Noi riconosciamo il sostegno NIH Innovator Award New DP2 116520 e ORAU Ralph Powe Facoltà Junior Enhancement Award.

1. Cella di manutenzione <ol><li> HESC H1 (WiCell) sono stati mantenuti hESC qualificati Matrigel pozzi rivestiti con mTeSR1 media, con i media cambiano ogni giorno. I pozzetti sono stati rivestiti con una soluzione diluita matrigel, preparata aggiungendo 300 pl di Matrigel hESC in 25 ml di DMEM: F12. 1 ml di questa soluzione Matrigel è stato aggiunto a ciascun pozzetto di una piastra ben sei, o 400 microlitri aggiunti a ciascun pozzetto di una piastra da 12 pozzetti e lasciate rivestimento per 1 ora a temperatura ambiente. Le cellule sono state meccanicamente diversi passaggi in un rapporto di divisione di 1:4 raschiando colonie, una volta raggiunto tra 1 e 1,5 millimetri di diametro. </li><li> RHMVEC (tecnologie VEC) è stata mantenuta in MCDB 131-supporto con mezzi modificare ogni altro giorno. Le cellule sono state suddivise per tripsinizzazione volta 80% di confluenza è stato raggiunto in un rapporto di divisione di 1:3. Le cellule endoteliali tra i passaggi 3 e 7 sono stati usati per questo studio. </li></ol> 2. Preparazione delle soluzioni madre <ol><li> Activin A è stato ricostituito a 50 ug / ml in P sterileBS contenente 0,1% di siero albumina bovina. La soluzione è stata aliquotati e conservati a -20 ° C. </li><li> FEG è stato ricostituito a 500 ug / ml sterile in 10 mM di acido acetico. La soluzione è stata aliquotati e conservati a -20 ° C. </li><li> L&#39;insulina è stato ricostituito a 10 mg / ml aggiungendo acidificata H 2 O (pH ≤ 2), preparato tramite aggiunta di 0,1 ml di acido acetico glaciale a 10 ml di acqua. </li><li> DAPT è stato ricostituito in DMSO a 18 mg / ml. È stato ulteriormente diluito a concentrazione 300 pM in DMEM: F12, aliquotati e conservati a -20 ° C. </li><li> KAAD-Cyclopamine è stato ricostituito in DMSO a 5mg/ml. Essa è stata ulteriormente diluita al 2 concentrazione pM in DMEM: F12, aliquotati e conservati a -20 ° C. </li><li> Acido all-trans retinoico è stato ricostituito a 2,7 mg / ml in etanolo al 95%. Essa è stata ulteriormente diluita alla concentrazione 2mM in DMEM: F12, aliquotati e conservati a -80 ° C. </li></ol> 3. Endoderma definitivo (DE) e Progenitore pancreatico (PP) Induzione <ol><li> Una volta che hColonie ESC raggiunto tra 1 e 1,5 millimetri di diametro, DE induzione è stata eseguita aggiungendo DMEM: F12 supplementato con B27, 0,2% BSA, 100 ng / ml Activin A e 1 pM Wortmannin per 4 giorni (giorno 0-Day 4) con mezzi cambiano ogni giorno. </li><li> Dopo l&#39;induzione DE era completa, capostipite di induzione del pancreas è stata indotta cambiando i media DMEM: F12 integrato con B27, 0.2% BSA e KAAD-Cyclopamine alla concentrazione di 0,2 uM per 24 ore (Giorno 4 Giorno 5). </li><li> Dopo 24 ore i media è stato cambiato in DMEM: F12 integrato con B27, 0,2% di BSA, KAAD-Cyclopamine concentrazione a 0,2 micron e acido all-trans retinoico a 2 concentrazione uM per 3 giorni con i media cambiano ogni giorno (Day 5-Day 8) . </li></ol> 4. Maturazione del pancreas <ol><li> Dopo induzione PP, tutti i gruppi sono stati cambiati per supporti maturazione composto di DMEM: F12 supplementato con B27, 0,2% BSA, 10 Nicotinamide mM, 25 pg / ml di insulina, 30 nM Na 2 ug SeO 3 e 50 / ml transferrina per 2 days con i media cambiano ogni giorno (Day 8-Day 10). </li><li> Dopo 2 giorni a mezzi di maturazione, la fase di maturazione finale viene effettuata in parallelo utilizzando diverse condizioni per il confronto. Differenziazione stata indotta nelle seguenti condizioni: (i) utilizzando tacca inibitore DAPT (ii) mediante co-coltura supporto soltanto, senza cellule endoteliali come controllo e (iii) mediante contatto co-coltura con cellule RHMVEC. Le cellule sono state mantenute in media DAPT o co-coltura per una settimana (giorno 10-Day 17) con i media cambiano ogni giorno. <ol><li> Supporto DAPT è stato preparato integrando i mezzi di comunicazione di maturazione con 30 DAPT pM. Cellule in questo gruppo sono stati esposti a completare MCDB131 