We thank Hongjae Sunwoo for helpful advice for oligonucleotide design in RNA FISH. We also thank Serenity Curtis for editing the manuscript. N.Y. was supported by a Postdoctoral Fellowship for Research Abroad of the Japan Society for the Promotion of Science (JSPS). This work was supported by the NIH (RO1-GM102184), the March of Dimes Research Foundation (#6-FY12-337), and the Developmental Fund and Trustee Grant at Cincinnati Children's Hospital Medical Center to Y.O.

1. Sonda Preparazione <ol><li> Ottenere più oligonucleotidi unici in Xist (oligonucleotidi 20-30 nucleotidi di lunghezza, 63-65 temperatura di fusione ºC, tabella 1), con una modifica 5&#39;-amino e sospendere in acqua. </li><li> Pool quantità equimolari di oligonucleotidi con 5&#39;-amino modifica (totale 4,5 mg) e l&#39;etichetta con colorante fluorescente ammina reattiva seguendo le istruzioni del produttore. <ol><li> Sciogliere gli oligonucleotidi pool in finale 5 ml di acqua priva di nucleasi e aggiungere 3 ml di 1 M bicarbonato di sodio alla soluzione oligonucleotide. </li><li> Aggiungere 2 microlitri DMSO al flaconcino di ammina reattiva tintura e vortex brevemente. </li><li> Miscelare la soluzione di oligonucleotide con il colorante reattivo in DMSO e incubare la miscela a temperatura ambiente per 1 ora al buio. </li></ol></li><li> Purificare le sonde oligonucleotidiche fluorescente di G-25 colonna seguita da precipitazione in etanolo. <ol><li&gt; Centrifuga G-25 colonne a 750 g per 1 minuto per rimuovere buffer di stoccaggio in eccesso. </li><li> Aggiungere l&#39;acqua priva di nucleasi 40 microlitri alla miscela etichettatura prodotta nel passaggio 1.2.3 e applicare alla colonna G-25. Centrifugare a 750 g per 2 minuti. </li><li> Aggiungere 50 ml di acqua priva di nucleasi, 10 microlitri 3 M di acetato di sodio (pH 5.2) e 250 ml di etanolo per la sonda purificato dal punto 1.3.2. Conservare a -80 ° C per 30 minuti e centrifugare a 21.000 xg per 15 min a 4 ° C. </li><li> Lavare gli oligonucleotidi precipitati una volta con 1 ml di etanolo al 70%. </li><li> Risospendere in 50 microlitri di acqua priva di nucleasi o TE (10 mM Tris-HCl, pH 7,5, 1 mM EDTA) per una concentrazione finale di circa 10 pM. </li></ol></li><li> Diluire le sonde oligonucleotidiche fluorescente ad una concentrazione finale di 250 nM con tampone di ibridazione (10% formammide, 2X SSC [NaCl 300 mM; citrato di sodio 30 mM]; 2 mg / ml BSA, 10% destrano solfato). NOTA: Con questo protocollo FISH veloce, oligonucleotide paccappatoi in Xist stati progettati ed utilizzati ad una concentrazione superiore al normale protocollo FISH con sonde oligonucleotidiche per abbreviare il tempo di incubazione per l&#39;ibridazione. </li></ol> 2. Far scorrere Preparazione NOTA: Le diapositive possono essere preparati per immuno-FISH utilizzando il mouse staminali embrionali (ES) o il corpo embrioide (EB) differenziando cellule 20, 21 da una loro crescita direttamente su un vetrino da poli-lisina-trattati o con cytospin con sospensione cellulare. Qui, viene mostrata la preparazione diapositiva Cytospin. <ol><li> Aspirare il mezzo di coltura in un piatto da 6 pozzetti. Lavare con PBS (temperatura ambiente), e aspirare a fondo. </li><li> Aggiungere 0,5 ml di tripsina al piatto 6 pozzetti, incubare per 5-10 minuti a 37 ° C. </li><li> Aggiungere 5 ml di terreno e disperdere le cellule pipettando gentilmente su e giù parecchie volte. </li><li> Trasferire le cellule in una provetta da 15 ml, centrifugare per 5 min a 200 xg a temperatura ambiente. </li><li> Eliminare il supporto did delicatamente sospendere le cellule in 2 ml di PBS. </li><li> Contare le cellule utilizzando emocitometro, e diluire sospensione cellulare a 4 x 10 5 cellule / ml di PBS. </li><li> Assemblare una diapositiva, una carta filtro e una camera con una clip e metterli nelle apposite fessure del rotore del cytospin. Aggiungere 250 ml di ogni campione preparato al punto 2.6 in ciascuna camera dei gruppi assemblati in cytospin. Centrifugare a 1500 rpm per 10 min a temperatura ambiente. </li><li> (10 TUBI mM, pH 6,8; NaCl 100 mm; 300 mM saccarosio; 3 mM MgCl 2) Fill 3 Coplin sul ​​ghiaccio con 40 ml ciascuna di tampone PBS, CSK ghiacciata, e tampone CSKT (tampone CSK con 0,5% Triton X-100), rispettivamente. </li><li> Dopo l&#39;cytospin è finito, trasferire rapidamente il vetrino in PBS freddo e incubare per 5 min. </li><li> Trasferire il vetrino nel buffer CSK ghiacciato e incubare per 1 min. </li><li> Trasferire il vetrino nel buffer CSKT ghiacciato e incubare per 5 min. </li><li> Trasferire il vetrino di nuovo in ghiacciata CSK buffer e incubare per 1 min. </li><li> Trasferire il vetrino in 4% paraformaldeide in PBS e incubare per 10 min a temperatura ambiente. </li></ol> 3. immunofluorescenza <ol><li> Porre i vetrini in una vaschetta Coplin con PBST (1x PBS con 0.1% Tween-20) per diversi secondi. </li><li> Porre i vetrini in un taglio che permette di buffer residuo a scorrere giù la diapositiva. Pulire con cura il liquido in eccesso dal vetrino e metterlo in una scatola pipetta punta vuota con acqua. Sovrapporre la slitta con 40 ml di soluzione bloccante (1x PBS, 1% BSA, 0,1% Tween-20), inserire delicatamente un coprioggetto e incubare per 10 minuti a temperatura ambiente. </li><li> Rimuovere il vetrino, rimuovere la soluzione di blocco, e aggiungere 40 ml di anticorpo primario Histone H3K27me3 diluito ad una concentrazione di 1: 500 in soluzione bloccante. Posizionare il coprioggetto posteriore della diapositiva e incubare per 30 min a temperatura ambiente. NOTA: Un inibitore RNase nella soluzione di blocco potrebbe essere utile per preservare RNA in questo RNA FISProtocollo H quando si utilizzano anticorpi policlonali. </li><li> Lavare il vetrino 2 volte in vasi pieni di Coplin PBST, per 5 minuti ciascuna, scuotendo delicatamente durante il lavaggio. </li><li> Porre i vetrini in un taglio che permette di buffer residuo a scorrere giù la diapositiva. Pulire con cura il liquido in eccesso e posizionare il vetrino nella scatola punta. Overlay con 40 ml di anticorpo secondario (1: 500) diluito in soluzione bloccante, posizionare un coprioggetto e incubare per 15 minuti al buio. Per le seguenti operazioni, mantenere la slitta al buio in ogni momento. </li><li> Lavare 2 volte in Coplin vasi con PBST come al punto 3.4. </li></ol> 4. RNA FISH con sonde oligonucleotidi <ol><li> Pre-riscaldare una scatola pipetta punta vuota con acqua sul fondo per evitare che scivoli di essiccazione a 37 ° C per l&#39;RNA FISH al punto 4.3. </li><li> Porre i vetrini in un taglio che permette di buffer residuo a scorrere giù la diapositiva. Pulire con cura il liquido in eccesso dal vetrino dal punto 3.6 e posizionare il vetrino nella casella pipetta-tip con water in basso. Aggiungere 500 pl di tampone di lavaggio FISH (10% formammide in 2x SSC) della diapositiva e incubare per 5 minuti a temperatura ambiente. </li><li> Rimuovere la soluzione di lavaggio FISH, aggiungere 8 ml di oligonucleotidi sul vetrino, inserire un vetrino, e trasferire la diapositiva di una scatola pipetta punta preriscaldata con acqua sul fondo; incubare a 37 ° C per 1-2 ore. </li><li> Mettere 3 vasetti pre-riscaldato Coplin in un bagno d&#39;acqua a 37 ° C con il tampone di lavaggio FISH, FISH tampone di lavaggio con DAPI, e 2x SSC. </li><li> Dopo 1-2 ore di incubazione per l&#39;RNA FISH, mettere il vetrino nel buffer di lavaggio FISH pre-riscaldato. </li><li> Incubare il vetrino per alcuni minuti fino a quando il vetrino cade della diapositiva. </li><li> Posizionare il vetrino nuovo nel tampone di lavaggio, e continuare incubazione per 5 min. </li><li> Trasferire i vetrini in un&#39;altra vaschetta Coplin con tampone di lavaggio FISH preriscaldata con 0,5 ng / ml DAPI e incubare per 5 min. </li><li> Trasferire i vetrini in un&#39;altra vaschetta Coplin con pre-riscaldato 2x SSC e incubare per 5 kmn. </li><li> Porre i vetrini in un taglio che permette di buffer residuo a scorrere giù la diapositiva. Pulire con cura il liquido in eccesso e posizionare il vetrino di nuovo in una scatola di punta secca. Aggiungere 4 ml di antifade con DAPI sul vetrino e mettere un coprioggetto. </li><li> Sigillare il coprioggetto con smalto e osservare al microscopio. La slitta può essere conservato a 4 ° C al buio per alcuni mesi. </li></ol>

