, la raccolta dei dati di segnale di un&#39;esecuzione con 16 campioni di sequenza dura circa 60 min (36 cm capillare) o 150 min (50 cm capillare). </li></ol> 8. Sequenza di montaggio <ol><li> Utilizzare il programma Lasergene (DNA-Star) per allineare e modificare le sequenze (Fig. 5). Altri programmi di modifica di sequenza possono essere utilizzati. Utilizzare un &quot;V3-Consensus B&quot; e la sequenza consenso env come riferimenti. </li><li> Lasergene crea una sequenza consenso del campione analizzato utilizzando tutti i dati grezzi disponibili e memorizzarli come file FASTA. Il file FASTA è un file di testo che include un header con il nome del campione e la sequenza nucleotidica. </li></ol> 9. Sequencing interpretazione dei dati e la previsione tropismo <ol><li> Sequenziamento interpretazione dei dati viene eseguita dal sistema web-based interpretazione geno2pheno [corecettore] ( <a href="http://coreceptor.bioinf.mpi-inf.mpg.de/index.php">http://coreceptor.bioinf.mpi-inf.mpg.de/</a>index.php). Per la previsione tropismo, FPR diverse impostazioni possono essere selezionate. L&#39;impostazione predefinita è secondo i tedesco-austriaco linee guida di terapia. Per FPR ≥ 20%, il virus è classificato come R5 quando FPR ≥ 20% e X4 per FPR &lt;12,5%. </li><li> Carica il file FASTA nel server. Questo server traduce la sequenza nucleotidica in aminoacidi, allinea con il consenso sequenza V3-B e produce una classificazione sottotipo. Inoltre, si genera una previsione dell&#39;utilizzo corecettore (Fig. 4) espresso come tasso di falsi positivi (FPR). </li></ol> 10. Risultati rappresentativi Il geno2pheno [corecettore] uscita mostra una interpretazione graduale del tropismo. A seconda della probabilità di utilizzo corecettore, il testo e il colore di sfondo interpretazione varia da verde (FPR &lt;20%), suggerendo una somministrazione sicura per MVC, al giallo, suggerendo un possibile, basso rischio ed infine al rosso. Rosso è il colore suggerisconozione non prescrivere MVC. Inoltre, il server genera un report pdf che può essere stampato, compilato con paziente e dati di esempio, e inviati al medico. Esempi di geno2pheno uscita [corecettore] sono rappresentate in fig. 6. <img alt="Figura 1" src="/files/ftp_upload/3264/3264fig1.jpg" /> Figura. 1. La replicazione del virus HIV schematica. Il virione deve legarsi ai recettori cellulari come CD4 e sia al CCR5 o CXCR4 come co-recettore. Il co-recettore CCR5 può essere bloccato con antagonisti CCR5 come il Maraviroc (MVC, Celsentri, Selzentry). Dopo la fusione delle membrane virali e cellulari, il nucleocapside virale viene rilasciato nel citoplasma. Nucleocapside smonta e il complesso RNA virale è liberata nel citoplasma. La trascrittasi inversa virale (RT) trascrive l&#39;RNA genomico in DNA provirale, che viene poi trasportato nel nucleo e integrato nel genoma dell&#39;ospite dal HIV integrasi. Cellular RNA polimerasi tradinscribe genomico virale e RNA messaggeri dal genoma provirale. Le proteine ​​virali sono prodotte nel citoplasma e trasportati alla superficie cellulare. La gemma virus particelle immature, non infettive virioni dalle cellule. La proteasi dell&#39;HIV scinde le proteine ​​produttrici di particelle infettive. Inibizione di una delle fasi porta ad una interruzione del ciclo di replicazione. I farmaci antiretrovirali e la fase di replica che inibiscono sono contrassegnati in rosso. Le RNA virale e DNA provirale (materiale utilizzato per l&#39;analisi del tropismo o resistenza) sono contrassegnati in verde. <img alt="Figura 2" src="/files/ftp_upload/3264/3264fig2.jpg" /> Figura 2. Genoma dell&#39;HIV provirale. La particella dell&#39;HIV è costruito con diverse proteine ​​strutturali e case di vari enzimi e proteine ​​sia di origine virale e cellulare. La figura mostras la posizione dei geni nel genoma virale. La superficie proteine ​​gp120 e gp41 costituiscono picchi sulla superficie del virione e contattare la cellula umana per effettuare la fusione della membrana. Nella parte inferiore della figura, i prodotti di amplificazione PCR e primer utilizzati nel nostro protocollo sono mostrati. <img alt="Figura 3" src="/files/ftp_upload/3264/3264fig3.jpg" /> Figura 3. Percentuale di pazienti con bassa carica virale (VL) misure analizzate per farmaco-resistenza o la determinazione tropismo presso l&#39;Istituto di Virologia, Università di Colonia (Germania). <img alt="Figura 4" src="/files/ftp_upload/3264/3264fig4.jpg" /> Figura 4. Schema generale della sperimentazione .. Si prega di <a href="http://www.jove.com/files/ftp_upload/3264/3264fig4_lg.jpg">cliccare qui</a> per vedere una versione più grande di questa figura. <img alt="Figura 5" src="/files/ftp_upload/3264/3264fig5.jpg" /> Figura 5. Sequenza di montaggio con Lasergene. L&#39;amplicone V3 è sequenziato con almeno un avanti e un innesco inverso. Lasergene alignés i &quot;. Abi&quot; i file ottenuti dal sequencer con la sequenza di riferimento &quot;V3-Consensus B&quot; e env. Lasergene crea una sequenza consenso utilizzando tutti i dati di riga disponibili. Le sequenze di riferimento può essere marcato (e vengono quindi visualizzate in grigio) in modo che non contribuiscono alla sequenza consensus campione. <img alt="Figura 6" src="/files/ftp_upload/3264/3264fig6.jpg" /> Figura 6. Rapporti di previsione tropismo generati dal geno2pheno [corecettore] Servizi tool.The vengono generati in formato pdf che possono essere salvati e completato nel computer. Altri dati quali nome paziente ci, la data di estrazione del sangue, ecc, può essere inclusa manualmente utilizzando un programma pdf scrittore. Osservazioni specifiche possono essere aggiunte. Thesdati elettronici sono esclusivamente sul computer dell&#39;utente e non sul ​​server geno2pheno [corecettore]. Si prega di <a href="http://www.jove.com/files/ftp_upload/3264/3264fig6_lg.jpg">cliccare qui</a> per vedere una versione più grande di questa figura.

