Ringraziamo Gordon Freeman per fornire l&#39;anticorpo blocco anti-PD-L1. Ringraziamo il personale clinico e di laboratorio presso il Massachusetts General Hospital e tutti i partecipanti di studio per il loro prezioso ruolo in questo progetto. Questo studio è stato sostenuto dal National Institute of Allergy e Malattie Infettive dei National Institutes of Health (PO1 AI-080192; DEK), il National Heart Lung and Blood Institute dei National Institutes of Health (RO1 HL-092565; DEK). DEK è supportato da un Research Scholar Premio alla Carriera della Salute Research Fund Quebec (FRQS). FP è supportata da una sovvenzione borsa di studio del General Hospital Comitato Esecutivo del Massachusetts per la ricerca e la Harvard Global Institute Salute (HGHI).

1. Impoverimento e isolamento delle PBMC mediante Ficoll Separazione <ol><li> Deplezione delle cellule T CD8 +, aggiungendo umano CD8 + Depletion Cocktail a 50 microlitri / ml di sangue intero. </li><li> Mescolare bene e incubare per 20 minuti a temperatura ambiente (18-25 ° C). </li><li> Dopo l&#39;incubazione, mescolare sangue intero con HBSS (soluzione salina bilanciata di Hank senza Ca 2 + o Mg 2 +) e strato sopra Histopaque. Spin a 340 rcf per 30 minuti (senza freni, accelerazione lenta). </li><li> Raccogliere PBMC e trasferire in un nuovo conico 50ml. Lavare 2x con 45 ml RPMI 1640 supplementato con 50 UI di penicillina, 50 mg / ml di streptomicina, 2 mM L-glutammina e 1% HEPES facendo girare per 10 min a 340 rcf. </li></ol> 2. Anticorpo Blockade e stimolazione antigene-specifica delle cellule <ol><li> Risospendere le cellule a 2x10 6 per condizione in RPMI 1640 contenente il 10% di siero umano supplementato con 50 UI di penicillina, 50 mg / ml di streptomicina, 2 mM L-glutammina e 1% HEPES,pari a 500 microlitri per ogni condizione. </li><li> Aliquota 500 microlitri di sospensione cellulare per provetta FACS. </li><li> A seconda del percorso studiato, aggiungere PD-L1, IL-10Rα anticorpi bloccanti e / o controlli isotipo a 10 pg / ml e incubare per 15 min a 37 ° C, 5% CO 2. </li><li> Stimolare le cellule con una piscina peptide HIV-1 Gag ad una concentrazione finale di 1 mg / ml / peptide. Includono anche un controllo &quot;nessuno stimolo&quot; per ogni condizione di blocco. Incubare a 37 ° C, 5% CO 2 per 48 ore. </li></ol> 3. Raccolta e analisi del surnatante <ol><li> Dopo 48 ore, centrifugare tubi FACS per 7 minuti a 340 rcf. </li><li> Raccogliere accuratamente 2 x 225 microlitri surnatante in provette Eppendorf per gli array di perline Luminex senza disturbare il pellet. </li><li> Inattivare virus nel supernatante raccolto con 25 microlitri 0,5% Tween-PBS per ottenere una concentrazione finale di 0,05% PBS-Tween. </li><li> Il negozio di raccolta surnatanti che non sono immediately utilizzato in un -80 ° C freezer. </li><li> Misurare le concentrazioni di citochine desiderati utilizzando il kit di Millipore Luminex secondo il protocollo del produttore. </li></ol> 4. Raccolta e analisi fenotipica delle cellule tramite Citometria a Flusso <ol><li> Dopo aver raccolto il surnatante, lavare le cellule in 3 ml di PBS. Spin le cellule per 7 minuti a 340 rcf e decantare lavaggio in eccesso. </li><li> Stain per la redditività con un LIVE / DEAD fissabile Morto Kit Stain cellulare secondo il protocollo del produttore. </li><li> Lavare le cellule in PBS per 7 minuti a 340 rcf e a 4 ° C. Risospendere in 100 microlitri di PBS 1% FBS. </li><li> Se la colorazione per i monociti o altre cellule presentanti l&#39;antigene, i recettori Fc blocco con l&#39;aggiunta di 1,4 ml di FcR blocco reagenti e vortex per miscelare. </li><li> Incubare per 10 minuti a 4 ° C. </li><li> Aggiungere anticorpi di superficie, vortex e incubare per 20 min a 4 ° C al buio. </li><li> Lavare le cellule con PBS 1% FBS, decantare lavaggio in eccesso, e aggiungere 200 microlitri paraformaldeide al 4%. Covarea temperatura ambiente per 20 minuti al