<ol>
	<li>Payer, B., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X+chromosome+dosage+compensation:+how+mammals+keep+the+balance.">X chromosome dosage compensation: how mammals keep the balance.</a> Annu Rev Genet. 42, 733-772 (2008).</li><li>Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gracefully+ageing+at+50,+X-chromosome+inactivation+becomes+a+paradigm+for+RNA+and+chromatin+control.">Gracefully ageing at 50, X-chromosome inactivation becomes a paradigm for RNA and chromatin control.</a> Nat Rev Mol Cell Biol. 12, 815-826 (2011).</li><li>Gendrel, A. V., Heard, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fifty+years+of+X-inactivation+research.">Fifty years of X-inactivation research.</a> Development. 138, 5049-5055 (2011).</li><li>Froberg, J. E., Yang, L., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guided+by+RNAs:+X-inactivation+as+a+model+for+lncRNA+function.">Guided by RNAs: X-inactivation as a model for lncRNA function.</a> J Mol Biol. 425, 3698-3706 (2013).</li><li>Penny, G. D., Kay, G. F., Sheardown, S. A., Rastan, S., Brockdorff, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Requirement+for+Xist+in+X+chromosome+inactivation.">Requirement for Xist in X chromosome inactivation.</a> Nature. 379, 131-137 (1996).</li><li>Marahrens, Y., Panning, B., Dausman, J., Strauss, W., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xist-deficient+mice+are+defective+in+dosage+compensation+but+not+spermatogenesis.">Xist-deficient mice are defective in dosage compensation but not spermatogenesis.</a> Genes Dev. 11, 156-166 (1997).</li><li>Clemson, C. M., McNeil, J. A., Willard, H. F., Lawrence, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=XIST+RNA+paints+the+inactive+X+chromosome+at+interphase:+evidence+for+a+novel+RNA+involved+in+nuclear/chromosome+structure.">XIST RNA paints the inactive X chromosome at interphase: evidence for a novel RNA involved in nuclear/chromosome structure.</a> J Cell Biol. 132, 259-275 (1996).</li><li>Sado, T., Brockdorff, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+understanding+chromosome+silencing+by+the+long+non-coding+RNA.">Advances in understanding chromosome silencing by the long non-coding RNA.</a> Xist. Phil Trans R Soc B. 368, 20110325-20 (2013).</li><li>Zhao, J., Sun, B. K., Erwin, J. A., Song, J. J., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycomb+proteins+targeted+by+a+short+repeat+RNA+to+the+mouse+X+chromosome.">Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome.</a> Science. 322, 750-756 (2008).</li><li>Plath, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+histone+H3+lysine+27+methylation+in+X+inactivation.">Role of histone H3 lysine 27 methylation in X inactivation.</a> Science. 300, 131-135 (2003).</li><li>Silva, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+histone+h3+methylation+on+the+inactive+X+chromosome+requires+transient+recruitment+of+Eed-Enx1+polycomb+group+complexes.">Establishment of histone h3 methylation on the inactive X chromosome requires transient recruitment of Eed-Enx1 polycomb group complexes.</a> Dev Cell. 4, 481-495 (2003).</li><li>Gall, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+synthesis+of+the+genes+for+ribosomal+RNA+during+amphibian+oogenesis.">Differential synthesis of the genes for ribosomal RNA during amphibian oogenesis.</a> Proc Natl Acad Sci U S A. 60, 553-560 (1968).</li><li>Femino, A. M., Fay, F. S., Fogarty, K., Singer, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+single+RNA+transcripts+in+situ.">Visualization of single RNA transcripts in situ.</a> Science. 280, 585-590 (1998).</li><li>Raj, A., van den Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+individual+mRNA+molecules+using+multiple+singly+labeled+probes.">Imaging individual mRNA molecules using multiple singly labeled probes.</a> Nat Methods. 5, 877-879 (2008).</li><li>Chaumeil, J., Augui, S., Chow, J. C., Heard, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combined+immunofluorescence,+RNA+fluorescent+in+situ+hybridization,+and+DNA+fluorescent+in+situ+hybridization+to+study+chromatin+changes,+transcriptional+activity,+nuclear+organization,+and+X-chromosome+inactivation.">Combined immunofluorescence, RNA fluorescent in situ hybridization, and DNA fluorescent in situ hybridization to study chromatin changes, transcriptional activity, nuclear organization, and X-chromosome inactivation.</a> Methods Mol Biol. 463, 297-308 (2008).</li><li>Katayama, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+transcription+in+the+mammalian+transcriptome.">Antisense transcription in the mammalian transcriptome.</a> Science. 309, 1564-1566 (2005).</li><li>Ogawa, Y., Xite Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-inactivation+intergenic+transcription+elements+that+regulate+the+probability+of+choice.">X-inactivation intergenic transcription elements that regulate the probability of choice.</a> Mol Cell. 11, 731-743 (2003).</li><li>Panning, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X+inactivation+in+mouse+ES+cells:+histone+modifications+and+FISH.">X inactivation in mouse ES cells: histone modifications and FISH.</a> Methods Enzymol. 376, 419-428 (2004).</li><li>Khalil, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+human+large+intergenic+noncoding+RNAs+associate+with+chromatin-modifying+complexes+and+affect+gene+expression.">Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression.</a> Proc Natl Acad Sci U S A. 106, 11667-11672 (2009).</li><li>Martin, G. R., Evans, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+clonal+lines+of+teratocarcinoma+cells:+formation+of+embryoid+bodies+in+vitro.">Differentiation of clonal lines of teratocarcinoma cells: formation of embryoid bodies in vitro.</a> Proc Natl Acad Sci U S A. 72, 1441-1445 (1975).</li><li>Lee, J. T., Lu, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+mutagenesis+of+Tsix+leads+to+nonrandom+X+inactivation.">Targeted mutagenesis of Tsix leads to nonrandom X inactivation.</a> Cell. 99, 47-57 (1999).</li><li>Zhang, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Telomeric+RNAs+mark+sex+chromosomes+in+stem+cells.">Telomeric RNAs mark sex chromosomes in stem cells.</a> Genetics. 182, 685-698 (2009).</li><li>Raj, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+individual+endogenous+RNA+transcripts+in+situ+using+multiple+singly+labeled+probes.">Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes.</a> Methods Enzymol. 472, 365-386 (2010).</li><li>Kimura, H., Hayashi-Takanaka, Y., Goto, Y., Takizawa, N., Nozaki, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+organization+of+histone+H3+modifications+as+revealed+by+a+panel+of+specific+monoclonal+antibodies.">The organization of histone H3 modifications as revealed by a panel of specific monoclonal antibodies.</a> Cell Struct Funct. 33, 61-73 (2008).</li><li>Ogawa, Y., Sun, B. K., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intersection+of+the+RNA+interference+and+X-inactivation+pathways.">Intersection of the RNA interference and X-inactivation pathways.</a> Science. 320, 1336-1341 (2008).</li><li>Kohlmaier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chromosomal+memory+triggered+by+Xist+regulates+histone+methylation+in+X+inactivation.">A chromosomal memory triggered by Xist regulates histone methylation in X inactivation.</a> PLoS Biol. 2, 171 (2004).</li><li>Wang, K. C., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+long+noncoding+RNAs.">Molecular mechanisms of long noncoding RNAs.</a> Mol Cell. 43, 904-914 (2011).</li></ol>