per 24 ore e poi esposto a supporti DAPT per 6 giorni (Day 11-Day 17). </li><li> Co-coltura è stato preparato mediante mezzi integrandolo MCDB 131-B27 con supporti, 0,2% BSA, 10 Nicotinamide mM, 10 ng / ml EGF, 1 pg / ml di idrocortisone, 10 mg EndoGro, 90 mcg / ml di eparina. Per la condizione di controllo dei media di differenziazione le cellule sono state espostea MCDB-131 terreno completo per 24 ore (Giorno 10-11 ° giorno) dopo che è stato cambiato i media a co-cultura dei media per 6 giorni (11 ° giorno-Day 17) (assenza di cellule endoteliali). </li><li> Per il contatto co-coltura condizione, un milione RHMVEC è stato aggiunto alle cellule differenziano in completo MCDB-131 mezzi (tecnologie VEC) per 24 ore (giorno 10-11 ° giorno) per consentire allegato. Dopo 24 ore i media è stato cambiato in co-cultura dei media per 6 giorni (11-Day Day 17) con i media cambiano ogni giorno. </li></ol></li></ol> 5. qRT-PCR <ol><li> Al termine di ciascuna fase di differenziazione (endoderma; progenitore pancreatiche, isolotto maturo) sono state lisate e RNA è stato estratto usando il kit di estrazione di RNA NucleoSpin II secondo le istruzioni del produttore. </li><li> RNA è stato analizzato qualità controllando RNA assorbanza a 260 nm e 280 nm, seguita da quantificazione RNA utilizzando uno spettrofotometro SmartSpec Plus.. </li><li> Trascrizione inversa è stata eseguita usando ImProm k trascrizione inversa IIsecondo le istruzioni del produttore. Tutte le reazioni sono state eseguite con 100 ng di RNA. </li><li> qRT-PCR è stata eseguita utilizzando il Mx3005P QPCR sistema (Agilent) e Brilliant II SYBR Green QPCR master mix secondo le istruzioni del produttore. Gli inneschi usati sono elencati nella tabella 1. La fase di inizializzazione è stata eseguita a 50 ° C per 2 minuti seguiti da 95 ° C per 10 minuti. 50 cicli di amplificazione sono state eseguite come segue: 95 ° C per 30 secondi, 54 ° C per 30 secondi e 72 ° C per 1 minuto. </li><li> Fold change di espressione di mRNA in cellule indifferenziate è stata calcolata a partire dai valori CT utilizzando le seguenti formule: ACT (Marker i) = CT (Marker i) - CT (GAPDH) Δ ACT (marcatori i) = ACT (Marker i) (Sample) - ACT (Marker i) (cellule indifferenziate) Espressione relativa (Marker i) = 2-ΔΔCT(Marker i) </li></ol> 6. Immunocitochimica <ol><li> Al termine di ciascuna fase di differenziazione (endoderma; progenitore pancreatiche, isolotto maturo) cellule sono state fissate in formaldeide 4% per 15 minuti a temperatura ambiente. </li><li> Le cellule sono state fissi permeabilizzate con 0,25% Triton X-100 (TX) per 15 minuti. </li><li> Marcatura non specifica è stata bloccata mediante incubazione in siero asino 10% in 0,05% TX per 30 minuti. </li><li> L&#39;anticorpo primario incubazione è stata eseguita la notte a 4 ° C in tampone di bloccaggio alla diluizione anticorpo raccomandata (vedi tabella 1). </li><li> Le cellule sono state lavate con 0,05% TX tre volte per 5 minuti. </li><li> Incubazione anticorpo secondario è stata eseguita per un&#39;ora a temperatura ambiente al buio con anticorpi appropriati diluiti in tampone di bloccaggio. </li><li> Le cellule sono state lavate con 0,05% TX tre volte per 5 minuti. </li><li> Colorazione nucleare è stata eseguita da incubazione con Hoescht macchia di diluizione 1:1000 in PBSper 5 minuti, seguito da 3 lavaggi con PBS. </li><li> Cellule fissate e colorate sono stati ripresi utilizzando Olympus IX81 microscopio invertito e Metamorph software di imaging. </li></ol> 7. Risultati rappresentativi L&#39;aggiunta di Activin A e Wortmannin di hESC indifferenziato per 4 giorni induce endoderma definitiva come confermato da qRT-PCR per marcatori DE Sox17, i CXCR4, e Foxa2 e immunocolorazione per Sox17 come illustrato in figura 2. La differenziazione di cellule progenitrici pancreatiche dopo aggiunta di acido retinoico cyclopamine ed è stato confermato dal qRT-PCR di marcatori progenitrici pancreatiche e l&#39;immunocolorazione per Pdx1 come illustrato in figura 3. Nella fase finale di differenziazione, contattare