<ol>
	<li>Heger, E., Schuelter, E., Klimkait, T., Lengauer, T., Kaiser, R., Walter, H., Sierra, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=European+coreceptor+proficiency+panel+test.">European coreceptor proficiency panel test.</a> , (2011).</li><li>Lengauer, T., Sander, O., Sierra, S., Thielen, T., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioinformatic+prediction+of+HIV+coreceptor+usage.">Bioinformatic prediction of HIV coreceptor usage.</a> Nature Biotech. 25 (12), 1407-1410 (2007).</li><li>McGovern, R., Dong, W., Zhong, X., Knapp, D., Thielen, A., Chapman, D., Lewis, M., James, I., Valdez, H., Harrigan, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Population-based+Sequencing+of+the+V3-loop+Is+Comparable+to+the+Enhanced+Sensitivity+Trofile+Assay+in+Predicting+Virologic+Response+to+Maraviroc+of+Treatment-na+ve+Patients+in+the+MERIT+Trial.">Population-based Sequencing of the V3-loop Is Comparable to the Enhanced Sensitivity Trofile Assay in Predicting Virologic Response to Maraviroc of Treatment-na ve Patients in the MERIT Trial.</a> , (2010).</li><li>Reuter, S., Braken, P., Jensen, B., Sierra-Aragon, S., Oette, M., Balduin, M., Kaiser, R., Haussinger, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maraviroc+in+treatment-experienced+patients+with+HIV-1+infection+-+experience+from+routine+clinical+practice.">Maraviroc in treatment-experienced patients with HIV-1 infection - experience from routine clinical practice.</a> Eur. J. Med. Res. 15 (6), 231-237 (2010).</li><li>Recordon-Pinson, P., Soulie, C., Flandre, P., Descamps, D., Lazrek, M., Charpentier, C., Montes, B., Trabaud, M. A., Cottalorda, J., Schneider, V., Morand-Joubert, L., Tamalet, C., Desbois, D., Mace, M., Ferre, V., Vabret, A., Ruffault, A., Pallier, C., Raymond, S., Izopet, J., Reynes, J., Marcelin, A. G., Masquelier, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+genotypic+prediction+of+HIV-1+coreceptor+use+versus+a+phenotypic+assay+and+correlation+with+the+virological+response+to+maraviroc:+the+ANRS+GenoTropism+study.">Evaluation of the genotypic prediction of HIV-1 coreceptor use versus a phenotypic assay and correlation with the virological response to maraviroc: the ANRS GenoTropism study.</a> Antimicrob. Agents. Chemother. 54 (8), 3335-3340 (2010).</li><li>Swenson, L. C., Knapp, D., Harrigan, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+and+accuracy+of+the+geno2pheno+co-receptor+algorithm+for+predicting+HIV+tropism+for+single+and+triplicate+measurements+of+V3+genotype.">Calibration and accuracy of the geno2pheno co-receptor algorithm for predicting HIV tropism for single and triplicate measurements of V3 genotype.</a> , (2010).