No conflicts of interest declared.

In questo lavoro, abbiamo presentato una rapida protocollo immuno-FISH, che richiede meno di 5 ore per completare la preparazione vetrino, Xist RNA FISH, e immunofluorescenza per H3K27me3. In confronto con l&#39;approccio generale immuno-FISH per Xist RNA rilevazione, che di solito ha bisogno di incubazione durante la notte per l&#39;RNA FISH, questo protocollo non solo riduce significativamente il tempo trascorso, ma migliora anche la sensibilità di immuno-FISH con sonde oligonucleotidi. Poiché Xist altamente è trascritto durante inattivazione cromosoma X e la sua trascrizione si trova ad accumularsi intensamente sul Xi in cis, è facile rilevare Xist RNA segnale nella differenziazione e cellule differenziate di RNA FISH utilizzando un relativamente breve tempo di incubazione. Questo protocollo immuno-FISH potrebbe essere applicato ad altre proteine ​​di interesse e abbondante RNA, anche se l&#39;ottimizzazione in immunofluorescenza e RNA FISH può essere richiesto. Al fine di applicare il protocollo di altri RNA, il numBER di eventuali sonde oligonucleotidiche avrebbe bisogno di essere considerati, seguita dalla ottimizzazione per tentativi ed errori di concentrazione della sonda, tempo di incubazione, e la temperatura per l&#39;RNA FISH. Un esempio di altre applicazioni è il nostro precedente successo nel rilevare RNA telomerico con sonde LNA singole 22. Per la progettazione della sonda e la preparazione per il rilevamento di bassi abbondanti bersagli di RNA, consultare l&#39;articolo di Raj e Tyagi 23. Un altro problema che deve essere considerato è il passo permeabilizzazione. È necessaria considerazione attenta per quanto riguarda diverse condizioni permeabilizzazione; per esempio, gli effetti più lievi rispetto a quanto descritto nel nostro protocollo possono verificarsi con permeabilizzazione dopo la fissazione 15. Varie procedure permeabilizzazione anche bisogno di essere considerati nello svolgimento di immuno-FISH utilizzando diversi tipi di cellule. L&#39;ordine di immunofluorescenza e RNA FISH può anche influenzare la rilevazione di proteine ​​bersaglio, modifiche e RNA da immuno-FISH. Se RNA FISH è eseguireed prima di immunofluorescenza, una incubazione ora durante il segmento di RNA FISH è sufficiente rilevare Xist RNA segnale. Tuttavia, poiché la formammide contenuta nel buffer di ibridazione e tampone di lavaggio FISH influisce negativamente H3K27me3 immunofluorescenza, abbiamo sempre effettuiamo H3K27me3 immunofluorescenza prima Xist RNA FISH in questo protocollo. Per altre applicazioni, l&#39;ordine delle procedure dipenderebbe proteine ​​bersaglio e modifiche epigenetiche da osservare mediante immunofluorescenza. Come l&#39;anticorpo primario che abbiamo usato per H3K27me3 immunofluorescenza ha un titolo elevato e specificità H3K27me3 24, siamo in grado di utilizzare un tempo di incubazione più breve per immunofluorescenza. Tuttavia, il tempo di reazione e temperatura per immunostaining dipendono dal anticorpo utilizzato e quindi l&#39;ottimizzazione è necessario per ciascun anticorpo. Utilizzando sonde oligonucleotidiche, Xist rilevamento RNA da RNA FISH è stata significativamente migliorata. Nei nostri studi precedenti, abbiamo scoperto che un sottoinsieme di difcellule ferentiating con H3K27me3 colorazione sul Xi non sono associati con il segnale Xist RNA 25. Poiché modifica H3K27me3 sul Xi è associato PRC2 assunzione da Xist RNA 9 - 11, 26, abbiamo ipotizzato che ciò fosse dovuto alla penetrazione inefficiente riboprobes nei nuclei rispetto all&#39;anticorpo per immunofluorescenza. Utilizzando sonde oligonucleotidiche in questo protocollo, abbiamo osservato che il segnale H3K27me3 nel differenziare cellule femminili quasi sempre co-localizzati con Xist RNA (Figura 1). Questo protocollo immuno-FISH veloce ci permette di ottenere un&#39;istantanea delle modifiche dinamiche che ruotano attorno Xist lncRNA e offre un nuovo strumento per aiutare acquisire una migliore comprensione del modo in cui funziona lncRNA. IncRNAs influenzare diverse funzioni cellulari come imprinting genomico, regolazione genica, traduzione RNA, e maturazione dell&#39;RNA 27. Lo sviluppo di una maggiore comprensione del ruolo diverses interpretato da lncRNA contribuirebbe a spingere il campo avanti e permettere future scoperte nella regolazione dei processi cellulari vitali nel corpo umano, e contribuire allo sviluppo di potenziali bersagli per i trattamenti di malattia. Dal momento che questo protocollo può essere facilmente ottimizzato rispetto ad altri marcatori e lncRNAs di interesse, è un ottimo strumento per aiutare ad affrontare i misteri di vari lncRNAs nelle cellule.