co-coltura con cellule RHMVEC fortemente indotta sovraregolazione di espressione insulina nelle cellule pancreatiche derivate hESC progenitrici. L&#39;efficienza di co-coltura differenziazione mediata è stata analizzata mediante comparing con la condizione di controllo utilizzando DAPT. DAPT è stato usato come controllo positivo in quanto è attualmente uno dei metodi più utilizzati per ottenere la maturazione pancreatica. Poiché la co-coltura è stata eseguita in un mezzo modificati completata da fattori di supporto di cellule endoteliali, il controllo aggiuntivo è stato effettuato con i media in assenza di cellule endoteliali per verificare l&#39;effetto dei media sulla differenziazione. I dettagli di questa analisi sono presentati in Figura 4. <img alt="Figura 1." src="/files/ftp_upload/3759/3759fig1.jpg" /> Figura 1. Multi-stage protocollo per la differenziazione delle hESC insulina in cellule che esprimono. <img alt="Figura 2." src="/files/ftp_upload/3759/3759fig2.jpg" /> Figura 2. Induzione endoderma definitivo delle cellule staminali embrionali umane. A) qRT-PCR di marcatori rappresentativi DE hESC in cellule esposte a Activin A e Wortmannin per 4 giorni. Risultati ar<html> e normalizzati rispetto al hESC indifferenziata. B) Sox17 colorazione (verde) e DAPI (blu) mostrano l&#39;espressione nucleare di Sox17. Scale bar: 50 micron. <img alt="Figura 3." src="/files/ftp_upload/3759/3759fig3.jpg" /> Figura 3. Progenitore induzione pancreatica delle cellule staminali embrionali derivate cellule endoderma. A) qRT-PCR di marcatori precoci in cellule pancreatiche endoderma hESC derivate esposti all&#39;acido retinoico cyclopamine e per 4 giorni dopo l&#39;induzione DE. Risultati normalizzati rispetto al hESC indifferenziata. B) Pdx1 colorazione (viola) e DAPI (blu) mostrano l&#39;espressione nucleare di Pdx1. Scale bar: 50 micron. &quot;&gt; <img alt="Figura 4." src="/files/ftp_upload/3759/3759fig4.jpg" /> Figura 4. Fase di maturazione pancreatica A) qRT-PCR degli ormoni pancreatici in hESC dopo la maturazione del pancreas con DAPT, contattare il co-coltura o di co-cultura dei media (controllo). Risultati normalizzati rispetto al hESC indifferenziata. valori di p ottenuti dallo studente t-test. B) Co-coltura con Dil-Ac-LDL marcato RHMVEC (Red) mostrano regioni in cui EC fissano alla piastra se ci sono spazi vuoti (in alto), RHMVEC altri si possono trovare a diretto contatto con la differenziazione ESC (in basso). C) C-peptide (verde) colorazione di cellule differenziate con co-coltura metodo. Scale bar: 12,5 micron (Top) e 50 micron (basso) D) immunocolorazione RHMVEC dimostra nessuna espressione insulina nel RHMVEC. <table border="1"><tbody><tr><td> Marcatore </td><td> Primer1 (5 &#39;a 3&#39;) &lt;/ Td&gt; <td> Primer2 (5 &#39;a 3&#39;) </td><td> Ref </td></tr><tr><td> SOX17 </td><td> CTCTGCCTCCTCCACGAA </td><td> CAGAATCCAGACCTGCACAA </td><td> 12 </td></tr><tr><td> CXCR4 </td><td> CACCGCATCTGGAGAACCA </td><td> GCCCATTTCCTCGGTGTAGTT </td><td> 4 </td></tr><tr><td> FOXA2 </td><td> GGAGCGGTGAAGATGGAA </td><td> TACGTGTTCATGCCGTTCAT </td><td> 12 </td></tr><tr><td> Pdx1 </td><td> AAGTCTACCAAAGCTCACGCG </td><td> GTAGGCGCCGCCTGC </td><td> 4 </td></tr><tr><td> PTF1 </td><td> CATAGAGAACGAAACCACCCTTTGAG </td><td> GCACGGAGTTTCCTGGACAGAGTTC </td><td> 12 </td></tr><tr><td> HLXB9 </td><td> CACCGCGGGCATGATC </td><td> ACTTCCCCAGGAGGTTCGA </td><td> 4 </td></tr><tr><td> HNF6 </td><td> TGTGGAAGTGGCTGCAGGA </td><td> TGTGAAGACCAACCTGGGCT </td><td> 5 </td></tr><tr><td> PAX6 </td><td> CGAATTCTGCAGGTGTCCAA </td><td> ACAGACCCCCTCGGACAGTAAT </td><td> 5 </td></tr><tr><td> NKX6.1 </td><td> AGACCCACTTTTTCCGGACA </td><td> CCAACGAATAGGCCAAACGA </td><td> 5 </td></tr><tr><td> ISL1 </td><td> GATCTATGTCACCTCGCAAGG </td><td> TACAACCACCATTTCACTG </td><td> 12 </td></tr><tr><td> Glucagone </td><td> AGGCAGACCCACTCAGTGA </td><td> AACAATGGCGACCTCTTCTG </td><td> 4 </td></tr><tr><td> INSULINA </td><td> AAGAGGCCATCAAGCAGATCA </td><td> CAGGAGGCGCATCCACA </td><td> 12 </td></tr></tbody></table> Primer Tabella 1. Utilizzato per le reazioni qPCR.