buio. </li><li> Lavare le cellule con PBS 1% FBS, risospendere in 250 microlitri di PBS 1% FBS, e di acquisire una multilaser citofluorimetro (es. BD LSRII o Fortessa). </li></ol> 5. Analisi delle celle tramite qRT-PCR <ol><li> Per le cellule non analizzato mediante citometria a flusso: dopo la raccolta surnatante, Lisare le cellule in 300 microlitri Qiagen Buffer RLT contenente 1% di beta-mercaptoetanolo. Se non continuando con protocollo, le cellule possono essere congelati a -80 ° C dopo questo punto. </li><li> Isolare l&#39;RNA utilizzando un kit di isolamento di RNA seguendo il protocollo del produttore. </li><li> Sintetizzare cDNA da RNA utilizzando un kit di sintesi di cDNA seguendo il protocollo del produttore. </li><li> Eseguire la PCR quantitativa utilizzando la tecnologia SYBR Green. </li><li> Creare una miscela di innesco per ciascun primer utilizzati compresi geni housekeeping (ad esempio IL-13, IL-10, IFN-γ, GAPDH) aggiungendo primer per priva di nucleasi acqua per ottenere una concentrazione finale di 10pM. Tenere su ghiaccio. </li><li> Creare un master mix per ogni primer con l&#39;aggiunta di 10,5 microlitri di acqua priva di nucleasi, 12,5 microlitri SYBR green, e 1 microlitri miscela di primer per piastra bene. Tenere su ghiaccio. </li><li> Pipettare 24 microlitri master mix in ogni pozzetto della piastra che verrà utilizzato. </li><li> Aggiungere 1 ml di cDNA a ciascun pozzetto secondo il modello. </li><li> Cap pozzi e piatto di centrifuga per 3 minuti a 800 rcf. </li><li> Eseguire piastra su una macchina qRT-PCR, ad esempio, uno strumento Stratagene Mx3005P. </li></ol> 6. Adattamento per intracellulare di citochine colorazione a 48 ore Aggiungi brefeldina e Monensin 6 ore prima intracellulare di citochine colorazione. Brefeldina viene aggiunto ad una concentrazione di 10 ug / ml mentre Monensina viene aggiunto secondo le istruzioni del produttore. Per comodità, brefeldina può essere aggiunto 12 hr prima di macchiare ad una concentrazione di 5 mg / ml. <ol><li> Dopo macchia di superficie, lavare le cellule con PBS 1% FBS e macchia nelextracellulare citochine come IL-12, IFN-γ e TNF-α utilizzando un kit di fissaggio / Permeabilization soluzioni e protocollo. </li><li> Lavare le cellule, risospendere in 250 microlitri di PBS 1% FBS, ed eseguito su un multilaser citofluorimetro (es. BD LSR II o Fortessa). </li></ol> 7. Adattamento per ordinamento celle <ol><li> 16 ore dopo la stimolazione, macchia per la vitalità usando LIVE / DEAD fissabile Morto Kit Stain cellulare secondo il protocollo del produttore. Mantenere le cellule in ghiaccio durante tutta la procedura. </li><li> Lavare le cellule con PBS per 7 minuti a 340 rcf e a 4 ° C. Risospendere in 100 microlitri di PBS 1% FBS. </li><li> Aggiungi anticorpi di superficie, vortex per miscelare e incubare cellule sul ghiaccio al buio per 20 min. </li><li> Lavare le cellule con PBS 1% FBS a 340 rcf e a 4 ° C e risospendere in 500 ml RPMI freddo 1640 contenente il 10% di siero fetale bovino supplementato con 50 UI di penicillina, 50 mg / ml di streptomicina, 2 mM L-glutammina e 1% HEPES. </li><li> Celle filtranti con 5 ml di polistirolorene tubo a fondo rotondo con tappo Cell-Strainer. </li><li> Preparare le provette di raccolta per l&#39;ordinamento con l&#39;aggiunta di 200 ml RPMI 1640 contenente il 10% siero fetale bovino integrata con 50 UI di penicillina, 50 mg / ml di streptomicina, 2 mM L-glutammina e 1% HEPES a ciascun tubo. Tenere tutte le provette in ghiaccio durante ordinamento. </li><li> In diretta ordinare i sottoinsiemi di cellule di interesse su uno strumento (ad es BD FACS Aria II) che si trova in una struttura attrezzata per materiale a rischio biologico. </li><li> Dopo celle sono state filtrate, posto celle torna in incubatrice per quantità desiderata di tempo e di seguire con l&#39;analisi collezione surnatante / Luminex e analisi collezione pellet di cellule / PCR. </li></ol>