Mammalian cromosoma X inattivazione (XCI) è una strategia per compensare lo squilibrio nel dosaggio del gene X-linked tra XX e XY, in cui uno dei due cromosomi X nelle femmine è trascrizionalmente inattivato 1. Inattivazione del cromosoma X è un ottimo sistema modello per lungo RNA non codificante (lncRNA) di ricerca. Inattivazione del cromosoma X è regolata da più lncRNAs, ed è stato ampiamente studiato negli ultimi decenni per scoprire i meccanismi di crosstalk tra lncRNAs, la trascrizione, la struttura della cromatina e l&#39;organizzazione nucleare 2, 3. Il centro X inattivazione (XIC) situato sul cromosoma X è un locus genetico complesso formato da un certo numero di geni che producono RNA non codificanti 4. X-inattiva trascrizione specifico (Xist) lncRNA nei mammiferi eutherian è uno di questi lncRNA che svolge un ruolo cruciale nel cromosoma X inattivazione 5,6. Trascrizioni Xist circondano la posizione del future Xi per avviare inattivazione del cromosoma X, e appaiono come una nuvola quando visualizzato utilizzando RNA FISH; questa formazione è denominato &quot;Xist Cloud&quot; 7. Dal Xist RNA interagisce con vari enzimi che modificano la cromatina, co-localizzazione delle nuvole Xist con diverse modificazioni epigenetiche per cromatina silente e trascrizione repressiva si osserva durante cromosoma X inattivazione 8. Ad esempio, Xist RNA interagisce con Polycomb complesso repressione 2 (PRC2) che è responsabile per H3K27me3 e induce uno stato cromatina repressione 9. Il verificarsi della nuvola Xist sul Xi e la sua co-localizzazione con la modifica intensiva H3K27me3 rappresenta un paesaggio eterocromatina facoltativa del Xi 10,11. Tecniche di citogenetica, come il DNA / RNA FISH hanno percorso una lunga strada dal metodo tradizionale utilizzando sonde radiomarcate 12 alle tecniche più recenti e avanzate con maggiore sensibilità eimmagini fluorescenti utilizzando più sonde oligonucleotidiche 13,14. DNA / RNA FISH accoppiato con immunofluorescenza è stato regolarmente utilizzato come strumento citologico per comprendere l&#39;organizzazione spazio-temporale nucleare, localizzazione RNA, la struttura della cromatina e modifiche. La preparazione sonda più standard per RNA FISH implica l&#39;uso di plasmide o cromosomiche artificiale (BAC) cloni batterici e la loro successiva etichettatura o con traduzione nick o adescamento casuali 15. Tuttavia, quasi il 70% dei geni nei topi e il 40% dei geni nell&#39;uomo mostrano una sovrapposizione di senso e antisenso trascrizioni 16, quindi richiede un metodo FISH specifico strand per distinguere senso e antisenso trascrizioni. In vitro sonde RNA trascritti (riboprobe ) sono spesso utilizzati per specifici filamento di RNA FISH 17,18; Tuttavia, ciò comporta la preparazione di un clone plasmidico o prodotti di PCR con T7, SP6, T3 o promotore e riboprobes sintetizzare. Inoltre, ribosonde derivato da genomic DNA o cDNA contengono spesso regioni non-specifici e gli elementi ripetitivi, che si traducono in alto rumore di fondo. Un altro problema è che riboprobes, che sono a poche centinaia di nucleotidi di lunghezza e contengono più fluorofori, non possono penetrare efficacemente nel nucleo. Per aggirare questo, più sonde oligonucleotidiche marcate con brevi un unico fluoroforo alla fine sono stati sviluppati che hanno una buona sensibilità, potenza del segnale uniforme, e la facilità di purificazione e movimentazione 14. Inoltre, gli oligonucleotidi di DNA sono generalmente più stabile di RNA. Abbiamo applicato una simile strategia di utilizzo di oligonucleotidi in Xist RNA FISH 19 con immunofluorescenza per comprendere le dinamiche epigenetici del Xi indotte da Xist lncRNA durante il processo di inattivazione del cromosoma X. Questo protocollo descrive la creazione di sonde oligonucleotidiche e corretta preparazione di cellule, così come l&#39;utilizzo di immunofluorescenza e RNA FISH. Xist RNA FISH utilizzando oligonucle multiplaotides è economicamente efficiente nel lungo termine se Xist RNA FISH viene eseguita di routine nel proprio laboratorio. Questa tecnica può essere utilizzata per identificare lncRNAs nelle cellule e contemporaneamente mappatura sua co-localizzazione con modificazioni epigenetiche o fattori. Uno dei principali vantaggi del protocollo è la capacità di modificare facilmente per soddisfare i propri interessi di ricerca.

<table><tbody><tr><td>oligonucleotides with 5&amp;rsquo;-amino modification</td><td>IDT</td><td></td><td></td></tr><tr><td>Alexa Fluor 488 Reactive Dye</td><td>Life Technologies</td><td>A32750</td><td></td></tr><tr><td>MicroSpin G-25 columns</td><td>GE Healthcare</td><td>27-5325-01</td><td></td></tr><tr><td>Cytospin 2</td><td>Shandon</td><td>59900102</td><td></td></tr><tr><td>Bovine Serum Albumin, Molecular Biology Grade (for hybridization buffer)</td><td>Roche</td><td>10715859103</td><td></td></tr><tr><td>Histone H3K27me3 antibody</td><td>Active Motif</td><td>61017</td><td></td></tr><tr><td>Alexa Fluor 555 Goat Anti-Mouse, highly cross-adsorbed</td><td>Life Technologies</td><td>A21424</td><td></td></tr><tr><td>ProLong Gold antifade reagent</td><td>Life Technologies</td><td>P36931</td><td></td></tr></tbody></table>

quick fluorescent in situ hybridization protocol for xist rna combined with immunofluorescence of histone modification in x-chromosome inactivation