<ol>
	<li>De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Les+cellules+souches+embryonnaires+humaines+:+de+la+transgression+de+l'embryon+humain+&#225;+la+m&#233;decine+r&#233;g&#233;n&#233;ratrice+de+demain.">Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain &#225; la m&#233;decine r&#233;g&#233;n&#233;ratrice de demain.</a> Gyn&#233;cologie Obst&#233;trique &#38; Fertilit&#233;. 37, 620-626 (2009).</li><li>Murtaugh, L. C., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes,+Signals,+and+Lineages+in+Pancreas+Development.">Genes, Signals, and Lineages in Pancreas Development.</a> Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).</li><li>Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+definitive+endoderm+from+embryonic+stem+cells+in+culture.">Development of definitive endoderm from embryonic stem cells in culture.</a> Development. 131, 1651-1662 (2004).</li><li>D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat. Biotech. 24, 1392-1401 (2006).</li><li>Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+differentiation+of+human+ES+cells+and+iPS+cells+into+mature+pancreatic+insulin-producing+cells.">Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells.</a> Cell Res. 19, 429-438 (2009).</li><li>Basma, H., Soto-Guti&#233;rrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+and+Transplantation+of+Human+Embryonic+Stem+Cell-Derived+Hepatocytes.">Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes.</a> Gastroenterology. 136, 990-999 (2009).</li><li>Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -. P., Chipperfield, H., Tan, E. -. K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+Differentiation+of+Human+Embryonic+Stem+Cells+into+the+Pancreatic+Endocrine+Lineage.">Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage.</a> Stem Cells and Development. 16, 561-578 (2007).</li><li>Kim, S. K., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pancreas+development+is+promoted+by+cyclopamine,+a+Hedgehog+signaling+inhibitor.">Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor.</a> Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).</li><li>Docherty, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+and+development+of+the+islets+of+Langerhans:+implications+for+the+treatment+of+diabetes+mellitus.">Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus.</a> Current Opinion in Pharmacology. 1, 641-649 (2001).</li><li>Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., F&#228;ssler, R., Gu, G., Gerber, H. -. P., Ferrara, N., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Vascular+Basement+Membrane:+A+Niche+for+Insulin+Gene+Expression+and+[beta]&gt;+Cell+Proliferation.">The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]&gt; Cell Proliferation.</a> Developmental Cell. 10, 397-405 (2006).</li><li>Yoshitomi, H., Zaret, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+cell+interactions+initiate+dorsal+pancreas+development+by+selectively+inducing+the+transcription+factor+Ptf1a.">Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a.</a> Development. 131, 807-817 (2004).</li><li>Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Marked+differences+in+differentiation+propensity+among+human+embryonic+stem+cell+lines.">Marked differences in differentiation propensity among human embryonic stem cell lines.</a> Nat. Biotech. 26, 313-315 (2008).</li><li>Banerjee, I., Sharma, N., Yarmush, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+co-culture+on+pancreatic+differentiation+of+embryonic+stem+cells.">Impact of co-culture on pancreatic differentiation of embryonic stem cells.</a> J. Tissue Eng. Regen. Med. 5, 313-323 (2010).</li></ol>

