We thank T. Ito, K. Hiramatsu, R. Daum, H. de Lencastre, and D. Coleman for the kind gift of some reference strains used in this study. This work was in part supported financially by the Centre for Antimicrobial Resistance (CAR), Alberta Health Services-Calgary/Calgary Laboratory Services/University of Calgary.

Queste procedure devono essere effettuate in un laboratorio certificato di livello 2 di biosicurezza. Adeguati dispositivi di protezione individuale, come guanti e camici da laboratorio deve essere utilizzato in ogni momento. 1. Preparazione del campione <ol><li> Sono tenuti fresche durante la notte culture piastra di MRSA. Il giorno prima della PCR deve essere fatto, selezionare una singola colonia di MRSA con una cultura bastoncino sterile e preparare una pesante striscia di batteri su una piastra di Tryptic Soy Agar (TSA). Campioni multipli possono essere strisciati su un singolo piatto. Incubare per una notte a 37

<ol>
	<li>IWG-SCC. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Classification+of+staphylococcal+cassette+chromosome+mec+(SCCmec):+guidelines+for+reporting+novel+SCCmec+elements.">Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements.</a> Antimicrobial Agents and Chemotherapy. 53 (12), 4961-4967 (2009).</li><li>Ito, T., Hiramatsu, K., Tomasz, A., de Lencastre, H., Perreten, V., Holden, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guidelines+for+Reporting+Novel+mecA+Gene+Homologues.">Guidelines for Reporting Novel mecA Gene Homologues.</a> Antimicrobial Agents and Chemotherapy. 56 (10), 4997-4999 (2012).</li><li>Okuma, K., Iwakawa, K., Turnidge, J. D., Grubb, W. B., Bell, J. M., O'Brien, F. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissemination+of+new+methicillin-resistant+Staphylococcus+aureus+clones+in+the+community.">Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community.</a> Journal of Clinical Microbiology. 40 (11), 4289-4294 (2002).</li><li>Kondo, Y., Ito, T., Ma, X. X., Watanabe, S., Kreiswirth, B. N., Etienne, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combination+of+multiplex+PCRs+for+staphylococcal+cassette+chromosome+mec+type+assignment:+rapid+identification+system+for+mec,+ccr,+and+major+differences+in+junkyard+regions.">Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions.</a> Antimicrobial Agents and Chemotherapy. 51 (1), 264-274 (2007).</li><li>Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+PCR+strategy+for+rapid+identification+of+structural+types+and+variants+of+the+mec+element+in+methicillin-resistant+Staphylococcus+aureus.">Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 46 (7), 2155-2161 (2002).</li><li>Milheirico, C., Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Update+to+the+multiplex+PCR+strategy+for+assignment+of+mec+element+types+in+Staphylococcus+aureus.">Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 51 (9), 3374-3377 (2007).</li><li>Milheirico, C., Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+PCR+strategy+for+subtyping+the+staphylococcal+cassette+chromosome+mec+type+IV+in+methicillin-resistant+Staphylococcus+aureus:+'SCCmec+IV+multiplex'.">Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus: 'SCCmec IV multiplex'.</a> Journal of Antimicrobial Chemotherapy. 60 (1), 42-48 (2007).</li><li>Zhang, K., McClure, J. A., Elsayed, S., Louie, T., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+multiplex+PCR+assay+for+characterization+and+concomitant+subtyping+of+staphylococcal+cassette+chromosome+mec+types+I+to+V+in+methicillin-resistant+Staphylococcus+aureus.">Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus.</a> Journal of Clinical Microbiology. 43 (10), 5026-5033 (2005).</li><li>Zhang, K., McClure, J. A., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+multiplex+PCR+assay+for+typing+of+staphylococcal+cassette+chromosome+mec+types+I+to+V+in+methicillin-resistant+Staphylococcus+aureus.">Enhanced multiplex PCR assay for typing of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus.</a> Molecular and Cellular Probes. 26 (5), 218-221 (2012).</li><li>de Lamballerie, X., Zandotti, C., Vignoli, C., Bollet, C., de Micco, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one-step+microbial+DNA+extraction+method+using+"Chelex+100"+suitable+for+gene+amplification.">A one-step microbial DNA extraction method using "Chelex 100" suitable for gene amplification.</a> Research in Microbiology. 143 (8), 785-790 (1992).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J. Vis. Exp. (62), e3923 (2012).</li><li>McClure, J. A., Conly, J. M., Elsayed, S., Zhang, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+PCR+assay+to+facilitate+identification+of+the+recently+described+Staphylococcal+cassette+chromosome+mec+type+VIII.">Multiplex PCR assay to facilitate identification of the recently described Staphylococcal cassette chromosome mec type VIII.</a> Molecular and Cellular Probes. 24 (4), 229-232 (2010).</li><li>Zhang, K., McClure, J. A., Elsayed, S., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+staphylococcal+cassette+chromosome+mec+type,+tentatively+designated+type+VIII,+harboring+class+A+mec+and+type+4+ccr+gene+complexes+in+a+Canadian+epidemic+strain+of+methicillin-resistant+Staphylococcus+aureus.">Novel staphylococcal cassette chromosome mec type, tentatively designated type VIII, harboring class A mec and type 4 ccr gene complexes in a Canadian epidemic strain of methicillin-resistant Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 53 (2), 531-540 (2009).</li></ol>