Combinando RNA ibridazione in situ fluorescente (FISH) con immunofluorescenza (immuno-FISH) crea una tecnica che può essere impiegata a livello di singola cellula per rilevare la dinamica spaziale della localizzazione RNA con visione simultanea nella localizzazione delle proteine, modificazioni epigenetiche e altri dettagli che può essere evidenziato mediante immunofluorescenza. Inattivazione del cromosoma X è un paradigma per lungo RNA non codificante (lncRNA) mediata silenziamento genico. Trascrizione specifico (Xist) accumulo lncRNA X-inattiva (chiamato nuvola Xist) su uno dei due cromosomi X nelle femmine di mammifero è un passo fondamentale per avviare l&#39;inattivazione del cromosoma X. Xist RNA direttamente o indirettamente interagisce con vari enzimi che modificano la cromatina e introduce distinti paesaggi epigenetici alla inattiva cromosoma X (Xi). Una nota caratteristica epigenetica del Xi è l&#39;istone H3 trimetil-lisina 27 (H3K27me3) modifica. Qui, descriviamo un immuno-FISH semplice e veloceprotocollo per la rilevazione Xist RNA utilizzando RNA FISH con sonde multiple oligonucleotide accoppiato con immunofluorescenza di H3K27me3 per esaminare la localizzazione di Xist RNA e modificazioni epigenetiche associate. Utilizzando sonde oligonucleotidiche risultati in un tempo di incubazione più breve e la rilevazione più sensibile di Xist RNA rispetto alle sonde di RNA trascritto in vitro (ribosonde). Questo protocollo fornisce un potente strumento per comprendere le dinamiche di lncRNAs e la sua modificazione epigenetica associato, la struttura della cromatina, l&#39;organizzazione nucleare e regolazione trascrizionale.

Immagini rappresentative della rapida immuno-FISH sono mostrati nella Figura 1A. Co-localizzazione del segnale Xist RNA nuvola e H3K27me3 sul Xi è stato rilevato nel differenziare cellule femminili. Al giorno 12 sulla differenziazione, più del 90% delle cellule EB aveva una nuvola Xist (Figura 1B). Sonde oligonucleotidiche Breve efficientemente penetrati nei nuclei, portando ad una visualizzazione di quasi tutti H3K27me3 segnali co-localizzato con Xist RNA (Figura 1C; 97%, n = 150). <img alt="Figura 1" src="/files/ftp_upload/52053/52053fig1highres.jpg" /> Figura 1: RNA Xist e H3K27me3 co-localizzare sulla Xi nel differenziare topo EB (A) Immuno-FISH per Xist RNA con modificazioni H3K27me3 nel differenziare cellule EB femminili al giorno 12 sulla differenziazione.. Sonde Xist sono stati etichettati con Alexa Fluor 488, e anticorpo primario anti-H3K27me3 è stato ilprotetta da anti-topo IgG Alexa Fluor anticorpo secondario 555-coniugato. I nuclei sono stati di contrasto con DAPI. La regione inscatolato è amplificato nei pannelli inferiori. Bar Scala:... 10 micron (B) Frequenza di Xist cellule cloud e H3K27me3-positivi EB al giorno 12 sulla differenziazione (C) Frequenza di co-localizzazione del cloud Xist con segnale H3K27me3 in EB al giorno 12 sulla differenziazione <a href="https://www.jove.com/files/ftp_upload/52053/52053fig1large.jpg" target="_blank">prego clicca qui per vedere una versione più grande di questa figura.</a> <table><tbody><tr><td> Xp1 </td><td> ggtaagtatccaaaaccccgttgg </td></tr><tr><td> XP2 </td><td> cgatcagcagcaacagtacacg </td></tr><tr><td> Xp3 </td><td> gcaattggttgcttttatccagtcc </td></tr><tr><td> XP4 </td><td> cgcaacaccgcacactaatacg </td></tr><tr><td> XP5 </td><td> gccatcttagacacattcaagagcat </td></tr><tr><td> XP6 </td><td> cacacgtgaagtaccaagcgaaac </td></tr><tr><td> XP7 </td><td> gccacgtatagagcactgtaagagactatg </td></tr><tr><td> XP8 </td><td> caaagcacactatcagacgtgtcg </td></tr><tr><td> XP9 </td><td> ggagaatctagatgccataaaggcaag </td></tr><tr><td> XP10 </td><td> tgatggacactgcattttagcactg </td></tr><tr><td> Xp11 </td><td> ggacactgcattttagcaatacgattc </td></tr><tr><td> XP12 </td><td> gtgatgggcactgcattttagc </td></tr><tr><td> XP13 </td><td> agatgggctatctcagtcttataggct </td></tr><tr><td> Xp14 </td><td> ggaagtcagtatggagggggtatg </td></tr><tr><td> Xp15 </td><td> tgggactgtgactactacagcaatga </td></tr><tr><td> XP16 </td><td> aagactcaattcctagtcaggattatccac </td></tr><tr><td> XP17 </td><td> gggctgtagctctatgacagtgcttt </td></tr><tr><td> Xp18 </td><td> gtcttcaccagatgcagattactacagtg </td></tr><tr><td> Xp19 </td><td> aatagtttgaggaaggggtttcaagtg </td></tr><tr><td> XP20 </td><td> gctgttcaggtttccttctgtagtga </td></tr><tr><td> Xp21 </td><td> gcaagagatacaatggtccgaaaagt </td></tr><tr><td> Xp22 </td><td> agcacttcgtacaaccctctttctg </td></tr><tr><td> Xp23 </td><td> gaagagagcaggtcattcgtcagag </td></tr><tr><td> Xp24 </td><td> gcaactgagacactgtagccatatgaag </td></tr><tr><td> XP25 </td><td> ttcctggaggaagaacggaaaga </td></tr><tr><td> XP26 </td><td> tgattagaaggcttaggtcatcttcca </td></tr><tr><td> Xp27 </td><td> ttttgttcagagtagcgaggacttga </td></tr><tr><td> Xp28 </td><td> aatagagcagaatggcttcctcgaa </td></tr><tr><td> Xp29 </td><td> acattgcttgatcacgctgaagac </td></tr><tr><td> XP30 </td><td> gcaaggaagaaatagacacacaaagc </td></tr><tr><td> Xp31 </td><td> ggaagaaatagatgtaacaaagaattagacaca </td></tr><tr><td> XP32 </td><td> cacttcagagccacttgaatcctg </td></tr><tr><td> Xp33 </td><td> agtcacaggtgtcctgtagaaacagttc </td></tr><tr><td> Xp34 </td><td> cctttatgggcaatggcaacaat </td></tr><tr><td> XP35 </td><td> ggcacatctgcatattgcttgtcta </td></tr><tr><td> Xp36 </td><td> gcaactaagaccatgaacccacaa </td></tr><tr><td> Xp37 </td><td> aaacacactggccttaagtatatggactg </td></tr><tr><td> Xp38 </td><td> cattcatttgcacacatggaacaat </td></tr><tr><td> Xp39 </td><td> tgggagacaatatttagcctccaggt </td></tr><tr><td> Xp40 </td><td> cctagcaagggcactgttttgtaataa </td></tr><tr><td> Xp41 </td><td> taacatttagcacactgccttgcac </td></tr><tr><td> Xp42 </td><td> cagtgatctacactaggtccacctcaca </td></tr><tr><td> Xp43 </td><td> ttatgttgaaggaatcttggccttg </td></tr><tr><td> Xp44 </td><td> aagtgagagctgtagtctcaaggtgtga </td></tr><tr><td> Xp45 </td><td> gtattcaacctctgaggcaaactgtg </td></tr><tr><td> Xp46 </td><td> agattgtggaacttagatggctgtca </td></tr><tr><td> Xp47 </td><td> tggaactgcattaaagtcccaacttag </td></tr><tr><td> Xp48 </td><td> gaactcccagacctcttcaacctg </td></tr></tbody></table&gt; Tabella 1: Sequenza di oligonucleotidi marcati modo fluorescente per Xist RNA FISH. Le 48 oligonucleotidi sono stati sintetizzati con una modifica 5&#39;-amino per preparare sonde oligonucleotidiche fluorescente per Xist RNA FISH.