Non abbiamo nulla da rivelare.

Durante lo sviluppo del pancreas, le cellule pancreatiche di differenziazione sono in stretta vicinanza con le cellule endoteliali della aorta, inoltre, isole pancreatiche sono densamente vascolarizzati per promuovere lo scambio rapido di glucosio nel sangue e ormoni insulari. Dati questi fatti, non è sorprendente che le cellule endoteliali svolgono un ruolo importante nel processo di organogenesi pancreatica. Mentre l&#39;importanza di cellule endoteliali durante lo sviluppo del pancreas è sempre più apprezzato, il ...

<table border="1"><tbody><tr><td> Nome del reattivo </td><td> Azienda </td><td> Numero di catalogo </td><td> Concentrazioni </td></tr><tr><td> mTeSR1 (con supplemento) </td><td> Tecnologie di cellule staminali </td><td> 5850 </td><td></td></tr><tr><td> hESC qualificato matrigel </td><td> BD Biosciences </td><td> 354277 </td><td></td></tr><tr><td> DMEM: F12 </td><td> Invitrogen </td><td> 11330-032 </td><td></td></tr><tr><td> MCDB-131 </td><td> Invitrogen </td><td> 10372019 </td><td></td></tr><tr><td> MCDB-131 (Complete) </td><td> VEC Technologies </td><td> MCDB-131 </td><td></td></tr><tr><td> B27 Supplemento </td><td> Invitrogen </td><td> 17504044 </td><td></td></tr><tr><td> A Activin </td><td> R &amp; D </td><td> <a href="http://www.rndsystems.com/pdf/338-ac.pdf">338-AC</a> </td><td> 100ng/ml </td></tr><tr><td> Wortmannin </td><td> Invitrogen </td><td> W3144 </td><td> 1 pm </td></tr><tr><td> KAAD-Cyclopamie </td><td> Sigma-Aldrich </td><td> C4116 </td><td> 0.2μM </td></tr><tr><td> Acido all-trans retinoico </td><td> Sigma-Aldrich </td><td> R2625 </td><td> 2μM </td></tr><tr><td> DAPT </td><td> Sigma-Aldrich </td><td> D5942 </td><td> 30 um </td></tr><tr><td> Nicotinamide </td><td> Sigma-Aldrich </td><td> N0636 </td><td> 10 mM </td></tr><tr><td> Sodio Selenite </td><td> Sigma-Aldrich </td><td> S5261 </td><td> 30 nM </td></tr><tr><td> Insulina </td><td> Sigma-Aldrich </td><td> I1882 </td><td> 25 pg / ml </td></tr><tr><td> Transferrina </td><td> Sigma-Aldrich </td><td> T8158 </td><td> 50 ug / ml </td></tr><tr><td> EGF </td><td> R &amp; D </td><td> <a href="http://www.rndsystems.com/pdf/236-eg.pdf">236-EG</a> </td><td> 10ng/ml </td></tr><tr><td> EndoGro </td><td> VEC Technologies </td><td> ENDOGRO </td><td> 10mg </td></tr><tr><td> Eparina </td><td> Sigma-Aldrich </td><td> H3149 </td><td> 90μg/ml </td></tr><tr><td> Idrocortisone </td><td> Sigma-Aldrich </td><td> H0888 </td><td> 1μg/ml </td></tr><tr><td> NucleoSpin RNA II </td><td> Macherey Nagel </td><td> 740955 </td><td></td></tr><tr><td> ImProm II sistema di trascrizione inversa </td><td> Promega </td><td> A3800 </td><td></td></tr><tr><td> II Brilliant SYBR Green QPCR master mix </td><td> Straragene </td><td> 600548 </td><td></td></tr><tr><td> Sox17 policlonale di capra IgG </td><td> Santa Cruz </td><td> sc-17355 </td><td> 1/500 </td></tr><tr><td> Pdx1 policlonale di capra IgG </td><td> Santa Cruz </td><td> sc-14662 </td><td> 1/500 </td></tr><tr><td> C-Peptide policlonale di coniglio </td><td> Segnalazione cellulare </td><td> 4593 </td><td> 1/500 </td></tr><tr><td> Alexa Fluor 488 asino anti-IgG di coniglio </td><td> Invitrogen </td><td> A-21.206 </td><td> 1/1000 </td></tr><tr><td> Alexa Fluor 647 asino anti-IgG di capra </td><td> Invitrogen </td><td> A-21.447 </td><td> 1/1000 </td></tr></tbody></table> Tabella 2. Reagenti e kit.

endothelial cell co-culture mediates maturation of human embryonic stem cell to pancreatic insulin producing cells in a directed differentiation approach