</li><li>Macartney, M. J., Cameron, J., Strang, A., Garc&#237;a, A., Booth, C., Marshall, N., Johnson, M., Geretti, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+a+genotypic+assay+for+the+prediction+of+HIV-1+coreceptor+tropism+and+guiding+the+use+of+CCR5+antagonists+in+clinical+practice.">Use of a genotypic assay for the prediction of HIV-1 coreceptor tropism and guiding the use of CCR5 antagonists in clinical practice.</a> , (2010).</li><li>Sierra, S., Thielen, A., Reuter, S., Jensen, B., Esser, S., F&#228;tkenheuer, G., Lengauer, T., Pfister, H., Sichtig, N., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tropism+determination+and+clinical+outcome+of+61+patients+under+MVC+treatment.">Tropism determination and clinical outcome of 61 patients under MVC treatment.</a> , (2010).</li><li>Obermeier, M., Carganico, A., Bieniek, B., Schleehauf, D., Dupke, S., Fischer, K., Freiwald, M., Neifer, S., Schuler, C., Mayr, C., Klausen, G., K&#246;ppe, S., &#252;&#252;nsche, T., Berg, T., Baumgarten, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tropism+testing+from+proviral+DNA+-+analysis+of+a+subgroup+from+the+Berlin+Maraviroc+cohort.">Tropism testing from proviral DNA - analysis of a subgroup from the Berlin Maraviroc cohort.</a> , (2010).</li><li>Vandekerckhove, L. P., Wensing, A. M., Kaiser, R., Brun-Vezinet, F., Clotet, B., De Luca, A., Dressler, S., Garcia, F., Geretti, A. M., Klimkait, T., Korn, K., Masquelier, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=European+guidelines+on+the+clinical+management+of+HIV-1+tropism+testing.">European guidelines on the clinical management of HIV-1 tropism testing.</a> Lancet Infect Dis. 11 (5), 394-407 (2011).</li><li>Walter, H., Eberle, J., M&#246;ller, H., Noah, C., Wolf, E., St rmer, M., Braun, P., Krn, K., D umer, M., Berg, T., Obermeier, M., Thielen, A., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Empfehlung+zur+Bestimmung+des+HIV-1-Korezeptor-Gebrauchs+(DAIG+Recommendations+for+the+HIV-1+tropism+testing).">Empfehlung zur Bestimmung des HIV-1-Korezeptor-Gebrauchs (DAIG Recommendations for the HIV-1 tropism testing).</a> , (2011).</li><li>Obermeier, M. J., Carganico, A., Dupke, S., Schranz, D., Cordes, C., Freiwald, M., Klausen, G., K&#246;ppe, S., Schuler, C., Mayr, C., Schleehauf, D., Berg, T., Krznaric, I., Baumgarten, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+application+of+genotypic+co-receptor+tropism+testing+from+viral+RNA+and+proviral+DNA:+week+24+analysis+of+the+Berlin+maraviroc+cohort.">Clinical application of genotypic co-receptor tropism testing from viral RNA and proviral DNA: week 24 analysis of the Berlin maraviroc cohort.</a> Journal of the International AIDS Society. 13, 129-129 (2010).</li><li>Toma, J., Frantzell, A., Hoh, R., Martin, J., Deeks, S., Petropoulos, C., Huang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determining+HIV-1+Co-receptor+Tropism+Using+PBMC+Proviral+DNA+Derived+from+Aviremic+Blood+Samples.">Determining HIV-1 Co-receptor Tropism Using PBMC Proviral DNA Derived from Aviremic Blood Samples.</a> , (2010).</li></ol>