Watch this Scientific Journal Video about Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation at JoVE.co

Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation

We developed an easily customized strand-specific fluorescent in situ hybridization (FISH) protocol combined with immunofluorescence. This allows for a detailed examination of RNA dynamics with simultaneous insight into the chromatin structure, nuclear organization, and transcriptional regulation at the single cell level.

Veloce fluorescente<em&gt; In Situ</em&gt; Protocollo di ibridazione per Xist RNA combinata con immunofluorescenza di istone modifica in cromosoma X inattivazione

Combining RNA fluorescent in situ hybridization (FISH) with immunofluorescence (immuno-FISH) creates a technique that can be employed at the single cell ...

quick-fluorescent-situ-hybridization-protocol-for-xist-rna-combined

Nanyang Technological University

Research

JoVE Journal

Biology

Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation

13.9K Views.  Cincinnati Children's Hospital Medical Center. We developed an easily customized strand-specific fluorescent in situ hybridization (FISH) protocol combined with immunofluorescence. This allows for a detailed examination of RNA dynamics with simultaneous insight into the chromatin structure, nuclear organization, and transcriptional regulation at the single cell level. 

Video: Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development. The Xenopuslaevis embryo is very useful for studying organogenesis because their large size makes them very suitable for identifying organs at the earliest steps in organogenesis. At this time, the primary method used for identifying a specific organ or primordium is whole mount in situ hybridization with labeled antisense RNA probes specific to a gene that is expressed in the organ of interest. In addition, it is relatively easy to manipulate genes or signaling pathways in Xenopus and in situ hybridization allows one to then assay for changes in the presence or morphology of a target organ. Whole mount in situ hybridization is a multi-day protocol with many steps involved. Here we provide a simplified protocol with reduced numbers of steps and reagents used that works well for routine assays. In situ hybridization robots have greatly facilitated the process and we detail how and when we utilize that technology in the process. Once an in situ hybridization is complete, capturing the best image of the result can be frustrating. We provide advice on how to optimize imaging of in situ hybridization results. Although the protocol describes assessing organogenesis in Xenopus laevis, the same basic protocol can almost certainly be adapted to Xenopus tropicalis and other model systems.

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

The Xenopus laevis embryo continues to be exceptionally useful in the study of early development due to its large size and ease of manipulation. A simplified protocol for whole mount in situ hybridization protocol is provided that can be used in the identification of specific organs in this model system.

Capire in anticipo Organogenesis Utilizzando una semplificata<em&gt; In Situ</em&gt; Protocollo di ibridazione in<em&gt; Xenopus</em

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development.  The Xenopuslaevis embryo ...

Ricerca

Biologia dello sviluppo

Using Fluorescence In Situ Hybridization (FISH) to Monitor the State of Arm Cohesion in Prometaphase and Metaphase I Drosophila Oocytes

In humans, chromosome segregation errors in oocytes are responsible for the majority of miscarriages and birth defects. Moreover, as women age, their risk of conceiving an aneuploid fetus increases dramatically and this phenomenon is known as the maternal age effect. One requirement for accurate chromosome segregation during the meiotic divisions is maintenance of sister chromatid cohesion during the extended prophase period that oocytes experience. Cytological evidence in both humans and model organisms suggests that meiotic cohesion deteriorates during the aging process. In addition, segregation errors in human oocytes are most prevalent during meiosis I, consistent with premature loss of arm cohesion. The use of model organisms is critical for unraveling the mechanisms that underlie age-dependent loss of cohesion. Drosophila melanogaster offers several advantages for studying the regulation of meiotic cohesion in oocytes. However, until recently, only genetic tests were available to assay for loss of arm cohesion in oocytes of different genotypes or under different experimental conditions. Here, a detailed protocol is provided for using fluorescence in situ hybridization (FISH) to directly visualize defects in arm cohesion in prometaphase I and metaphase I arrested Drosophila oocytes. By generating a FISH probe that hybridizes to the distal arm of the X chromosome and collecting confocal Z stacks, a researcher can visualize the number of individual FISH signals in three dimensions and determine whether sister chromatid arms are separated. The procedure outlined makes it possible to quantify arm cohesion defects in hundreds of Drosophila oocytes. As such, this method provides an important tool for investigating the mechanisms that contribute to cohesion maintenance as well as the factors that lead to its demise during the aging process.

Using Fluorescence In Situ Hybridization FISH to Monitor the State of Arm Cohesion in Prometaphase and Metaphase I Drosophila Oocytes

This manuscript presents a detailed method for generating X-chromosome arm probes and performing fluorescence in situ hybridization (FISH) to examine the state of sister chromatid cohesion in prometaphase and metaphase I arrested Drosophila oocytes. This protocol is suitable for determining whether meiotic arm cohesion is intact or disrupted in different genotypes.

Mediante ibridazione In Situ di fluorescenza (pesce) per monitorare lo stato di coesione braccio in prometafase e metafase I Oocytes di Drosophila

In humans, chromosome segregation errors in oocytes are responsible for the majority of miscarriages and birth defects. Moreover, as women age, their risk ...

Zebrafish Whole Mount High-Resolution Double Fluorescent In Situ Hybridization

Whole mount in situ hybridization is one of the most widely used techniques in developmental biology. Here, we present a high-resolution double fluorescent in situ hybridization protocol for analyzing the precise expression pattern of a single gene and for determining the overlap of the expression domains of two genes. The protocol is a modified version of the standard in situ hybridization using alkaline phosphatase and substrates such as NBT/BCIP and Fast Red 1,2. This protocol utilizes standard digoxygenin and fluorescein labeled probes along with tyramide signal amplification (TSA) 3. The commercially available TSA kits allow flexible experimental design as fluorescence emission from green to far-red can be used in combination with various nuclear stains, such as propidium iodide, or fluorescence immunohistochemistry for proteins. TSA produces a reactive fluorescent substrate that quickly covalently binds to moieties, typically tyrosine residues, in the immediate vicinity of the labeled antisense riboprobe. The resulting staining patterns are high resolution in that subcellular localization of the mRNA can be observed using laser scanning confocal microscopy 3,4. One can observe nascent transcripts at the chromosomal loci, distinguish nuclear and cytoplasmic staining and visualize other patterns such as cortical localization of mRNA. Studies in Drosophila indicate that roughly 70% of mRNAs exhibit specific patterns of subcellular localization that frequently correlate with the function of the encoded protein 5. When combined with computer-aided reconstruction of 3D confocal datasets, our protocol allows the detailed analysis of mRNA distribution with sub-cellular resolution in whole vertebrate embryos.