<ol>
	<li>Zajac, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+immune+evasion+due+to+persistence+of+activated+T+cells+without+effector+function.">Viral immune evasion due to persistence of activated T cells without effector function.</a> J. Exp. Med. 188, 2205-2213 (1998).</li><li>Wherry, E. J., Blattman, J. N., Murali-Krishna, K., vander Most, R., Ahmed, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+persistence+alters+CD8+T-cell+immunodominance+and+tissue+distribution+and+results+in+distinct+stages+of+functional+impairment.">Viral persistence alters CD8 T-cell immunodominance and tissue distribution and results in distinct stages of functional impairment.</a> J. Virol. 77, 4911-4927 (2003).</li><li>Kwon, D. S., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+and+detrimental+roles+of+IL-10+in+HIV+pathogenesis.">Protective and detrimental roles of IL-10 in HIV pathogenesis.</a> Eur. Cytokine Netw. 21, 208-214 (2010).</li><li>Porichis, F., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+PD-1+in+HIV+pathogenesis+and+as+target+for+therapy.">Role of PD-1 in HIV pathogenesis and as target for therapy.</a> Curr. HIV/AIDS Rep. 9, 81-90 (2012).</li><li>Wherry, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell+exhaustion.">T cell exhaustion.</a> Nat. 12, 492-499 (2011).</li><li>Trautmann, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upregulation+of+PD-1+expression+on+HIV-specific+CD8++T+cells+leads+to+reversible+immune+dysfunction.">Upregulation of PD-1 expression on HIV-specific CD8+ T cells leads to reversible immune dysfunction.</a> Nat. Med. 12, 1198-1202 (2006).</li><li>Day, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+expression+on+HIV-specific+T+cells+is+associated+with+T-cell+exhaustion+and+disease+progression.">PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression.</a> Nature. 443, 350-354 (2006).</li><li>Brockman, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-10+is+up-regulated+in+multiple+cell+types+during+viremic+HIV+infection+and+reversibly+inhibits+virus-specific+T+cells.">IL-10 is up-regulated in multiple cell types during viremic HIV infection and reversibly inhibits virus-specific T cells.</a> Blood. 114, 346-356 (2009).</li><li>Barber, D. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restoring+function+in+exhausted+CD8+T+cells+during+chronic+viral+infection.">Restoring function in exhausted CD8 T cells during chronic viral infection.</a> Nature. 439, 682-687 (2006).</li><li>Zhang, J. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+up-regulation+is+correlated+with+HIV-specific+memory+CD8++T-cell+exhaustion+in+typical+progressors+but+not+in+long-term+nonprogressors.">PD-1 up-regulation is correlated with HIV-specific memory CD8+ T-cell exhaustion in typical progressors but not in long-term nonprogressors.</a> Blood. 109, 4671-4678 (2007).</li><li>Ndhlovu, Z. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-dimensional+immunomonitoring+models+of+HIV-1-specific+CD8+T-cell+responses+accurately+identify+subjects+achieving+spontaneous+viral+control.">High-dimensional immunomonitoring models of HIV-1-specific CD8 T-cell responses accurately identify subjects achieving spontaneous viral control.</a> Blood. 121, 801-811 (2013).</li><li>Porichis, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Responsiveness+of+HIV-specific+CD4+T+cells+to+PD-1+blockade.">Responsiveness of HIV-specific CD4 T cells to PD-1 blockade.</a> Blood. 118, 965-974 (2011).</li><li>Kwon, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD4++CD25++regulatory+T+cells+impair+HIV-1-specific+CD4+T+cell+responses+by+upregulating+interleukin-10+production+in+monocytes.">CD4+ CD25+ regulatory T cells impair HIV-1-specific CD4 T cell responses by upregulating interleukin-10 production in monocytes.</a> 86, 6586-6594 (2012).</li></ol>