In questo articolo il video è sponsorizzato da ViiV Healthcare e GlaxoSmithKline.

La sequenza V3 permette una previsione affidabile tropismo virale, come dimostrato in studi clinici 3-9. Infatti, la determinazione del genotipo è contemplato nelle linee guida europee in vigore e austro-tedesco 10. Rispetto al test fenotipico, non solo è il tempo di rotazione più breve (equivalente a test di resistenza), ma anche i costi. Inoltre, un vantaggio importante di test genotipico è che i risultati sono classificati come FPR e quindi può essere adattata alle esigenze del paziente. Risultati Trofile, invece, sono semplicemente relazioni R5 o X4, e l&#39;accesso ai dati grezzi non è dato. Attualmente, le linee guida europee suggeriscono un FPR cut-off del 20% 10, mentre gli austro-tedeschi linee guida permettono di adattare il FPR cut-off in particolare alle esigenze di ogni paziente 11. In questa linea, per i pazienti con una vasta gamma di opzioni di farmaci antiretrovirali, più FPR cut-off (&gt; 20%) sono raccomfinita. Al contrario, per pesantemente pre-trattati pazienti con limitate opzioni terapeutiche, inferiore FPR cut-off (&gt; 5%) può essere utilizzato. Questo tipo di guida terapia è attualmente in corso della prova di resistenza NRTI, NNRTI, PI, e Inis, dove farmaci parzialmente attivi possono essere incluse nel trattamento di pazienti con ridotte opzioni terapeutiche. Inoltre, con un numero crescente di cambiamenti di terapia genotipicamente-guidate, l&#39;clinicamente rilevante FPR cut-off sono costantemente regolati da un gruppo di bioinformatici, virologi e medici. Un altro importante vantaggio del test genotipico tropismo è la possibilità di analizzare campioni clinici con molto basso o non rilevabile carica virale (VL). In questi casi, quando plasma RNA non è amplificabile, il DNA provirale può essere sequenziato e utilizzate per previsioni affidabili 9,12. Di nota, il numero di pazienti con bassa o carica virale non è nettamente aumentata negli ultimi anni. Ad oggi, la Trofilo test consente solo l&#39;analisi di campioni da pazienti con VL &lt;1000 copie / ml. Tuttavia, studi preliminari hanno dimostrato che il DNA provirale possono essere anche adecuate essere testato da Trofile 13.

<table border="1"><tbody><tr><td> Nome del reagente </td><td> Azienda </td><td> Numero di catalogo </td><td> Commenti </td></tr><tr><td> MagNA Pure Compact acidi nucleici Kit di isolamento I </td><td> Roche Diagnostics </td><td> 04 802 993 001 </td><td></td></tr><tr><td> MagNA Pure System Compact </td><td> Roche Diagnostics </td><td> 03731146001 </td><td></td></tr><tr><td> T3000 termociclatore </td><td> Biometra </td><td> 050-723 </td><td></td></tr><tr><td> One Step RT-PCR Kit </td><td> Qiagen </td><td> 210215 </td><td></td></tr><tr><td> HotStarTaq Master Mix Kit </td><td> Qiagen </td><td> 203445 </td><td></td></tr><tr><td> QIAquick PCR Purification Kit </td><td> Qiagen </td><td> 28106 </td><td></td></tr><tr><td> Esonucleasi I (Exo I) </td><td> Fermentas </td><td> EN0582 </td><td></td></tr><tr><td> Fastap termosensibile fosfatasi alcalina </td><td> Fermentas </td><td> EF0651 </td> &lt;td&gt; </td></tr><tr><td> BigDye Terminator v3.1 Cycle Sequencing Kit </td><td> Applied Biosystems </td><td> 4337457 </td><td></td></tr><tr><td> Sephadex G-50 Superfine </td><td> GE Healthcare </td><td> 17-0041-01 </td><td></td></tr><tr><td> ABI Prism 3130 XL sequenziatore capillare </td><td> Applied Biosystems </td><td> 3130XL </td><td></td></tr></tbody></table>

prediction of hiv-1 coreceptor usage (tropism) by sequence analysis using a genotypic approach