No conflicts of interest declared.

The multiplex PCR assay described here provides a simple, reliable method for classifying types and major subtypes of SCCmec I-V in Staphylococci, with simultaneous discrimination of MRSA from MSSA. The assay is robust, conveniently done in a single PCR reaction and results are easy to interpret. The assay does have limitations in that it targets individual loci within each SCCmec type, but does not offer comprehensive ccr and mec complex typing, and therefore cannot be considered a go...

An erratum was issued for: <a href="https://www.jove.com/video/50779/multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec">Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus</a>.&#160; There was a&#160;typo&#160;in Table 1.
In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from:
TTCTCATTGATGCTGAAGCC
To:
GAAACTAGTTATTTCCAACGG

An erratum was issued for: <a href="https://www.jove.com/video/50779/multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec">Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus</a>.&#160; There was a&#160;typo&#160;in Table 1.

Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

Staphylococcus aureus meticillino-resistente (MRSA) ha acquisito e integrato nel suo genoma di un elemento genetico mobile 21-67-kb, definito il stafilococco cassetta cromosoma mec (SCC mec) che ospita la resistenza alla meticillina (mecA) gene e altri fattori determinanti di resistenza agli antibiotici 1 . SCC mec

<table border="1">
		<tbody>
		 <tr>
			<td>Name of Reagent</td>
			<td>Company</td>
			<td>Catalogue Number</td>
		 </tr>
		 <tr>
			<td>Tryptic Soy Agar</td>
			<td>Fisher (BD)</td>
			<td>CA90002-700 (236920)</td>
		 </tr>
		 <tr>
			<td>Sterile distilled water</td>
			<td>Life Technologies</td>
			<td>10977-015</td>
		 </tr>
		 <tr>
			<td>Platinum Taq: including 10x PCR buffer and 50 mM MgCl2</td>
			<td>Life Technologies</td>
			<td>10966-034</td>
		 </tr>
		 <tr>
			<td>100 mM dNTP</td>
			<td>Life Technologies</td>
			<td>10297-018</td>
		 </tr>
		 <tr>
			<td>Tris base</td>
			<td>Sigma-Aldrich</td>
			<td>T6066</td>
		 </tr>
		 <tr>
			<td>Boric acid</td>
			<td>Sigma-Aldrich</td>
			<td>B7901</td>
		 </tr>
		 <tr>
			<td>EDTA</td>
			<td>Life Technologies</td>
			<td>15576-028</td>
		 </tr>
		 <tr>
			<td>Agarose</td>
			<td>Life Technologies</td>
			<td>16500-500</td>
		 </tr>
		 <tr>
			<td>Glycerol</td>
			<td>Life Technologies</td>
			<td>15514-011</td>
		 </tr>
		 <tr>
			<td>Bromophenol blue</td>
			<td>Sigma-Aldrich</td>
			<td>B8026</td>
		 </tr>
		 <tr>
			<td>1Kb+ DNA ladder</td>
			<td>Life Technologies</td>
			<td>10787-026</td>
		 </tr>
		 <tr>
			<td>Ethidium bromide</td>
			<td>Sigma-Aldrich</td>
			<td>E7637</td>
		 </tr>
		 <tr>
			<td>1.5ml Microcentrifuge tubes </td>
			<td>VWR (Axygen Scientific)</td>
			<td>10011-700 </td>
		 </tr>
		 <tr>
			<td>Culture sticks</td>