Gli autori dichiarano di non avere interessi finanziari in competizione.

Collezione surnatante è una parte fondamentale di questo progetto sperimentale. Durante la raccolta surnatanti per il dosaggio Luminex, sono state fatte aliquote e conservati a -80 ° C per evitare la degradazione della proteina causa gelo-disgelo. Congelamento e scongelamento può essere processi dure per le proteine, e riducendo al minimo freeze-disgelo, il segnale sarà massimizzata in saggi. Pertanto, è più facile ottenere dati ripetibile e preciso quando si lavora da aliquote che sono stati scongelati freeze-lo ...

Durante le infezioni virali persistenti, specifiche cellule-T virus acquisiscono difetti funzionali in un processo noto come l&#39;esaurimento delle cellule T. All&#39;inizio studi in vivo nel modello murino LCMV di infezione virale cronica indicato che le cellule T virus-specifici esauste una riduzione della funzione citolitica contro cellule infettate da virus, perdono la loro capacità di proliferare e una capacità ridotta di produrre citochine come IL-2, TNF- α e IFN-γ 1,2. Complessa rete di percorsi immunomodulanti, come PD-1 e IL-10, sono upregulated durante le infezioni croniche e contribuire alla disfunzione delle cellule T (recensito in 3,4). Nella somministrazione in vivo di bloccare anticorpi contro queste vie inibitorie nel topo LCMV modello di funzione delle cellule T virus-specifici esaurite e la clearance virale maggiore restaurato, indicando che l&#39;esaurimento delle cellule T è un fenomeno parzialmente reversibile (recensito in 5). Giudizio su °e modello LCMV sono stati rapidamente estesa a infezioni virali croniche umani quali HBV, HCV e HIV 5. In cronica da HIV-1, PD-1 e IL-10 percorsi sono upregulated in soggetti infetti e correlano con parametri di progressione della malattia, direttamente con la carica virale e inversamente con la conta CD4 6-8. Anticorpo blocco dei PD-1 o IL-10 percorsi in vitro restaurato proliferazione di HIV-specifiche cellule T CD4 e CD8 indicano che, simile al modello di topo LCMV, esaurimento delle cellule T nell&#39;uomo è un fenomeno parzialmente reversibile. Tuttavia, a causa della natura delicata di esperimenti su campioni umani nonché limitazioni nella sensibilità dei saggi in vitro, un&#39;indagine approfondita dei profili ripristino funzionale ottenuti da questi interventi è sorprendentemente assente. Saggi di proliferazione sono stati, finora, l&#39;unico test affidabile in vitro testato in maggior parte degli studi, ma vi è una notevole mancanza di prove sull&#39;impatto di questi, tra l&#39;interventi su: 1) la capacità di uccisione delle cellule T citotossiche, 2) l&#39;effetto antivirale di cellule T sulla replicazione virale, 3) il profilo secrezione di citochine, e 4) l&#39;effetto su aiuto delle cellule T CD4 su altri sottogruppi di cellule. Intracellulare di citochine colorazione (ICS) è un flusso molto utile e ampiamente utilizzati saggio basato citometria che viene utilizzato per rilevare la produzione di citochine in vari tipi di cellule, sia nei topi e nell&#39;uomo. E &#39;stato anche utilizzato per studiare l&#39;effetto di anticorpi blocco di vie inibitorie. In saggi ICS, secrezione di citochine è bloccata con l&#39;aggiunta di brefeldina e / o Monensina. Le citochine intrappolati all&#39;interno delle cellule sono poi rilevate con anticorpi fluorescenti con citometria a flusso policromo. La durata del test è solitamente limitato a 6 o 12 ore dopo la stimolazione antigene poiché sia ​​brefeldina e monensina, che sono tipicamente aggiunti in 2 ore di antigene indicato, sono tossici per le cellule. Il saggio ICS è una potente tecnica che è stata i utilen l&#39;indagine l&#39;effetto della somministrazione in vivo di bloccare intervento anticorpo nei topi in cui le cellule sono state estratte dopo un certo periodo di tempo dopo l&#39;esposizione anticorpo 9. Tuttavia, vi sono diverse limitazioni per l&#39;applicazione di questo approccio sperimentale per valutare l&#39;impatto del blocco dei recettori inibitori in campioni umani. Durante l&#39;esecuzione di interventi di anticorpi vie inibitorie in un hr stimolazione 6 o 12 in vitro (tipicamente il caso con campioni umani), il blocco dei recettori inibitori in molti casi non modifica la frequenza di rispondere cellule T antigene-specifiche come misurata mediante saggi circuiti integrati standard 6, 7. Le misurazioni della produzione di citochine per cella misurati mediante media o la mediana intensità di fluorescenza hanno dato risultati inconsistenti 6, 7, 10. D&#39;altra parte, quando ICS viene eseguita in un punto temporale in ritardo dopo la stimolazione (ovvero sei giorni), le variazioni del numero di citochina-secernente cells possono essere osservati. Le differenze sono un effetto combinato della proliferazione alterata, sopravvivenza, e cambiamenti nella funzione effettrice che si accumulano durante il periodo di tempo specificato 6. Un modo per superare in parte questi limiti è quello di incubare per lunghi periodi di tempo (ad esempio 36 hr, 60 hr, ecc.) Con l&#39;antigene prima l&#39;aggiunta del bloccante secrezione di citochine senza attendere la proliferazione si verifichi. Abbiamo utilizzato con successo questo metodo per determinare la cinetica di secrezione di citochine da HIV-specifiche cellule T CD4 e CD8 11,12, tuttavia, questo approccio non è in grado di rilevare piccole risposte e non dia un risultato integrata della secrezione di citochine totale verificano poiché la stimolazione. Pertanto, ICS non è un metodo abbastanza sensibile per rilevare l&#39;impatto del blocco di vie inibitorie sulla quantità di citochine prodotte dalle cellule T attivate rispetto a mRNA quantitativa o misure di secrezione di citochine nel supernatant agli stessi punti temporali. Inoltre, la maggior parte delle citochine prodotte dalle cellule T attivate agire in maniera autocrina contribuendo al feedback positivo o negativo passanti attraverso l&#39;interazione con le cellule presentanti l&#39;antigene. Pertanto, l&#39;aggiunta di brefeldina o Monensina durante il saggio ICS impedisce la secrezione di citochine e quindi la stimolazione delle cellule T non è ottimale. Infine, il rilevamento di citochine multiple con ICS è limitata dalla disponibilità e sensibilità di anticorpi per il rilevamento di citochine mediante citometria a flusso, nonché da vincoli nel numero di fluorocromi che possono essere utilizzati contemporaneamente in un dato pannello. Abbiamo sviluppato un approccio altamente sensibile in vitro sperimentale per valutare l&#39;impatto delle vie immunomodulanti nella regolazione della secrezione di citochine da HIV-specifiche cellule T CD4 e successivamente CD4 contribuiscono a cellule presentanti l&#39;antigene (APC) e le cellule natural killer (cellule NK). Questo metodo può anche essere utilizzato per valutare l&#39;impact del blocco di molecole inibitori sulla funzione delle cellule T CD8 mediante deplezione delle cellule T CD4 da PBMC o stimolando con peptidi ottimali che vengono riconosciuti solo dalle cellule T CD8. In contrasto intracellulari saggi citochina colorazione, abbiamo deciso di non interferire con la secrezione di citochine da HIV-specifiche cellule T CD4 per essere in grado di: 1) effettuare una quantificazione più accurata dei livelli di citochine prodotte; 2) indagare un pannello più ampio di citochine o molecole effettrici e 3) valutare l&#39;impatto delle citochine prodotte da HIV-specifiche cellule T CD4 su altri sottoinsiemi di cellule. Stimoliamo CD8 PBMC impoverito a HIV-1 Gag piscina peptide in presenza di anticorpi bloccanti per la via immunoregolatorio di interesse. Dopo il tempo desiderato di incubazione, di solito 48 ore, raccogliamo il surnatante per misurare la secrezione di citochine con array di perline e raccogliere i pellet cellulari sia per l&#39;analisi fenotipica delle diverse sottopopolazioni cellulari o per l&#39;analisi trascrizionale. Da segnalare, al tempo til suo 48 punto di tempo hr, noi non rileva una significativa popolazione di cellule proliferanti T 12. Questo è un approccio flessibile e diversi adattamenti di questo motivo può essere applicato per affrontare diverse ipotesi. Per esempio, i singoli sottogruppi di cellule (come HIV-specifiche cellule T CD4 o PD-1 le cellule T CD4 elevati, ecc.) Possono essere scelti dopo 12 ore di incubazione prima ulteriore incubazione per 36 ore seguita da collezione di supernatanti e pellet cellulari indagare più specificamente l&#39;impatto degli interventi del blocco sulla secrezione di citochine da sottopopolazioni definite di PBMC.