Maraviroc (MVC) è il primo farmaco autorizzato antiretrovirale della classe degli antagonisti corecettore. Si lega all&#39;host corecettore CCR5, utilizzato dalla maggior parte dei ceppi di HIV per infettare le cellule immunitarie umane (Fig. 1). Altri isolati di HIV utilizzare un corecettore diverso, il CXCR4. Recettore che viene utilizzato, è determinato il virus dalla proteina Env (Fig. 2). A seconda del corecettore utilizzato, i virus sono classificati come R5 o X4, rispettivamente. MVC lega al recettore CCR5 inibendo l&#39;ingresso di virus R5 nella cellula bersaglio. Durante il corso della malattia, virus X4 possono emergere e diventare troppo i virus R5. Determinazione di utilizzo co-recettore (chiamato anche tropismo) è quindi obbligatoria prima della somministrazione di MVC, come richiesto da EMA e FDA. Gli studi di efficienza MVC MOTIVATE, MERIT e il 1029 sono stati eseguiti con il test Trofile da Monogram, San Francisco, USA Si tratta di un saggio di alta qualità sulla base di Sophisticated test ricombinanti. L&#39;accettazione di questo test per la routine quotidiana è piuttosto bassa al di fuori degli Stati Uniti, dal momento che i medici europei piuttosto tendono a lavorare con laboratori decentrati esperti, che prevedono prove di resistenza concomitante. Questi laboratori sono stati sottoposti a diverse valutazioni di garanzia della qualità, l&#39;ultimo viene presentato nel 2011 1. Da diversi anni, abbiamo eseguito le determinazioni tropismo sulla base di analisi di sequenza della regione V3 env-HIV gene (V3) 2. Questa regione trasporta informazioni sufficienti per effettuare una stima affidabile. La determinazione genotipica di utilizzo corecettore presenta vantaggi quali: tempo di rotazione più breve (equivalente a test di resistenza), riduzione dei costi, possibilità di adattare i risultati alle esigenze dei pazienti e la possibilità di analizzare i campioni clinici con molto basso o addirittura carica virale non rilevabile (VL ), tanto più che il numero di campioni analizzati con VL &lt;1000 copie / mLapprossimativamente aumentata negli ultimi anni (Fig. 3). I passi principali per i test tropismo (Fig. 4) hanno dimostrato in questo video: 1. Raccolta di un campione di sangue 2. L&#39;isolamento del RNA dell&#39;HIV dalla / o plasma e DNA provirale HIV dalle cellule mononucleate del sangue 3. Amplificazione della regione env 4. Amplificazione della regione V3 5. Reazione Sequenza dell&#39;amplicone V3 6. Purificazione dei campioni di sequenziamento 7. Sequenziamento dei campioni purificati 8. Sequenza di montaggio 9. Sequencing interpretazione dei dati e la previsione tropismo

Watch this Scientific Journal Video about Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach at JoVE.com

Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach

La previsione del corecettore utilizzo di HIV-1 è necessaria per la somministrazione di una nuova classe di farmaci antiretrovirali, antagonisti corecettore cioè. Può essere effettuata mediante analisi di sequenza del<em&gt; Env</em&gt; Genica e successiva interpretazione attraverso un sistema basato su un&#39;interpretazione internet (geno2pheno<sub&gt; [Corecettore]</sub&gt;).

Pronostico di HIV-1 Uso corecettore (tropismo) mediante analisi della sequenza utilizzando un approccio genotipica

Maraviroc (MVC) is the first licensed antiretroviral drug from the class of coreceptor antagonists. It binds to the host coreceptor CCR5, which is used by ...

<a class="grey_button" href="http://www.jove.com/video/4153"> Espa&ntilde;ol </a>

prediction-hiv-1-coreceptor-usage-tropism-sequence-analysis-using

Research

JoVE Journal

Immunology and Infection

Prediction of HIV-1 Coreceptor Usage (Tropism) by Sequence Analysis using a Genotypic Approach

13.1K Views.  University of Cologne.  Español 

Video: Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach

Assessment of Immunologically Relevant Dynamic Tertiary Structural Features of the HIV-1 V3 Loop Crown R2 Sequence by ab initio Folding

The antigenic diversity of HIV-1 has long been an obstacle to vaccine design, and this variability is especially pronounced in the V3 loop of the virus' surface envelope glycoprotein. We previously proposed that the crown of the V3 loop, although dynamic and sequence variable, is constrained throughout the population of HIV-1 viruses to an immunologically relevant &beta;-hairpin tertiary structure. Importantly, there are thousands of different V3 loop crown sequences in circulating HIV-1 viruses, making 3D structural characterization of trends across the diversity of viruses difficult or impossible by crystallography or NMR. Our previous successful studies with folding of the V3 crown1, 2 used the ab initio algorithm 3 accessible in the ICM-Pro molecular modeling software package (Molsoft LLC, La Jolla, CA) and suggested that the crown of the V3 loop, specifically from positions 10 to 22, benefits sufficiently from the flexibility and length of its flanking stems to behave to a large degree as if it were an unconstrained peptide freely folding in solution. As such, rapid ab initio folding of just this portion of the V3 loop of any individual strain of the 60,000+ circulating HIV-1 strains can be informative. Here, we folded the V3 loop of the R2 strain to gain insight into the structural basis of its unique properties. R2 bears a rare V3 loop sequence thought to be responsible for the exquisite sensitivity of this strain to neutralization by patient sera and monoclonal antibodies4, 5. The strain mediates CD4-independent infection and appears to elicit broadly neutralizing antibodies. We demonstrate how evaluation of the results of the folding can be informative for associating observed structures in the folding with the immunological activities observed for R2.