			<td>VWR</td>
			<td>CA10805-018</td>
		 </tr>
		 <tr>
			<td>PCR tubes</td>
			<td>Diamed</td>
			<td>AD0210-FCN (new #: DIATEC420-1250)</td>
		 </tr>
		 <tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td>5417c</td>
		 </tr>
		 <tr>
			<td>Heat block</td>
			<td>VWR</td>
			<td>13259-030 / 13259-286 </td>
		 </tr>
		 <tr>
			<td>Thermalcycler</td>
			<td>Applied Biosystems (2720)</td>
			<td>4359659 </td>
		 </tr>
		 <tr>
			<td>Horizontal, submersible gel electrophoresis chamber with gel mold</td>
			<td>BioRad</td>
			<td>170-4469</td>
		 </tr>
		 <tr>
			<td>Power supply</td>
			<td>BioRad</td>
			<td>164-5050</td>
		 </tr>
		 <tr>
			<td>Rocker shaker</td>
			<td>VWR</td>
			<td>40000-300 </td>
		 </tr>
		 <tr>
			<td>Molecular Imager Gel Doc System</td>
			<td>BioRad</td>
			<td>1708170 </td>
		 </tr>
		</tbody>
 </table>

multiplex pcr assay for typing of staphylococcal cassette chromosome mec types i to v in methicillin-resistant staphylococcus aureus

Stafilococco Cassette Cromosoma mec (SCC mec) tipizzazione molecolare

This updated M-PCR is able to determine (classify) SCCmec types I-V, as well major subtypes of SCCmec IV. The assay targets unique and specific loci of SCCmec I, II, III, IVa, IVb, IVc, IVd, IVE and V, with concomitant mecA gene detection. Tentative identification of SCCmec VI and VIII is also possible, but would require further testing to confirm. Figure 3 illustrates representative SCCmec I-VI and VIII and the locations of each target within the ele...

Watch this Scientific Journal Video about Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus at JoVE.com

Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

We demonstrate a simple multiplex PCR assay for quick-screening and typing of Staphylococcal Cassette Chromosome mec (SCCmec) types I-V for methicillin-resistant Staphylococcus aureus, and provide some of the vital steps and procedural nuances that make it successful for adapting this assay to individual laboratories.

Multiplex PCR per la tipizzazione di stafilococco cassette cromosomiche Mec Tipi I a V, resistente alla meticillina<em&gt; Staphylococcus aureus</em

Staphylococcal Cassette Chromosome mec (SCCmec) typing  is a very important molecular tool for understanding the epidemiology and  clonal strain ...

multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec

Research

JoVE Journal

Immunology and Infection

Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

11.7K Views.  Alberta Health Services / Calgary Laboratory Services / University of Calgary. We demonstrate a simple multiplex PCR assay for quick-screening and typing of Staphylococcal Cassette Chromosome mec (SCCmec) types I-V for methicillin-resistant Staphylococcus aureus, and provide some of the vital steps and procedural nuances that make it successful for adapting this assay to individual laboratories.