<table border="1">
		<tbody>
		 <tr>
			<td>Name of Reagent/Material</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		 </tr>
		 <tr>
			<td>Hanks Balanced Salt Solution without Ca2+ or Mg2+</td>
			<td>Sigma</td>
			<td>H9394</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RPMI 1640</td>
			<td>Sigma</td>
			<td>R0883</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Histopaque-1077</td>
			<td>Sigma</td>
			<td>10771</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Human Serum AB</td>
			<td>Gemini BioProducts</td>
			<td>100-512</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Penicillin/Streptomycin</td>
			<td>Mediatech</td>
			<td>30 001 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>L-glutamine</td>
			<td>Mediatech</td>
			<td>25 005 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>HEPES buffer</td>
			<td>Mediatech</td>
			<td>25060CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>FcR blocking reagent, human</td>
			<td>Miltenyi</td>
			<td>130-059-901</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RosetteSep Human CD8+ Depletion Cocktail </td>
			<td>Stem Cell </td>
			<td>15663</td>
			<td></td>
		 </tr>
		 <tr>
			<td>LIVE/DEAD Fixable Dead Cell Stain Kit, for UV excitation</td>
			<td>Invitrogen</td>
			<td>L23105</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Rneasy Mini Kit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Improm-II Reverse Transcription System</td>
			<td>Promega</td>
			<td>A3800</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Brilliant II SYBR qPCR Low Rox Master Mix</td>
			<td>Agilent</td>
			<td>600830</td>
			<td></td>
		 </tr>
		 <tr>
			<td>BD Cytofix/Cytoperm Fixation/Permeabilization Solution Kit</td>
			<td>BD</td>
			<td>554714</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Tween-20</td>
			<td>Fisher</td>
			<td>BP337100</td>
			<td></td>
		 </tr>
		 <tr>
			<td>IFN-&gamma; primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: CGAGATGACTTCGAAAAGCTGA REV: TCTTCGACCTCGAAACAGCA</td>
		 </tr>
		 <tr>
			<td>GAPDH primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: TCATCATCTCTGCCCCCTCT REV: AGTGATGGCATGGACTGTGG</td>
		 </tr>
		</tbody>
 </table>

in vitro assay to evaluate the impact of immunoregulatory pathways on hiv-specific cd4 t cell effector function

Esaurimento delle cellule T è un fattore importante nella riuscita di liquidazione patogeno durante le infezioni virali croniche. Percorsi immunomodulanti, come PD-1 e IL-10, sono upregulated su questa esposizione all&#39;antigene corso e contribuiscono alla perdita della proliferazione, riduzione della funzione citolitica e compromessa produzione di citochine da parte di cellule T CD4 e CD8. Nel modello murino di infezione LCMV, somministrazione di bloccare anticorpi contro queste due vie aumentata risposte delle cellule T. Tuttavia, attualmente non vi è prova in vitro per misurare l&#39;impatto di tale blocco sulla secrezione di citochine in cellule da campioni umani. Il nostro protocollo e approccio sperimentale ci consentono di quantificare con precisione e in modo efficiente il ripristino della produzione di citochine da HIV-specifiche cellule T CD4 da soggetti infetti da HIV. Qui, ci raffiguriamo un disegno sperimentale in vitro che consente misurazioni della secrezione di citochine da HIV-specifiche cellule T CD4 e il loro impatto su altri celsottoinsiemi l. Cellule T CD8 erano esaurite dal sangue intero e che restano PBMC sono state isolate tramite metodo di separazione Ficoll. PBMC CD8-impoverito sono state poi incubate con anticorpi bloccanti contro PD-L1 e / o IL-10Rα e, dopo stimolazione con HIV-1 piscina Gag peptide, le cellule sono state incubate a 37 ° C, 5% CO 2. Dopo 48 ore, il surnatante è stato raccolto per l&#39;analisi di citochine da perline array e pellet cellulari sono stati raccolti sia per l&#39;analisi fenotipica mediante citometria a flusso o l&#39;analisi trascrizionale mediante qRT-PCR. Per un&#39;analisi più dettagliata, diverse popolazioni cellulari sono stati ottenuti selettiva sottoinsieme esaurimento da PBMC o di classificare mediante citometria a flusso, prima di essere valutato negli stessi dosaggi. Questi metodi forniscono un approccio altamente sensibile e specifico per determinare la modulazione della produzione di citochine da parte di cellule T-helper antigene-specifiche e determinare interazioni funzionali tra diverse popolazioni di cellule immunitarie.

Per effettuare le misurazioni di citochine tramite questo sistema in vitro, è essenziale essere in grado di distinguere le risposte antigene-specifiche rispetto al controllo senza stimolazione. In generale, abbiamo preso in considerazione le risposte positive da tutti i valori della stimolazione antigenica che danno almeno tre volte aumento dei livelli di citochine rispetto al controllo nessuno stimolo e che erano all&#39;interno della gamma lineare del test. Stiamo usando ad alta sensibilità saggi di matrice...

Watch this Scientific Journal Video about In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function at JoVE.com

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

Abbiamo sviluppato un test in vitro per studiare il ruolo delle vie immunomodulanti nella regolazione della secrezione di citochine da HIV-specifiche cellule T CD4.

In vitro per valutare l&#39;impatto di immunoregolatorio Pathways su HIV-specifica CD4 T effettrici delle cellule di funzione

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

in-vitro-assay-to-evaluate-impact-immunoregulatory-pathways-on-hiv

Research

JoVE Journal

Immunology and Infection

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

14.0K Views.  The Ragon Institute of MGH, MIT and Harvard.  Abbiamo sviluppato un test in vitro per studiare il ruolo delle vie immunomodulanti nella regolazione della secrezione di citochine da HIV-specifiche cellule T CD4. 

Video: In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

Isolation and Th17 Differentiation of Na&iuml;ve CD4 T Lymphocytes

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets including Th1, Th2, and regulatory T cells. Th17 cells have emerged as a central culprit in overzealous inflammatory immune responses associated with many autoimmune disorders. In this method we purify T lymphocytes from the spleen and lymph nodes of C57BL/6 mice, and stimulate purified CD4+ T cells under control and Th17-inducing environments. The Th17-inducing environment includes stimulation in the presence of anti-CD3 and anti-CD28 antibodies, IL-6, and TGF-&#946;. After incubation for at least 72 hours and for up to five days at 37 &#176;C, cells are subsequently analyzed for the capability to produce IL-17 through flow cytometry, qPCR, and ELISAs. Th17 differentiated CD4+CD25- T cells can be utilized to further elucidate the role that Th17 cells play in the onset and progression of autoimmunity and host defense. Moreover, Th17 differentiation of CD4+CD25- lymphocytes from distinct murine knockout/disease models can contribute to our understanding of cell fate plasticity.