Zebrafish Whole Mount High-Resolution Double Fluorescent In Situ Hybridization

Whole mount in situ hybridization is one of the most widely used techniques in developmental biology. Here, we present a high-resolution double fluorescent in situ hybridization protocol for analyzing the precise expression pattern of a single gene and for determining the overlap of the expression domains of two genes. We include a propidium iodide nuclear counter-stain to highlight tissue organization.

Zebrafish intero monte ad alta risoluzione doppia fluorescente In Situ Ibridazione

Whole mount in situ hybridization is one of the most widely used techniques in developmental biology.  Here, we present a high-resolution double ...

Biologia

Exploring X Chromosomal Aberrations in Ovarian Cells by Using Fluorescence In Situ Hybridization

Millions of people worldwide deal with issues concerning fertility. Reduced fertility, or even infertility, may be due to many different causes, including genetic disorders, of which chromosomal abnormalities are the most common. Fluorescence in situ hybridization (FISH) is a well-known and frequently used method to detect chromosomal aberrations in humans. FISH is mainly used for the analysis of chromosomal abnormalities in the spermatozoa of males with numerical or structural chromosomal aberrations. Furthermore, this technique is also frequently applied in females to detect X chromosomal aberrations that are known to cause ovarian dysgenesis. However, information on the X chromosomal content of ovarian cells from females with X chromosomal aberrations in lymphocytes and/or buccal cells is still lacking.
The aim of this study is to advance basic research regarding X chromosomal aberrations in females, by presenting two methods based on FISH to identify the X chromosomal content of ovarian cells. First, a method is described to determine the X chromosomal content of isolated ovarian cells (oocytes, granulosa cells, and stromal cells) in non-grafted ovarian cortex tissue from females with X chromosomal aberrations. The second method is directed at evaluating the effect of chromosomal aberrations on folliculogenesis by determining the X chromosomal content of ovarian cells of newly formed secondary and antral follicles in ovarian tissue, from females with X chromosomal aberrations after long-term grafting into immunocompromised mice. Both methods could be helpful in future research to gain insight into the reproductive potential of females with X chromosomal aberrations.

Exploring X Chromosomal Aberrations in Ovarian Cells by Using Fluorescence In Situ Hybridization

This article presents two methods based on fluorescence in situ hybridization to determine the X chromosomal content of ovarian cells in non-grafted and grafted ovarian cortex tissue from females with X chromosomal aberrations.

Esplorazione delle aberrazioni cromosomiche X nelle cellule ovariche utilizzando l'ibridazione fluorescenza in situ

Millions of people worldwide deal with issues concerning fertility. Reduced fertility, or even infertility, may be due to many different causes, including ...

Genetica

Fluorescent Calcium Imaging and Subsequent In Situ Hybridization for Neuronal Precursor Characterization in Xenopus laevis

Spontaneous intracellular calcium activity can be observed in a variety of cell types and is proposed to play critical roles in a variety of physiological processes. In particular, appropriate regulation of calcium activity patterns during embryogenesis is necessary for many aspects of vertebrate neural development, including proper neural tube closure, synaptogenesis, and neurotransmitter phenotype specification. While the observation that calcium activity patterns can differ in both frequency and amplitude suggests a compelling mechanism by which these fluxes might transmit encoded signals to downstream effectors and regulate gene expression, existing population-level approaches have lacked the precision necessary to further explore this possibility. Furthermore, these approaches limit studies of the role of cell-cell interactions by precluding the ability to assay the state of neuronal determination in the absence of cell-cell contact. Therefore, we have established an experimental workflow that pairs time-lapse calcium imaging of dissociated neuronal explants with a fluorescence in situ hybridization assay, allowing the unambiguous correlation of calcium activity pattern with molecular phenotype on a single-cell level. We were successfully able to use this approach to distinguish and characterize specific calcium activity patterns associated with differentiating neural cells and neural progenitor cells, respectively; beyond this, however, the experimental framework described in this article could be readily adapted to investigate correlations between any time-series activity profile and expression of a gene or genes of interest.

Fluorescent Calcium Imaging and Subsequent In Situ Hybridization for Neuronal Precursor Characterization in Xenopus laevis

We present a two-part protocol that combines fluorescent calcium imaging with in situ hybridization, allowing the experimenter to correlate patterns of calcium activity with gene expression profiles on a single-cell level.

Imaging fluorescente del calcio e successiva ibridazione in situ per la caratterizzazione neuronale del precursore in Xenopus laevis

Spontaneous intracellular calcium activity can be observed in a variety of cell types and is proposed to play critical roles in a variety of physiological ...

Combining Double Fluorescence In Situ Hybridization with Immunolabelling for Detection of the Expression of Three Genes in Mouse Brain Sections

Detection of gene expression in different types of brain cells e.g., neurons, astrocytes, oligodendrocytes, oligodendrocyte precursors and microglia, can be hampered by the lack of specific primary or secondary antibodies for immunostaining. Here we describe a protocol to detect the expression of three different genes in the same brain section using double fluorescence in situ hybridization with two gene-specific probes followed by immunostaining with an antibody of high specificity directed against the protein encoded by a third gene. The Aspartoacyclase (ASPA) gene, mutations of which can lead to a rare human white matter disease - Canavan disease - is thought to be expressed in oligodendrocytes and microglia but not in astrocytes and neurons. However, the precise expression pattern of ASPA in the brain has yet to be established. This protocol has allowed us to determine that ASPA is expressed in a subset of mature oligodendrocytes and it can be generally applied to a wide range of gene expression pattern studies.

Combining Double Fluorescence In Situ Hybridization with Immunolabelling for Detection of the Expression of Three Genes in Mouse Brain Sections

Localizing gene expression to specific cell types can be challenging due to the lack of specific antibodies. Here we describe a protocol for simultaneous triple detection of gene expression by combining double fluorescence RNA in situ hybridization with immunostaining.

La combinazione di doppio Fluorescenza<em&gt; In Situ</em&gt; Ibridazione con Immunolabelling per il rilevamento della Manifestazione di tre geni nel cervello di topo Sezioni

Detection of gene expression in different types of brain cells e.g., neurons, astrocytes, oligodendrocytes, oligodendrocyte precursors and microglia, can ...

Neuroscienze

Quantitative Fluorescence In Situ Hybridization (FISH) and Immunofluorescence (IF) of Specific Gene Products in KSHV-Infected Cells

Mechanistic insight arrives from careful study and quantification of specific RNAs and proteins. The relative locations of these biomolecules throughout the cell at specific times can be captured with fluorescence in situ hybridization (FISH) and immunofluorescence (IF). During lytic herpesvirus infection, the virus hijacks the host cell to preferentially express viral genes, causing changes in cell morphology and behavior of biomolecules. Lytic activities are centered in nuclear factories, termed viral replication compartments, which are discernable only with FISH and IF. Here we describe an adaptable protocol of RNA FISH and IF techniques for Kaposi's sarcoma-associated herpesvirus (KSHV)-infected cells, both adherent and in suspension. The method includes steps for the development of specific anti-sense oligonucleotides, double RNA FISH, RNA FISH with IF, and quantitative calculations of fluorescence intensities. This protocol has been successfully applied to multiple cell types, uninfected cells, latent cells, lytic cells, time-courses, and cells treated with inhibitors to analyze the spatiotemporal activities of specific RNAs and proteins from both the human host and KSHV.