Video: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

The Use of Drip Flow and Rotating Disk Reactors for Staphylococcus aureus Biofilm Analysis

Most microbes in nature are thought to exist as surface-associated communities in biofilms.1 Bacterial biofilms are encased within a matrix and attached to a surface.2 Biofilm formation and development are commonly studied in the laboratory using batch systems such as microtiter plates or flow systems, such as flow-cells. These methodologies are useful for screening mutant and chemical libraries (microtiter plates)3 or growing biofilms for visualization (flow cells)4. Here we present detailed protocols for growing Staphylococcus aureus in two additional types of flow system biofilms: the drip flow biofilm reactor and the rotating disk biofilm reactor.
Drip flow biofilm reactors are designed for the study of biofilms grown under low shear conditions.5 The drip flow reactor consists of four parallel test channels, each capable of holding one standard glass microscope slide sized coupon, or a length of catheter or stint. The drip flow reactor is ideal for microsensor monitoring, general biofilm studies, biofilm cryosectioning samples, high biomass production, medical material evaluations, and indwelling medical device testing.6,7,8,9
The rotating disk reactor consists of a teflon disk containing recesses for removable coupons.10 The removable coupons can by made from any machinable material. The bottom of the rotating disk contains a bar magnet to allow disk rotation to create liquid surface shear across surface-flush coupons. The entire disk containing 18 coupons is placed in a 1000 mL glass side-arm reactor vessel. A liquid growth media is circulated through the vessel while the disk is rotated by a magnetic stirrer. The coupons are removed from the reactor vessel and then scraped to collect the biofilm sample for further study or microscopy imaging. Rotating disc reactors are designed for laboratory evaluations of biocide efficacy, biofilm removal, and performance of anti-fouling materials.9,11,12,13

The Use of Drip Flow and Rotating Disk Reactors for Staphylococcus aureus Biofilm Analysis

Protocols for utilizing open system flow biofilms with drip flow reactors and rotating disk reactors are presented in detail.

L&#39;uso del flusso gocciolamento e Reattori disco rotante per Staphylococcus aureus Analisi Biofilm

Most microbes in nature are thought to exist as surface-associated communities in biofilms.1  Bacterial biofilms are encased within a matrix and attached ...

Ricerca

Immunologia e infezioni

Subcutaneous Infection of Methicillin Resistant Staphylococcus Aureus (MRSA)

MRSA is a worldwide threat to public health, and MRSA skin and soft-tissue infections now account for more than half of all soft-tissue infections in the United States. Among soft-tissue infections, myositis, pyomyositis, and necrotizing fasciitis have been increasingly reported in association with MRSA arising from the community. To understand the interplay between MRSA and host immunity leading to more severe infection, the availability of animal models is critical, permitting the study of host and bacterial factors. Several infection models have been introduced to assess the pathogenesis of S. aureus during superficial skin infection. Here, we describe a subcutaneous infection model that examines the skin, subcutaneous, and muscle pathologies.

Subcutaneous Infection of Methicillin Resistant Staphylococcus Aureus MRSA

Murine skin and soft tissue infection model is utilized for assessing the virulence function of methicillin resistant Staphylococcus aureus (MRSA) and the host immunological responses. Here, we presented a subcutaneous infection model for skin and soft tissue infection.

Sottocutaneo infezione di Staphylococcus aureus meticillino resistente (MRSA)

MRSA is a worldwide threat to public health, and MRSA skin and soft-tissue infections now account for more than half of all soft-tissue infections in the ...

Experimental Endocarditis Model of Methicillin Resistant Staphylococcus aureus (MRSA) in Rat

Endovascular infections, including endocarditis, are life-threatening infectious syndromes1-3. Staphylococcus aureus is the most common world-wide cause of such syndromes with unacceptably high morbidity and mortality even with appropriate antimicrobial agent treatments4-6. The increase in infections due to methicillin-resistant S. aureus (MRSA), the high rates of vancomycin clinical treatment failures and growing problems of linezolid and daptomycin resistance have all further complicated the management of patients with such infections, and led to high healthcare costs7, 8. In addition, it should be emphasized that most recent studies with antibiotic treatment outcomes have been based in clinical settings, and thus might well be influenced by host factors varying from patient-to-patient. Therefore, a relevant animal model of endovascular infection in which host factors are similar from animal-to-animal is more crucial to investigate microbial pathogenesis, as well as the efficacy of novel antimicrobial agents. Endocarditis in rat is a well-established experimental animal model that closely approximates human native valve endocarditis. This model has been used to examine the role of particular staphylococcal virulence factors and the efficacy of antibiotic treatment regimens for staphylococcal endocarditis. In this report, we describe the experimental endocarditis model due to MRSA that could be used to investigate bacterial pathogenesis and response to antibiotic treatment.