Isolation and Th17 Differentiation of Na&amp;#239;ve CD4 T Lymphocytes

With effector functions distinct from other T cell subsets, Th17 cells have been centrally implicated in inflammatory autoimmunity. This in vitro Th17 differentiation protocol provides a means to determine whether na&#239;ve CD4+ T lymphocytes can differentiate into Th17 cells, and to further examine their role in autoimmunity and host response.

Isolamento e differenziazione di Th17 Naïve linfociti T CD4

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets ...

Ricerca

Immunologia e infezioni

Transplantation of Tail Skin to Study Allogeneic CD4 T Cell Responses in Mice

The study of T cell responses and their consequences during allo-antigen recognition requires a model that enables one to distinguish between donor and host T cells, to easily monitor the graft, and to adapt the system in order to answer different immunological questions. Medawar and colleagues established allogeneic tail-skin transplantation in mice in 1955. Since then, the skin transplantation model has been continuously modified and adapted to answer specific questions. The use of tail-skin renders this model easy to score for graft rejection, requires neither extensive preparation nor deep anesthesia, is applicable to animals of all genetic background, discourages ischemic necrosis, and permits chemical and biological intervention. 
In general, both CD4+ and CD8+ allogeneic T cells are responsible for the rejection of allografts since they recognize mismatched major histocompatibility antigens from different mouse strains. Several models have been described for activating allogeneic T cells in skin-transplanted mice. The identification of major histocompatibility complex (MHC) class I and II molecules in different mouse strains including C57BL/6 mice was an important step toward understanding and studying T cell-mediated alloresponses. In the tail-skin transplantation model described here, a three-point mutation (I-Abm12) in the antigen-presenting groove of the MHC-class II (I-Ab) molecule is sufficient to induce strong allogeneic CD4+ T cell activation in C57BL/6 mice. Skin grafts from I-Abm12 mice on C57BL/6 mice are rejected within 12-15 days, while syngeneic grafts are accepted for up to 100 days. The absence of T cells (CD3-/- and Rag2-/- mice) allows skin graft acceptance up to 100 days, which can be overcome by transferring 2 x 104 wild type or transgenic T cells. Adoptively transferred T cells proliferate and produce IFN-&#947; in I-Abm12-transplanted Rag2-/- mice.

Tail-skin transplantation is a powerful model for studying T cell-dependent rejection and tolerance induction during allogeneic immune responses in mice. The advantages of this protocol are minor invasive surgery, and ease of monitoring with no need to sacrifice the recipient mouse.

Il trapianto di coda della pelle per studiare allogenico di cellule T CD4 risposte in topi

The study of T cell responses and their consequences during allo-antigen recognition requires a model that enables one to distinguish between donor and ...

Image-based Flow Cytometry Technique to Evaluate Changes in Granulocyte Function In Vitro

Granulocytes play a key role in the body&#8217;s innate immune response to bacterial and viral infections. While methods exist to measure granulocyte function, in general these are limited in terms of the information they can provide. For example, most existing assays merely provide a percentage of how many granulocytes are activated following a single, fixed length incubation. Complicating matters, most assays focus on only one aspect of function due to limitations in detection technology. This report demonstrates a technique for simultaneous measurement of granulocyte phagocytosis of bacteria and oxidative burst. By measuring both of these functions at the same time, three unique phenotypes of activated granulocytes were identified: 1) Low Activation (minimal phagocytosis, no oxidative burst), 2) Moderate Activation (moderate phagocytosis, some oxidative burst, but no co-localization of the two functional events), and 3) High Activation (high phagocytosis, high oxidative burst, co-localization of phagocytosis and oxidative burst). A fourth population that consisted of inactivated granulocytes was also identified. Using assay incubations of 10, 20, and 40-min the effect of assay incubation duration on the redistribution of activated granulocyte phenotypes was assessed. A fourth incubation was completed on ice as a control. By using serial time incubations, the assay may be able to able to detect how a treatment spatially affects granulocyte function. All samples were measured using an image-based flow cytometer equipped with a quantitative imaging (QI) option, autosampler, and multiple lasers (488, 642, and 785 nm).

Image-based Flow Cytometry Technique to Evaluate Changes in Granulocyte Function In Vitro

This method demonstrates a technique for assessing granulocyte function by simultaneously measuring phagocytosis of bacteria and oxidative burst. Image-based flow cytometry allowed for the identification of three distinct subsets of activated granulocytes that all differed in their relative functional capacity.

Immagine a base di Citometria a flusso Tecnica per valutare le variazioni Granulocyte Funzione<em&gt; In Vitro</em

Granulocytes play a key role in the body&#8217;s innate immune response to bacterial and viral infections. While methods exist to measure granulocyte ...

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages and disadvantages. We describe here an experimental colitis model that is initiated by adoptive transfer of syngeneic splenic CD4+CD45RBhigh T cells into T and B cell deficient recipient mice. The CD4+CD45RBhigh T cell population that largely consists of na&#239;ve effector cells is capable of inducing chronic intestinal inflammation, closely resembling key aspects of human IBD. This method can be manipulated to study aspects of disease onset and progression. Additionally it can be used to study the function of innate, adaptive, and regulatory immune cell populations, and the role of environmental exposures, i.e., the microbiota, in intestinal inflammation. In this article we illustrate the methodology for inducing colitis with a step-by-step protocol. This includes a video demonstration of key technical aspects required to successfully develop this murine model of experimental colitis for research purposes.