Assessment of Immunologically Relevant Dynamic Tertiary Structural Features of the HIV-1 V3 Loop Crown R2 Sequence by ab initio Folding

The crown region of different V3 loop sequences of the surface envelope glycoprotein (gp120) of HIV-1 can be structurally characterized in many cases by in silico folding of positions 10 to 22 of the loop using a state-of-the-art ab initio folding algorithm. Here we demonstrate the folding and evaluation of this region of the V3 loop from the R2 strain of HIV-1, a uniquely neutralization sensitive strain with puzzling functional properties.

Valutazione della immunologicamente rilevanti dinamiche Caratteristiche strutturali del terziario di HIV-1 sequenza R2 Loop Corona V3 da Ab initio Pieghevole

The antigenic diversity of HIV-1 has long been an obstacle to vaccine design, and this variability is especially pronounced in the V3 loop of the virus' ...

Ricerca

Immunologia e infezioni

Specific Marking of HIV-1 Positive Cells using a Rev-dependent Lentiviral Vector Expressing the Green Fluorescent Protein

Most of HIV-responsive expression vectors are based on the HIV promoter, the long terminal repeat (LTR). While responsive to an early HIV protein, Tat, the LTR is also responsive to cellular activation states and to the local chromatin activity where the integration has occurred. This can result in high HIV-independent activity, and has restricted the usefulness of LTR-based reporter to mark HIV positive cells 1,2,3. Here, we constructed an expression lentiviral vector that possesses, in addition to the Tat-responsive LTR, numerous HIV DNA sequences that include the Rev-response element and HIV splicing sites 4,5,6. The vector was incorporated into a lentiviral reporter virus, permitting highly specific detection of replicating HIV in living cell populations. The activity of the vector was measured by expression of the green fluorescence protein (GFP). The application of this vector as reported here offers a novel alternative approach to existing methods, such as in situ PCR or HIV antigen staining, to identify HIV-positive cells. The vector can also express therapeutic genes for basic or clinical experimentation to target HIV-positive cells.

We have developed a lentiviral vector that possesses, in addition to the Tat-responsive LTR, the Rev-response element (RRE) that can regulate reporter gene expression in an HIV-1 Tat- and Rev-dependent fashion. The vector permits the specific detection of replicating HIV in living cells via the expression of GFP.

Marcatura specifica di HIV-1 Cellule positive con un Rev-dipendente Vector lentivirali Esprimendo la proteina fluorescente verde

Most of HIV-responsive expression vectors are based on the HIV promoter, the long terminal repeat (LTR). While responsive to an early HIV protein, Tat, ...

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

Inferenza genotipica del virus HIV-1 Tropismo utilizzo basati sulla popolazione sequenziamento del V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Structure of HIV-1 Capsid Assemblies by Cryo-electron Microscopy and Iterative Helical Real-space Reconstruction

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein complexes and assemblies. In fact, single particle electron microscopy1 and two-dimensional (2D) electron crystallography2 have become relatively routine methodologies and a large number of structures have been solved using these methods. At the same time, image processing and three-dimensional (3D) reconstruction of helical objects has rapidly developed, especially, the iterative helical real-space reconstruction (IHRSR) method3, which uses single particle analysis tools in conjunction with helical symmetry. Many biological entities function in filamentous or helical forms, including actin filaments4, microtubules5, amyloid fibers6, tobacco mosaic viruses7, and bacteria flagella8, and, because a 3D density map of a helical entity can be attained from a single projection image, compared to the many images required for 3D reconstruction of a non-helical object, with the IHRSR method, structural analysis of such flexible and disordered helical assemblies is now attainable.
In this video article, we provide detailed protocols for obtaining a 3D density map of a helical protein assembly (HIV-1 capsid9 is our example), including protocols for cryo-EM specimen preparation, low dose data collection by cryo-EM, indexing of helical diffraction patterns, and image processing and 3D reconstruction using IHRSR. Compared to other techniques, cryo-EM offers optimal specimen preservation under near native conditions. Samples are embedded in a thin layer of vitreous ice, by rapid freezing, and imaged in electron microscopes at liquid nitrogen temperature, under low dose conditions to minimize the radiation damage. Sample images are obtained under near native conditions at the expense of low signal and low contrast in the recorded micrographs. Fortunately, the process of helical reconstruction has largely been automated, with the exception of indexing the helical diffraction pattern. Here, we describe an approach to index helical structure and determine helical symmetries (helical parameters) from digitized micrographs, an essential step for 3D helical reconstruction. Briefly, we obtain an initial 3D density map by applying the IHRSR method. This initial map is then iteratively refined by introducing constraints for the alignment parameters of each segment, thus controlling their degrees of freedom. Further improvement is achieved by correcting for the contrast transfer function (CTF) of the electron microscope (amplitude and phase correction) and by optimizing the helical symmetry of the assembly.