Le cellule staminali embrionali (ESC) hanno due caratteristiche principali: possono essere a tempo indeterminato propagate in vitro in uno stato indifferenziato e sono pluripotenti, avendo così la potenzialità di differenziarsi in diversi lignaggi. Tali proprietà rendono CES estremamente attraente per la terapia cellulare a base e le applicazioni di trattamento di rigenerazione 1. Tuttavia, per il suo pieno potenziale da realizzare le cellule devono essere differenziate in fenotipi maturi e funzionale, che è un compito scoraggiante. Un approccio promettente per indurre la differenziazione cellulare è imitare al cammino dell&#39;organogenesi nell&#39;impostazione in vitro. Sviluppo del pancreas si verifica in 2 fasi specifiche, a cominciare da endoderma, che può svilupparsi in diversi organi, compreso fegato e pancreas. Endoderma induzione può essere ottenuto mediante la modulazione del percorso nodale aggiunta di Activin A 3 in combinazione con diversi fattori di crescita 4-7 </sup&gt;. Cellule endoderma definitive quindi sottoposti impegno pancreatica mediante inibizione di inibizione hedgehog sonic, che può essere ottenuto in vitro mediante l&#39;aggiunta di cyclopamine 8. La maturazione del pancreas è mediata da numerosi eventi collaterali tra cui l&#39;inibizione del segnale di Notch, l&#39;aggregazione di cellule progenitrici del pancreas in 3-dimensionali cluster; induzione di vascolarizzazione, solo per citarne alcuni. Di gran lunga il maggior successo nella maturazione in vitro delle cellule pancreatiche progenitrici derivate CES sono stati raggiunti attraverso l&#39;inibizione del segnale di Notch dal completamento DAPT 9. Malgrado il successo, questo si traduce in bassa resa del fenotipo maturo con funzionalità ridotte. Una zona meno studiato è l&#39;effetto di segnalazione delle cellule endoteliali nella maturazione del pancreas, che è sempre più apprezzato come un fattore importante che contribuisce in in-vivo maturazione di isole pancreatiche 10,11. Il presente studio esamina tale effetto di endothelIAL di segnalazione delle cellule nella maturazione di cellule pancreatiche progenitrici derivate dal Comitato in isole pancreatiche produttrici di insulina come le cellule. Riportiamo un multi-stadio protocollo di differenziazione diretta dove i CES umani vengono prima indotti verso endoderma da Activin A insieme con l&#39;inibizione della via PI3K. Specifica delle cellule del pancreas endoderma si ottiene l&#39;inibizione di sonic hedgehog segnalazione da Cyclopamine insieme con l&#39;induzione dei retinoidi mediante aggiunta di acido retinoico. La fase finale di maturazione viene indotta da segnalazione cellulare endoteliale raggiunti da una co-coltura configurazione. Mentre diverse cellule endoteliali sono stati testati in co-coltura, qui vi presentiamo i nostri dati con le cellule del cuore di ratto endoteliali microvascolari (RHMVEC), principalmente per la facilità di analisi.

Watch this Scientific Journal Video about Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach at J

Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

Il presente studio descrive un approccio diretto differenziazione nell&#39;indurre la differenziazione pancreatica di cellule staminali embrionali umane. Di grande importanza è la scoperta che cellule endoteliali co-coltura maturazione media di cellule staminali umane embrionali derivano in cellule progenitrici del pancreas di insulina che esprimono.

Delle cellule endoteliali Co-cultura Maturazione media di Cellule Staminali embrionali umane a cellule pancreas che producono insulina in un approccio di differenziazione Regia

Embryonic stem cells (ESC) have two main characteristics: they can be indefinitely propagated in vitro in an undifferentiated state and they are ...

endothelial-cell-co-culture-mediates-maturation-human-embryonic-stem

Research

JoVE Journal

Biology

16.2K Views.  University of Pittsburgh. Il presente studio descrive un approccio diretto differenziazione nell'indurre la differenziazione pancreatica di cellule staminali embrionali umane. Di grande importanza è la scoperta che cellule endoteliali co-coltura maturazione media di cellule staminali umane embrionali derivano in cellule progenitrici del pancreas di insulina che esprimono.

Video: Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

Derivation of Hematopoietic Stem Cells from Murine Embryonic Stem Cells

A stem cell is defined as a cell with the capacity to both self-renew and generate multiple differentiated progeny.  Embryonic stem cells (ESC) are derived from the blastocyst of the early embryo and are pluripotent in differentiative ability.  Their vast differentiative potential has made them the focus of much research centered on deducing how to coax them to generate clinically useful cell types.  The successful derivation of hematopoietic stem cells (HSC) from mouse ESC has recently been accomplished and can be visualized in this video protocol.  HSC, arguably the most clinically exploited cell population, are used to treat a myriad of hematopoietic malignancies and disorders.  However, many patients that might benefit from HSC therapy lack access to suitable donors.  ESC could provide an alternative source of HSC for these patients.  The following protocol establishes a baseline from which ESC-HSC can be studied and inform efforts to isolate HSC from human ESC.  In this protocol, ESC are differentiated as embryoid bodies (EBs) for 6 days in commercially available serum pre-screened for optimal hematopoietic differentiation.  EBs are then dissociated and infected with retroviral HoxB4.  Infected EB-derived cells are plated on OP9 stroma, a bone marrow stromal cell line derived from the calvaria of  M-CSF-/- mice, and co-cultured in the presence of hematopoiesis promoting cytokines for ten days.  During this co-culture, the infected cells expand greatly, resulting in the generation a heterogeneous pool of 100s of millions of cells.  These cells can then be used to rescue and reconstitute lethally irradiated mice.