Experimental Endocarditis Model of Methicillin Resistant Staphylococcus aureus MRSA in Rat

Experimental rat endocarditis model due to methicillin-resistant S. aureus.

Endocardite modello sperimentale di meticillino resistente<em&gt; Staphylococcus aureus</em&gt; (MRSA) in Rat

Endovascular infections, including endocarditis, are life-threatening infectious syndromes1-3. Staphylococcus aureus is the most common world-wide cause ...

Staphylococcus aureus Growth using Human Hemoglobin as an Iron Source

S. aureus is a pathogenic bacterium that requires iron to carry out vital metabolic functions and cause disease. The most abundant reservoir of iron inside the human host is heme, which is the cofactor of hemoglobin. To acquire iron from hemoglobin, S. aureus utilizes an elaborate system known as the iron-regulated surface determinant (Isd) system1. Components of the Isd system first bind host hemoglobin, then extract and import heme, and finally liberate iron from heme in the bacterial cytoplasm2,3. This pathway has been dissected through numerous in vitro studies4-9. Further, the contribution of the Isd system to infection has been repeatedly demonstrated in mouse models8,10-14. Establishing the contribution of the Isd system to hemoglobin-derived iron acquisition and growth has proven to be more challenging. Growth assays using hemoglobin as a sole iron source are complicated by the instability of commercially available hemoglobin, contaminating free iron in the growth medium, and toxicity associated with iron chelators. Here we present a method that overcomes these limitations. High quality hemoglobin is prepared from fresh blood and is stored in liquid nitrogen. Purified hemoglobin is supplemented into iron-deplete medium mimicking the iron-poor environment encountered by pathogens inside the vertebrate host. By starving S. aureus of free iron and supplementing with a minimally manipulated form of hemoglobin we induce growth in a manner that is entirely dependent on the ability to bind hemoglobin, extract heme, pass heme through the bacterial cell envelope and degrade heme in the cytoplasm. This assay will be useful for researchers seeking to elucidate the mechanisms of hemoglobin-/heme-derived iron acquisition in S. aureus and possibly other bacterial pathogens.

Staphylococcus aureus Growth using Human Hemoglobin as an Iron Source

Here we describe a growth assay for Staphylococcus aureus using hemoglobin as the sole source of available nutrient iron. This assay establishes the role of bacterial factors involved in hemoglobin-derived iron acquisition.

Staphylococcus aureus crescita con emoglobina umana come fonte di ferro

S. aureus is a pathogenic bacterium that requires iron to  carry out vital metabolic functions and cause disease. The most abundant  reservoir of iron ...

Studying Interactions of Staphylococcus aureus with Neutrophils by Flow Cytometry and Time Lapse Microscopy

We present methods to study the effect of phenol soluble modulins (PSMs) and other toxins produced and secreted by Staphylococcus aureus on neutrophils. To study the effects of the PSMs on neutrophils we isolate fresh neutrophils using density gradient centrifugation. These neutrophils are loaded with a dye that fluoresces upon calcium mobilization. The activation of neutrophils by PSMs initiates a rapid and transient increase in the free intracellular calcium concentration. In a flow cytometry experiment this rapid mobilization can be measured by monitoring the fluorescence of a pre-loaded dye that reacts to the increased concentration of free Ca2+. Using this method we can determine the PSM concentration necessary to activate the neutrophil, and measure the effects of specific and general inhibitors of the neutrophil activation.	
	To investigate the expression of the PSMs in the intracellular space, we have constructed reporter fusions of the promoter of the PSM&alpha; operon to GFP. When these reporter strains of S. aureus are phagocytosed by neutrophils, the induction of expression can be observed using fluorescence microscopy.

Studying Interactions of Staphylococcus aureus with Neutrophils by Flow Cytometry and Time Lapse Microscopy

We present methods to study the effect of PSMs and other toxins secreted by Staphylococcus aureus on neutrophils using flow cytometry and fluorescence microscopy.