This article describes a method to obtain a three-dimensional (3D) structure of helically assembled molecules using cryo-electron microscopy. In this protocol, we use HIV-1 capsid assemblies to illustrate the detailed 3D reconstruction procedure for achieving a density map by the iterative helical real-space reconstruction method.

Struttura del virus HIV-1 Assemblee Capsidico da Cryo-microscopia elettronica e iterativo ricostruzione elicoidale reale spazio

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein ...

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

In uncoating vitro di HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the protocols described here use freshly isolated human peripheral blood mononuclear cells (PBMCs) or plasmacytoid dendritic cells (pDCs) to sense infections in either T cell line (MT4) or heterologous primary CD4+ T cells. In order to ensure proper sensing, it is essential that PBMC are isolated immediately after blood collection and that optimal percentage of infected T cells are used. Furthermore, multi-parametric flow cytometric staining can be used to confirm that PBMC samples contain the different cell lineages at physiological ratios. A number of controls can also be included to evaluate viability and functionality of pDCs. These include, the presence of specific surface markers, assessing cellular responses to known agonist of Toll-Like Receptors (TLR) pathways, and confirming a lack of spontaneous type-I interferon (IFN) production. In this system, freshly isolated PBMCs or pDCs are co-cultured with HIV-1 infected cells in 96 well plates for 18-22 hr. Supernatants from these co-cultures are then used to determine the levels of bioactive type-I IFNs by monitoring the activation of the ISGF3 pathway in HEK-Blue IFN-&#945;/&#946; cells. Prior and during co-culture conditions, target cells can be subjected to flow cytometric analysis to determine a number of parameters, including the percentage of infected cells, levels of specific surface markers, and differential killing of infected cells. Although, these protocols were initially developed to follow type-I IFN production, they could potentially be used to study other imuno-modulatory molecules released from pDCs and to gain further insight into the molecular mechanisms governing HIV-1 innate sensing.

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

Unlike cell-free HIV-1 particles, infected CD4+ T cells are effectively sensed by plasmacytoid dendritic cells (pDCs). This manuscript describes a method where peripheral blood mononuclear cells (PBMCs) or isolated pDCs are co-cultured with HIV-1 infected T cells to evaluate innate sensing by pDCs as assessed by release of type-I IFN.

Valutare l&#39;innato rilevamento dell&#39;infezione da HIV-1 CD4 infetti<sup&gt; +</sup&gt; Cellule T dalle cellule dendritiche plasmacitoidi Utilizzando un<em&gt; Ex vivo</em&gt; Sistema di co-coltura.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins are able to fuel the fusion process through their conformational changes could lead to the design of better, more effective immunogens for vaccine strategies. Here we describe a cell-based ELISA assay that allows studying the recognition of trimeric HIV-1 Env by monoclonal antibodies. Following expression of HIV-1 trimeric Env at the surface of transfected cells, conformation specific anti-Env antibodies are incubated with the cells. A horseradish peroxidase-conjugated secondary antibody and a simple chemiluminescence reaction are then used to detect bound antibodies. This system is highly flexible and can detect Env conformational changes induced by soluble CD4 or cellular proteins. It requires minimal amount of material and no highly-specialized equipment or know-how. Thus, this technique can be established for medium to high throughput screening of antigens and antibodies, such as newly-isolated antibodies.

Understanding viral surface antigens conformations is required to evaluate antibody neutralization and guide the design of effective vaccine immunogens. Here we describe a cell-based ELISA assay that allows the study of the recognition of trimeric HIV-1 Env expressed at the surface of transfected cells by specific anti-Env antibodies.