This protocol details the derivation of transplantable hematopoietic stem cells from mouse embryonic stem cells (ESC) and their subsequent injection into lethally irradiated recipient mice. Briefly, ESC are differentiated as embryoid bodies, which are then infected with retroviral HoxB4 and co-cultured with OP9 stromal cells and hematopoietic cytokines.

Derivazione di cellule staminali ematopoietiche da cellule staminali embrionali murini

A stem cell is defined as a cell with the capacity to both self-renew and generate multiple differentiated progeny.  Embryonic stem cells (ESC) are ...

Ricerca

Biologia

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

Derivazione di cellule staminali embrionali umane da Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Embryonic Stem Cell-Derived Endothelial Cells for Treatment of Hindlimb Ischemia

Peripheral arterial disease (PAD) results from narrowing of the peripheral arteries that supply oxygenated blood and nutrients to the legs and feet, This pathology causes symptoms such as intermittent claudication (pain with walking), painful ischemic ulcerations, or even limb-threatening gangrene. It is generally believed that the vascular endothelium, a monolayer of endothelial cells that invests the luminal surface of all blood and lymphatic vessels, plays a dominant role in vascular homeostasis and vascular regeneration. As a result, stem cell-based regeneration of the endothelium may be a promising approach for treating PAD.In this video, we demonstrate the transplantation of embryonic stem cell (ESC)-derived endothelial cells for treatment of unilateral hindimb ischemia as a model of PAD, followed by non-invasive tracking of cell homing and survival by bioluminescence imaging. The specific materials and procedures for cell delivery and imaging will be described. This protocol follows another publication in describing the induction of hindlimb ischemia by Niiyama et al.1

The surgical procedure for delivery of embryonic stem cell-derived endothelial cells to the ischemic hindlimb is demonstrated, with non-invasive tracking by bioluminescence imaging.

Cellule embrionali staminali endoteliali derivati ​​dalle cellule per il trattamento di ischemia degli arti posteriori

Peripheral arterial disease (PAD) results from narrowing of the peripheral arteries that supply oxygenated blood and nutrients to the legs and feet, This ...

Isolation and Large Scale Expansion of Adult Human Endothelial Colony Forming Progenitor Cells

This paper introduces a novel recovery strategy for endothelial colony forming progenitor cells (ECFCs) from heparinized but otherwise unmanipulated adult human peripheral blood within a mean of 12 days. After large scale expansion &gt;1x108 ECFCs can be obtained for further tests. Advantageously by using pHPL the contact of human cells with bovine serum antigens can be excluded. By flow cytometry and immunohistochemistry the isolated cells can be characterized as ECFC and their in vitro functionality to form vascular like structures can be tested in a matrigel assay. Further these cells can be subcutaneously injected in a mouse model to form functional, perfused vessels in vivo. After long term expansion and cryopreservation proliferation, function and genomic stability appear to be preserved. 3,4
This animal-protein free isolation and expansion method is easily applicable to generate a large quantity of ECFCs.

Endothelial colony forming progenitor cells (ECFCs) are a promising tool to study vascular homeostasis and repair.1,2 This paper introduces a novel animal-serum free method for isolation and expansion of ECFC from heparinised adult human peripheral blood with pooled human platelet lysate (pHPL) diminishing the risk of anti-bovine immunisation.

Isolamento e di espansione su vasta scala di umano adulto cellule progenitrici endoteliali che formano colonie

This paper introduces a novel recovery strategy for endothelial colony forming progenitor cells (ECFCs) from heparinized but otherwise unmanipulated adult ...

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells (MSCs) and Endothelial Colony Forming Progenitor Cells (ECFCs)

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal stem cells, MSCs) and endothelial colony forming progenitor cells (ECFCs). Both cell types are key players in maintaining the integrity of tissue and are probably also involved in regenerative processes and tumor formation.
To study their biology and function in a comparative manner it is important to have both cells types available from the same donor. It may also be beneficial for regenerative purposes to derive MSCs and ECFCs from the same tissue.
Because cellular therapeutics should eventually find their way from bench to bedside we established a new method to isolate and further expand progenitor cells without the use of animal protein. Pooled human platelet lysate (pHPL) replaced fetal bovine serum in all steps of our protocol to completely avoid contact of the cells to xenogeneic proteins.
This video demonstrates a methodology for the isolation and expansion of progenitor cells from one umbilical cord.
All materials and procedures will be described.

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells MSCs and Endothelial Colony Forming Progenitor Cells ECFCs

This protocol describes the isolation and subsequent expansion of mesenchymal stromal cells and endothelial colony forming cells without the use of animal serum to generate autologous pairs for experimental transplantation purposes.

Isolamento e di espansione degli animali siero gratuito di cordone ombelicale umano derivato cellule stromali mesenchimali (MSC) e cellule endoteliali progenitrici formanti colonia (ECFCs)

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal ...