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Here, we present a protocol to induce colonic inflammation in mice by adoptive transfer of syngeneic CD4+CD45RBhigh T cells into T and B cell deficient recipients. Clinical and histopathological features mimic human inflammatory bowel diseases. This method allows the study of the initiation of colonic inflammation and progression of disease.

Induzione di Murine infiammazione intestinale per trasferimento adottivo di Effector CD4<sup&gt; +</sup&gt; CD45RB<sup&gt; Alto</sup&gt; T Cells in topi immunodeficienti

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages ...

Mouse Na&#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition of cognate antigen presented on MHC class II. The cytokine signals present in the environment at the time of TCR activation are a major factor in determining the effector fate of a na&#239;ve CD4+ T cell. Although the cytokine environment during na&#239;ve T cell activation may be complex and involve both redundant and opposing signals in vivo, the addition of various cytokine combinations during naive CD4+ T cell activation in vitro can readily promote the establishment of effector T helper lineages with hallmark cytokine and transcription factor expression. Such differentiation experiments are commonly used as a first step for the evaluation of targets believed to promote or inhibit the development of certain CD4+ T helper subsets. The addition of mediators, such as signaling agonists, antagonists, or other cytokines, during the differentiation process can also be used to study the influence of a particular target on T cell differentiation. Here, we describe a basic protocol for the isolation of na&#239;ve T cells from mouse and the subsequent steps necessary for polarizing na&#239;ve cells to various T helper effector lineages in vitro.

Mouse Na&amp;#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Na&#239;ve CD4+ T cells polarize to various subsets depending on the environment at the time of activation. The differentiation of na&#239;ve CD4+ T cells to various effector subsets can be achieved in vitro through the addition of T cell receptor stimuli and specific cytokine signals.

Mouse Naïve CD4<sup&gt; +</sup&gt; Isolamento T cellulare e<em&gt; In vitro</em&gt; Differenziazione in T sottopopolazioni cellulari

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition ...

Application of Long-term cultured Interferon-&#947; Enzyme-linked Immunospot Assay for Assessing Effector and Memory T Cell Responses in Cattle

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is controlled up to 95 % of the T cells generated during the expansion phase are eliminated (i.e., contraction phase) and memory T cells remain, sometimes for a lifetime. In humans, two functionally distinct subsets of memory T cells have been described based on the expression of lymph node homing receptors. Central memory T cells express C-C chemokine receptor 7 and CD45RO and are mainly located in T-cell areas of secondary lymphoid organs. Effector memory T cells express CD45RO, lack CCR7 and display receptors associated with lymphocyte homing to peripheral or inflamed tissues. Effector T cells do not express either CCR7 or CD45RO but upon encounter with antigen produce effector cytokines, such as interferon-&#947;. Interferon-&#947; release assays are used for the diagnosis of bovine and human tuberculosis and detect primarily effector and effector memory T cell responses. Central memory T cell responses by CD4+ T cells to vaccination, on the other hand, may be used to predict vaccine efficacy, as demonstrated with simian immunodeficiency virus infection of non-human primates, tuberculosis in mice, and malaria in humans. Several studies with mice and humans as well as unpublished data on cattle, have demonstrated that interferon-&#947; ELISPOT assays measure central memory T cell responses. With this assay, peripheral blood mononuclear cells are cultured in decreasing concentration of antigen for 10 to 14 days (long-term culture), allowing effector responses to peak and wane; facilitating central memory T cells to differentiate and expand within the culture.

Application of Long-term cultured Interferon-&amp;#947; Enzyme-linked Immunospot Assay for Assessing Effector and Memory T Cell Responses in Cattle

Long-term cultured interferon-&#947; enzyme-linked immunospot assay is used as a measure of central memory responses and correlates with protective anti-mycobacterial vaccine responses. With this assay, peripheral blood mononuclear cells are stimulated with mycobacterial antigens and interleukin-2 for 14 days, enabling differentiation and expansion of central memory T cells.

Applicazione di lungo termine colta interferone-γ Enzyme Linked immunospot Assay per la valutazione effettori e memoria delle cellule T risposte a Bovino

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is ...

Imaging CD4 T Cell Interstitial Migration in the Inflamed Dermis

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral tissues through an as-yet undefined mechanism. The application of multiphoton microscopy to the study of the immune system provides a tool to measure the dynamics of immune responses within intact tissues. Here we present a protocol for non-invasive intravital multiphoton imaging of CD4 T cells in the inflamed mouse ear dermis. Use of a custom imaging platform and a venous catheter allows for the visualization of CD4 T cell dynamics in the dermal interstitium, with the ability to interrogate these cells in real-time via the addition of blocking antibodies to key molecular components involved in motility. This system provides advantages over both in vitro models and surgically invasive imaging procedures. Understanding the pathways used by CD4 T cells for motility may ultimately provide insight into the basic function of CD4 T cells as well as the pathogenesis of both autoimmune diseases and pathology from chronic infections.

The mechanisms that govern the interstitial motility of CD4 effector T cells at sites of inflammation are relatively unknown. We present a non-invasive approach to visualize and manipulate in vitro-primed CD4 T cells in the inflamed ear dermis, allowing for study of the dynamic behavior of these cells in situ.

Imaging CD4 T cellule interstiziali migrazione nel derma infiammate

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral ...