Valutazione conformazionale di HIV-1 trimeric busta glicoproteine ​​Utilizzando una base di Cell-ELISA Saggio

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. They are found in a number of biological fluids and are known to carry a variety of proteins, lipids, and nucleic acid molecules. Originally thought to be little more than reservoirs for cellular debris, the roles of exosomes regulating biological processes and in diseases are increasingly appreciated.
Several methods have been described for isolating exosomes from cellular culture media and biological fluids. Due to their small size and low density, differential ultracentrifugation and/or ultrafiltration are the most commonly used techniques for exosome isolation. However, plasma of HIV-1 infected individuals contains both exosomes and HIV viral particles, which are similar in size and density. Thus, efficient separation of exosomes from HIV viral particles in human plasma has been a challenge.
To address this limitation, we developed a procedure modified from Cantin et. al., 2008 for purification of exosomes from HIV particles in human plasma. Iodixanol velocity gradients were used to separate exosomes from HIV-1 particles in the plasma of HIV-1 positive individuals. Virus particles were identified by p24 ELISA. Exosomes were identified on the basis of exosome markers acetylcholinesterase (AChE), and the CD9, CD63, and CD45 antigens. Our gradient procedure yielded exosome preparations free of virus particles. The efficient purification of exosomes from human plasma enabled us to examine the content of plasma-derived exosomes and to investigate their immune modulatory potential and other biological functions.

Techniques describing a gradient procedure to separate exosomes from human immunodeficiency virus (HIV) particles are described. This procedure was used to isolate exosomes away from HIV particles in human plasma from HIV-infected individuals. The isolated exosomes were analyzed for cytokine/chemokine content.

Isolamento di esosomi dal plasma di HIV-1 individui positivi

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. ...

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the viral capsid (CA) core into the cytoplasm. Subsequently, the viral Reverse Transcriptase (RT), as part of a namesake nucleoprotein complex termed the Reverse Transcription Complex (RTC), converts the viral single-stranded RNA genome into a double-stranded DNA copy (vDNA). This leads to the biogenesis of another nucleoprotein complex, termed the pre-integration complex (PIC), composed of the vDNA and associated virus proteins and host factors. The PIC-associated viral integrase (IN) orchestrates the integration of the vDNA into the host chromosomal DNA in a temporally and spatially regulated two-step process. First, the IN processes the 3&#39; ends of the vDNA in the cytoplasm and, second, after the PIC traffics to the nucleus, it mediates integration of the processed vDNA into the chromosomal DNA. The PICs isolated from target cells acutely infected with HIV-1 are functional in vitro, as they are competent to integrate the associated vDNA into an exogenously added heterologous target DNA. Such PIC-based in vitro integration assays have significantly contributed to delineating the mechanistic details of retroviral integration and to discovering IN inhibitors. In this report, we elaborate upon an updated HIV-1 PIC assay that employs a nested real-time quantitative Polymerase Chain Reaction (qPCR)-based strategy for measuring the in vitro integration activity of isolated native PICs.

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.

Misurazione<em&gt; In Vitro</em&gt; Integrazione di attività del virus HIV-1 preintegrazione Complessi

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the ...

SILAC Based Proteomic Characterization of Exosomes from HIV-1 Infected Cells

Proteomics is the large-scale analysis of proteins. Proteomic techniques, such as liquid chromatography tandem mass spectroscopy (LC-MS/MS), can characterize thousands of proteins at a time. These powerful techniques allow us to have a systemic understanding of cellular changes, especially when cells are subjected to various stimuli, such as infections, stresses, and specific test conditions. Even with recent developments, analyzing the exosomal proteome is time-consuming and often involves complex methodologies. In addition, the resultant large dataset often needs robust and streamlined analysis in order for researchers to perform further downstream studies. Here, we describe a SILAC-based protocol for characterizing the exosomal proteome when cells are infected with HIV-1. The method is based on simple isotope labeling, isolation of exosomes from differentially labeled cells, and mass spectrometry analysis. This is followed by detailed data mining and bioinformatics analysis of the proteomic hits. The resultant datasets and candidates are easy to understand and often offer a wealth of information that is useful for downstream analysis. This protocol is applicable to other subcellular compartments and a wide range of test conditions.

Here, we describe a quantitative proteomics method using the technique of stable isotope labeling by amino acids in cell culture (SILAC) to analyze the effects of HIV-1 infection on host exosomal proteomes. This protocol can be easily adapted to cells under different stress or infection conditions.