Quantitative Fluorescence In Situ Hybridization FISH and Immunofluorescence IF of Specific Gene Products in KSHV-Infected Cells

We describe a protocol utilizing fluorescence in situ hybridization (FISH) to visualize multiple herpesviral RNAs within lytically infected human cells, either in suspension or adherent. This protocol includes quantification of fluorescence producing a nucleocytoplasmic ratio and can be extended for simultaneous visualization of host and viral proteins with immunofluorescence (IF).

Quantitative Fluorescence In Situ Hybridization (FISH) e Immunofluorescence (IF) di prodotti genici specifici nelle cellule infette da KSHV

Mechanistic insight arrives from careful study and quantification of specific RNAs and proteins. The relative locations of these biomolecules throughout ...

Immunologia e infezioni

Whole Mount RNA Fluorescent in situ Hybridization of Drosophila Embryos

Assessing the expression pattern of a gene, as well as the subcellular localization properties of its transcribed RNA, are key features for understanding its biological function during development. RNA in situ hybridization (RNA-ISH) is a powerful method used for visualizing RNA distribution properties, be it at the organismal, cellular or subcellular levels 1. RNA-ISH is based on the hybridization of a labeled nucleic acid probe (e.g. antisense RNA, oligonucleotides) complementary to the sequence of an mRNA or a non-coding RNA target of interest 2. As the procedure requires primary sequence information alone to generate sequence-specific probes, it can be universally applied to a broad range of organisms and tissue specimens 3. Indeed, a number of large-scale ISH studies have been implemented to document gene expression and RNA localization dynamics in various model organisms, which has led to the establishment of important community resources 4-11. While a variety of probe labeling and detection strategies have been developed over the years, the combined usage of fluorescently-labeled detection reagents and enzymatic signal amplification steps offer significant enhancements in the sensitivity and resolution of the procedure 12. Here, we describe an optimized fluorescent in situ hybridization method (FISH) employing tyramide signal amplification (TSA) to visualize RNA expression and localization dynamics in staged Drosophila embryos. The procedure is carried out in 96-well PCR plate format, which greatly facilitates the simultaneous processing of large numbers of samples.

Whole Mount RNA Fluorescent in situ Hybridization of Drosophila Embryos

Here we describe a whole-mount fluorescent in situ hybridization (FISH) protocol for determining the expression and localization properties of RNAs expressed during embryogenesis in the fruit fly, Drosophila melanogaster.

Tutta la Monte RNA fluorescente<em&gt; In situ</em&gt; L&#39;ibridazione di<em&gt; Drosophila</em&gt; Embrioni

Assessing  the expression pattern of a gene, as well as the subcellular localization  properties of its transcribed RNA, are key features for ...

Combined DNA-RNA Fluorescent In situ Hybridization (FISH) to Study X Chromosome Inactivation in Differentiated Female Mouse Embryonic Stem Cells

Fluorescent in situ hybridization (FISH) is a molecular technique which enables the detection of nucleic acids in cells. DNA FISH is often used in cytogenetics and cancer diagnostics, and can detect aberrations of the genome, which often has important clinical implications. RNA FISH can be used to detect RNA molecules in cells and has provided important insights in regulation of gene expression. Combining DNA and RNA FISH within the same cell is technically challenging, as conditions suitable for DNA FISH might be too harsh for fragile, single stranded RNA molecules. We here present an easily applicable protocol which enables the combined, simultaneous detection of Xist RNA and DNA encoded by the X chromosomes. This combined DNA-RNA FISH protocol can likely be applied to other systems where both RNA and DNA need to be detected.

Combined DNA-RNA Fluorescent In situ Hybridization FISH to Study X Chromosome Inactivation in Differentiated Female Mouse Embryonic Stem Cells

Fluorescent in situ hybridization (FISH) allows the detection of nucleic acids in their native environment within cells. We here describe a protocol for the combined, simultaneous detection of RNA and DNA by means of FISH, which can be used to study X chromosome inactivation in mouse embryonic stem cells.

DNA-RNA combinato fluorescente<em&gt; In situ</em&gt; Ibridazione (FISH) per studiare inattivazione del cromosoma X nelle cellule staminali embrionali di topo differenziata Femminile

Fluorescent in situ hybridization (FISH) is a molecular technique which enables the detection of nucleic acids in cells. DNA FISH is often used in ...

Simple Method for Fluorescence DNA In Situ Hybridization to Squashed Chromosomes

DNA in situ hybridization (DNA ISH) is a commonly used method for mapping sequences to specific chromosome regions. This approach is particularly effective at mapping highly repetitive sequences to heterochromatic regions, where computational approaches face prohibitive challenges. Here we describe a streamlined protocol for DNA ISH that circumvents formamide washes that are standard steps in other DNA ISH protocols. Our protocol is optimized for hybridization with short single strand DNA probes that carry fluorescent dyes, which effectively mark repetitive DNA sequences within heterochromatic chromosomal regions across a number of different insect tissue types. However, applications may be extended to use with larger probes and visualization of single copy (non-repetitive) DNA sequences. We demonstrate this method by mapping several different repetitive sequences to squashed chromosomes from Drosophila melanogaster neural cells and Nasonia vitripennis spermatocytes. We show hybridization patterns for both small, commercially synthesized probes and for a larger probe for comparison. This procedure uses simple laboratory supplies and reagents, and is ideal for investigators who have little experience with performing DNA ISH.

Simple Method for Fluorescence DNA In Situ Hybridization to Squashed Chromosomes

Here, we present a simple method for performing fluorescence DNA in situ hybridization (DNA ISH) to visualize repetitive heterochromatic sequences on slide-mounted chromosomes. The method requires minimal reagents and it is versatile for use with short or long probes, different tissues, and detection with fluorescence or non-fluorescence-based signals.

Veloce fluorescente

Riepilogo

Esplora Altri Video

Capire in anticipo Organogenesis Utilizzando una semplificata

Mediante ibridazione In Situ di fluorescenza (pesce) per monitorare lo stato di coesione braccio in prometafase e metafase I Oocytes di Drosophila

Zebrafish intero monte ad alta risoluzione doppia fluorescente In Situ Ibridazione

Esplorazione delle aberrazioni cromosomiche X nelle cellule ovariche utilizzando l'ibridazione fluorescenza in situ

Imaging fluorescente del calcio e successiva ibridazione in situ per la caratterizzazione neuronale del precursore in Xenopus laevis

La combinazione di doppio Fluorescenza

Quantitative Fluorescence In Situ Hybridization (FISH) e Immunofluorescence (IF) di prodotti genici specifici nelle cellule infette da KSHV

Tutta la Monte RNA fluorescente

DNA-RNA combinato fluorescente

Metodo semplice per DNA fluorescenza