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal model experimental autoimmune encephalomyelitis (EAE). This process is characterized by the transmigration of activated T cells across brain endothelial cells (ECs), the main constituents of the BBB. However, the consequences on brain EC function upon interaction with such T cells are largely unknown. Here we describe an assay that allows for the evaluation of primary mouse brain microvascular EC (MBMEC) function and barrier integrity during the interaction with T cells over time. The assay makes use of impedance cell spectroscopy, a powerful tool for studying EC monolayer integrity and permeability, by measuring changes in transendothelial electrical resistance (TEER) and cell layer capacitance (Ccl). In direct contact with ECs, stimulated but not na&#239;ve T cells are capable of inducing EC monolayer dysfunction, as visualized by a decrease in TEER and an increase in Ccl. The assay records changes in EC monolayer integrity in a continuous and automated fashion. It is sensitive enough to distinguish between different strengths of stimuli and levels of T cell activation and it enables the investigation of the consequences of a targeted modulation of T cell-EC interaction using a wide range of substances such as antibodies, pharmacological reagents and cytokines. The technique can also be used as a quality control for EC integrity in in vitro T-cell transmigration assays. These applications make it a versatile tool for studying BBB properties under physiological and pathophysiological conditions.

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Here, we describe an in vitro murine model of the blood-brain barrier that makes use of impedance cell spectroscopy, with a focus on the consequences on endothelial cell integrity and permeability upon interaction with activated T cells.

Un<em&gt; In Vitro</em&gt; Modello della barriera emato-encefalica Utilizzando spettroscopia di impedenza: un focus sui T Cell-endoteliale cellulare Interazione

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal ...

Assessing Retinal Microglial Phagocytic Function In Vivo Using a Flow Cytometry-based Assay

Microglia are the tissue resident macrophages of the central nervous system (CNS) and they perform a variety of functions that support CNS homeostasis, including phagocytosis of damaged synapses or cells, debris, and/or invading pathogens. Impaired phagocytic function has been implicated in the pathogenesis of diseases such as Alzheimer's and age-related macular degeneration, where amyloid-&#946; plaque and drusen accumulate, respectively. Despite its importance, microglial phagocytosis has been challenging to assess in vivo. Here, we describe a simple, yet robust, technique for precisely monitoring and quantifying the in vivo phagocytic potential of retinal microglia. Previous methods have relied on immunohistochemical staining and imaging techniques. Our method uses flow cytometry to measure microglial uptake of fluorescently labeled particles after intravitreal delivery to the eye in live rodents. This method replaces conventional practices that involve laborious tissue sectioning, immunostaining, and imaging, allowing for more precise quantification of microglia phagocytic function in just under six hours. This procedure can also be adapted to test how various compounds alter microglial phagocytosis in physiological settings. While this technique was developed in the eye, its use is not limited to vision research.

Assessing Retinal Microglial Phagocytic Function In Vivo Using a Flow Cytometry-based Assay

Microglial phagocytosis is critical for the maintenance of tissue homeostasis and inadequate phagocytic function has been implicated in pathology. However, assessing microglia function in vivo is technically challenging. We have developed a simple but robust technique for precisely monitoring and quantifying the phagocytic potential of microglia in a physiological setting.

La valutazione della retina microglia fagocitaria Funzione<em&gt; In Vivo</em&gt; Usando un test citometria a flusso basato su

Microglia are the tissue resident macrophages of the central nervous system (CNS) and they perform a variety of functions that support CNS homeostasis, ...

In Vitro Differentiation of Human CD4+FOXP3+ Induced Regulatory T Cells (iTregs) from Na&#239;ve CD4+ T Cells Using a TGF-&#946;-containing Protocol

Regulatory T cells (Tregs) are an integral part of peripheral tolerance, suppressing immune reactions against self-structures and thus preventing autoimmune diseases. Clinical approaches to adoptively transfer Tregs, or to deplete Tregs in cancer, are underway with promising first outcomes. 
Because the number of naturally occurring Tregs (nTregs) is very limited, studying certain Treg features using in vitro induced Tregs (iTregs) can be advantageous. To date, the best although not absolutely specific protein marker to delineate Tregs is the transcription factor FOXP3. Despite the importance of Tregs including non-redundant roles of peripherally induced Tregs, the protocols to generate iTregs are currently controversial, particularly for human cells. This protocol therefore describes the in vitro differentiation of human CD4+FOXP3+ iTregs from human na&#239;ve T cells using a range of Treg-inducing factors (TGF-&#946; plus IL-2 only, or their combination with retinoic acid, rapamycin or butyrate) in parallel. It also describes the phenotyping of these cells by flow cytometry and qRT-PCR. 
These protocols result in reproducible expression of FOXP3 and other Treg signature genes and enable the study of general FOXP3-regulatory mechanisms as well as protocol-specific effects to delineate the impact of certain factors. iTregs can be utilized to study various phenotypic aspects as well as molecular mechanisms of Treg induction. Detailed molecular studies are facilitated by relatively large cell numbers that can be obtained. 
A limitation for the application of iTregs is the relative instability of FOXP3 expression in these cells compared to nTregs. iTregs generated by these protocols can also be used for functional assays such as studying their suppressive function, in which iTregs induced by TGF-&#946; plus retinoic acid and rapamycin display superior suppressive activity. However, the suppressive capacity of iTregs can differ from nTregs and the use of appropriate controls is crucial.

&lt;em&gt;In Vitro&lt;/em&gt; Differentiation of Human CD4&lt;sup&gt;+&lt;/sup&gt;FOXP3&lt;sup&gt;+&lt;/sup&gt; Induced Regulatory T Cells (iTregs) from Na&amp;#239;ve CD4&lt;sup&gt;+&lt;/sup&gt; T Cells Using a TGF-&amp;#946;-containing Protocol

This protocol describes the reproducible generation and phenotyping of human induced regulatory T cells (iTregs) from na&#239;ve CD4+ T cells in vitro. Different protocols for FOXP3 induction allow for the study of specific iTreg phenotypes obtained with respective protocols.

La differenziazione in vitro di cellule CD4 + umana FOXP3 + indotta da T regolatorie (iTregs) da cellule T CD4 Naïve utilizzando un protocollo TGF-β contenenti