Video Bioinformatics Analysis of Human Embryonic Stem Cell Colony Growth

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer software.  Video bioinformatics is a powerful quantitative approach for extracting spatio-temporal data from video images using computer software to perform dating mining and analysis. In this article, we introduce a video bioinformatics method for quantifying the growth of human embryonic stem cells (hESC) by analyzing time-lapse videos collected in a Nikon BioStation CT incubator equipped with a camera for video imaging. In our experiments, hESC colonies that were attached to Matrigel were filmed for 48 hours in the BioStation CT.  To determine the rate of growth of these colonies, recipes were developed using CL-Quant software which enables users to extract various types of data from video images.  To accurately evaluate colony growth, three recipes were created. The first segmented the image into the colony and background, the second enhanced the image to define colonies throughout the video sequence accurately, and the third measured the number of pixels in the colony over time.  The three recipes were run in sequence on video data collected in a BioStation CT to analyze the rate of growth of individual hESC colonies over 48 hours. To verify the truthfulness of the CL-Quant recipes, the same data were analyzed manually using Adobe Photoshop software. When the data obtained using the CL-Quant recipes and Photoshop were compared, results were virtually identical, indicating the CL-Quant recipes were truthful. The method described here could be applied to any video data to measure growth rates of hESC or other cells that grow in colonies. In addition, other video bioinformatics recipes can be developed in the future for other cell processes such as migration, apoptosis, and cell adhesion.  

Video bioinformatics is the automated processing, analysis, understanding, and data mining of biological spatio-temporal data extracted from microscopic videos. The purpose of this article is to demonstrate a method for measuring human embryonic stem cell colony growth using a video bioinformatics method.

Video Bioinformatica Analisi delle embrionali umane crescita Colony cellule staminali

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

Differenziazione delle cellule staminali embrionali in precursori degli oligodendrociti

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Mappatura destino di cellule staminali embrionali umane per la formazione teratoma

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three ...

Efficient Derivation of Human Cardiac Precursors and Cardiomyocytes from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based transplantation or by cardiac tissue engineering1-3. Cardiomyocytes become terminally-differentiated soon after birth and lose their ability to proliferate. There is no evidence that stem/progenitor cells derived from other sources, such as the bone marrow or the cord blood, are able to give rise to the contractile heart muscle cells following transplantation into the heart1-3. The need to regenerate or repair the damaged heart muscle has not been met by adult stem cell therapy, either endogenous or via cell delivery1-3. The genetically stable human embryonic stem cells (hESCs) have unlimited expansion ability and unrestricted plasticity, proffering a pluripotent reservoir for in vitro derivation of large supplies of human somatic cells that are restricted to the lineage in need of repair and regeneration4,5. Due to the prevalence of cardiovascular disease worldwide and acute shortage of donor organs, there is intense interest in developing hESC-based therapies as an alternative approach. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity6-8 (see a schematic in Fig. 1A). In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic9-11. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules12 (see a schematic in Fig. 1B). After screening a variety of small molecules and growth factors, we found that such defined conditions rendered nicotinamide (NAM) sufficient to induce the specification of cardiomesoderm direct from pluripotent hESCs that further progressed to cardioblasts that generated human beating cardiomyocytes with high efficiency (Fig. 2). We defined conditions for induction of cardioblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human cardiac cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of cardioblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human cardiac progenitors and functional cardiomyocytes for cardiovascular repair.

Derivazione efficiente dei diritti dell&#39;uomo e precursori cardiaci e cardiomiociti pluripotenti da cellule staminali embrionali umane con induzione piccole molecole

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based ...

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells (iPSCs) Using Retroviral Vector with GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has been previously shown that human somatic cells can be reprogrammed to pluripotency by ectopic expression of four transcription factors (Oct4, Sox2, Klf4 and Myc) and become induced pluripotent stem cells (iPSCs)2-4 . Like hESCs, human iPSCs are pluripotent and a potential source for autologous cells. Here we describe the protocol to reprogram human fibroblast cells with the four reprogramming factors cloned into GFP-containing retroviral backbone4. Using the following protocol, we generate human iPSCs in 3-4 weeks under human ESC culture condition. Human iPSC colonies closely resemble hESCs in morphology and display the loss of GFP fluorescence as a result of retroviral transgene silencing. iPSC colonies isolated mechanically under a fluorescence microscope behave in a similar fashion as hESCs. In these cells, we detect the expression of multiple pluripotency genes and surface markers.

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells iPSCs Using Retroviral Vector with GFP

A method to generate human induced pluripotent stem cells (iPSCs) via retrovirus-mediated ectopic expression of OCT4, SOX2, KLF4 and MYC is described. A practical way to identify human iPSC colonies based on GFP expression is also discussed.

Riprogrammare cellule somatiche umane in cellule staminali pluripotenti indotte (iPSCs) Utilizzo vettore retrovirale con GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has ...