Lo studio delle interazioni di<em&gt; Staphylococcus aureus</em&gt; Con neutrofili mediante citometria a flusso e Time Lapse Microscopy

We present methods to study the effect of phenol soluble modulins (PSMs)  and other toxins produced and secreted by Staphylococcus  aureus on neutrophils. ...

2D and 3D Chromosome Painting in Malaria Mosquitoes

Fluorescent in situ hybridization (FISH) of whole arm chromosome probes is a robust technique for mapping genomic regions of interest, detecting chromosomal rearrangements, and studying three-dimensional (3D) organization of chromosomes in the cell nucleus. The advent of laser capture microdissection (LCM) and whole genome amplification (WGA) allows obtaining large quantities of DNA from single cells. The increased sensitivity of WGA kits prompted us to develop chromosome paints and to use them for exploring chromosome organization and evolution in non-model organisms. Here, we present a simple method for isolating and amplifying the euchromatic segments of single polytene chromosome arms from ovarian nurse cells of the African malaria mosquito Anopheles gambiae. This procedure provides an efficient platform for obtaining chromosome paints, while reducing the overall risk of introducing foreign DNA to the sample. The use of WGA allows for several rounds of re-amplification, resulting in high quantities of DNA that can be utilized for multiple experiments, including 2D and 3D FISH. We demonstrated that the developed chromosome paints can be successfully used to establish the correspondence between euchromatic portions of polytene and mitotic chromosome arms in An. gambiae. Overall, the union of LCM and single-chromosome WGA provides an efficient tool for creating significant amounts of target DNA for future cytogenetic and genomic studies.

Chromosome painting is a useful method for studying organization of the cell nucleus and evolution of the karyotype. Here, we demonstrate an approach to isolate and amplify specific regions of interest from single polytene chromosomes that are subsequently used for two- and three-dimensional fluorescent in situ hybridization (FISH).

Pittura cromosoma 2D e 3D nelle zanzare della malaria

Fluorescent in situ hybridization (FISH) of whole arm chromosome probes is a robust technique for mapping genomic regions of interest, detecting ...

High-throughput Quantitative Real-time RT-PCR Assay for Determining Expression Profiles of Types I and III Interferon Subtypes

Described in this report is a qRT-PCR assay for the analysis of seventeen human IFN subtypes in a 384-well plate format that incorporates highly specific locked nucleic acid (LNA) and molecular beacon (MB) probes, transcript standards, automated multichannel pipetting, and plate drying. Determining expression among the type I interferons (IFN), especially the twelve IFN-&#945; subtypes, is limited by their shared sequence identity; likewise, the sequences of the type III IFN, especially IFN-&#955;2 and -&#955;3, are highly similar. This assay provides a reliable, reproducible, and relatively inexpensive means to analyze the expression of the seventeen interferon subtype transcripts.

This protocol describes a high-throughput qRT-PCR assay for the analysis of type I and III IFN expression signatures. The assay discriminates single base pair differences between the highly similar transcripts of these genes. Through batch assembly and robotic pipetting, the assays are consistent and reproducible.

High-throughput Quantitative Real-time RT-PCR test per la determinazione di espressione Profili di tipo I e III interferone sottotipi

Described in this report is a qRT-PCR assay for the analysis of seventeen human IFN subtypes in a 384-well plate format that incorporates highly specific ...

Targeting Biofilm Associated Staphylococcus aureus Using Resazurin Based Drug-susceptibility Assay

Most pathogenic bacteria are able to form biofilms during infection, but due to the difficulty of manipulating and assessing biofilms, the vast majority of laboratory work is conducted with planktonic cells. Here, we describe a peg plate biofilm assay as performed with Staphylococcus aureus. Bacterial biofilms are grown on pegs attached to a 96-well microtiter plate lid, washed through gentle submersion in buffer, and placed in a drug challenge plate. After subsequent incubation they are again washed and moved to a final recovery plate, in which the fluorescent dye resazurin serves as a viability indicator. This assay offers greatly increased ease-of-use, reliability, and reproducibility, as well as a wealth of data when conducted as a kinetic read. Moreover, this assay can be adapted to a medium-throughput drug screening approach by which an endpoint fluorescent readout is taken instead, offering a path for drug discovery efforts.

Targeting Biofilm Associated Staphylococcus aureus Using Resazurin Based Drug-susceptibility Assay

Most bacterial infections produce a biofilm. By virtue of their environment, biofilm associated bacteria are often phenotypically drug resistant. Novel antibacterial molecules that kill bacteria in biofilms are thus a high priority. We establish an assay to quickly screen for antimicrobial compounds that are effective at eradicating biofilms.

Targeting biofilm Associated<em&gt; Staphylococcus aureus</em&gt; Uso resazurina base Assay farmaco-sensibilità

Most pathogenic bacteria are able to form biofilms during infection, but due to the difficulty of manipulating and assessing biofilms, the vast majority ...

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR (RS-PCR)

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, therefore, suitable to be used for routine purposes. For best resolution, data evaluation and data management, a miniaturized electrophoresis system is required. Together with such an electrophoresis system and the in-house developed software (freely available here) assignment of the pattern of bands to a genotype is standardized and straight forward. DNA extraction is simple (boiling prep), setting-up of the reactions is easy and they can be run on any standard PCR machine. PCR cycling is common except prolonged ramping and elongation times. Compared to spa typing and Multi Locus Sequence Typing (MLST), RS-PCR does not require DNA sequencing what simplifies the analysis considerably and allows a high throughput. Furthermore, the resolution for bovine strains of S. aureus is at least as good as spa typing and better than MLST or pulsed-field gel electrophoresis (PFGE). The RS-PCR data base includes presently a total of 141 genotypes and variants. The method is highly associated with the virulence gene pattern, contagiosity and pathogenicity of S. aureus strains involved in bovine mastitis. S. aureus genotype B (GTB) is contagious and causes herds problems causing large costs in the Switzerland and other European countries. All the other genotypes observed in Switzerland infect individual cows and quarters. Genotyping by RS-PCR allows the reliable prediction of the epidemiological and the pathogenic potential of S. aureus involved in bovine intramammary infection (IMI), two key factors for clinical veterinary medicine. Because of these beneficial properties together with moderate costs and a high sample throughput the goal of this publication is to give a detailed, step-by-step protocol for easily establishing and running RS-PCR for genotyping S. aureus in other laboratories.

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR RS-PCR

Here, ribosomal spacer PCR (RS-PCR) is used together with a miniaturized electrophoresis system as a fast and high resolution method for genotyping S. aureus at moderate costs allowing a high throughput.

La genotipizzazione di<em&gt; Staphylococcus aureus</em&gt; Per ribosomiale Spacer PCR (RS-PCR)

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, ...

Methodology for the Study of Horizontal Gene Transfer in Staphylococcus aureus

One important feature of the major opportunistic human pathogen Staphylococcus aureus is its extraordinary ability to rapidly acquire resistance to antibiotics. Genomic studies reveal that S. aureus carries many virulence and resistance genes located in mobile genetic elements, suggesting that horizontal gene transfer (HGT) plays a critical role in S. aureus evolution. However, a full and detailed description of the methodology used to study HGT in S. aureus is still lacking, especially regarding natural transformation, which has been recently reported in this bacterium. This work describes three protocols that are useful for the in vitro investigation of HGT in S. aureus: conjugation, phage transduction, and natural transformation. To this aim, the cfr gene (chloramphenicol/florfenicol resistance), which confers the Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A (PhLOPSA)-resistance phenotype, was used. Understanding the mechanisms through which S. aureus transfers genetic materials to other strains is essential to comprehending the rapid acquisition of resistance and helps to clarify the modes of dissemination reported in surveillance programs or to further predict the spreading mode in the future.

Methodology for the Study of Horizontal Gene Transfer in Staphylococcus aureus

We describe here three different protocols for the in vitro investigation of conjugation, transduction, and natural transformation in Staphylococcus aureus.

Metodologia per lo studio del orizzontale Gene Transfer in<em&gt; Staphylococcus aureus</em

One important feature of the major opportunistic human pathogen Staphylococcus aureus is its extraordinary ability to rapidly acquire resistance to ...