Questo lavoro è stato reso possibile da finanziamenti a JK dei Centri di eccellenza dell&#39;Ontario e del Fondo di ricerca Ontario. Vorremmo ringraziare Siddika Pardhan e il Dr. Peter Ferguson per l&#39;assistenza tecnica durante le riprese.

NOTA: Il seguente protocollo è stato progettato per l&#39;utilizzo con cellule aderenti. Le modifiche sono necessarie per applicare il metodo a cellule non-aderenti coltivate in sospensione. Gli esperimenti CAM descritti nel protocollo sono progettati per l&#39;uso con cellule che esprimono un marcatore fluorescente (ad esempio, GFP, RFP, ecc). Nove giorni embrioni di pollo sono tenuti il ​​giorno 2 del protocollo sperimentale per gli esperimenti CAM. 1. Preparazione e Trasfezione delle cellule tumorali con oligonucleotidi antisenso (ASO) <ol><li> Medio Aspirare dalla boccetta T75 (s) contenente cellule di interesse, lavare con 1XPBS, e aggiungere 2 ml di 0,25% tripsina / EDTA. Aggiungere 10 ml di terreno di coltura completo per ogni beuta e trasferire le cellule in soluzione ad un tubo da 50 ml. Contare le cellule e regolare il volume in modo che la concentrazione finale è 1.0x10 5 cellule per ml. </li><li> Label due gruppi di palloni T25: un gruppo conterrà otto flaconi, etichettati 1-8, e sarà used per l&#39;esperimento di misura metabolismo tempo reale; e il secondo gruppo conterrà anche 8 palloni e verrà utilizzato per l&#39;esperimento CAM embrione di pollo. Aggiungere 2 ml di cellule in soluzione ad ogni pallone e posto in incubatrice (37 ° C, 5% CO 2 O / N). </li><li> La mattina dopo (giorno 0, Tempo 0), etichetta di tre 5 ml provette nel modo seguente: il controllo (non-targeting ASO o siRNA), &#39;obiettivo di interesse&#39; (vale a dire, il targeting ASO o siRNA), e Lipofectamine 2000 (o simile reagente di trasfezione). Diluire le soluzioni magazzino ASO alla concentrazione appropriata con mezzo privo di siero in provetta appropriata. <ol><li> Aggiungere la quantità necessaria di reagente di trasfezione al tubo appropriato e incubare in terreno privo di siero per 5 min. Aggiungere la soluzione reagente di trasfezione ai tubi ASO e incubare per 20 min. </li></ol></li><li> Aggiungere 250 pl di controllo ASO soluzione reagente di trasfezione per ciascuno dei flaconi 1-4 in ciascun gruppo, e 250microlitri di &#39;bersaglio di interesse&#39; ASO soluzione reagente di trasfezione per ciascuno dei flaconi 5-8 in ciascun gruppo. Incubare per 4 ore (37 ᵒC, 5% di CO 2). <ol><li> Durante l&#39;incubazione, eseguire le operazioni descritte nella sezione 2.1. Dopo l&#39;incubazione, aggiungere 3 ml di mezzo completo in ciascuno dei palloni gruppo esperimento CAM e ritornare alla incubatore O / N (37 ᵒC, 5% CO 2). Elaborare il gruppo dell&#39;esperimento metabolismo in base alla descrizione nella sezione 2.2. Elaborare l&#39;esperimento CAM impostato secondo la descrizione al punto 4. </li></ol></li></ol> 2. Chip Preparazione Biosensor e semina cellulare <ol><li> In un ambiente sterile, lavare accuratamente sei chip biosensore con 400 ml di PBS. Sterilizzare i chip con 400 ml di etanolo al 70% per 20 min. Lavare tre volte con 400 ml di PBS. <ol><li> Posizionare i chip all&#39;interno cultur tessuto sterilee piatti per evitare la contaminazione. Mettere tre chip in un piatto etichettato &#39;di controllo&#39;, e tre in un piatto denominato &#39;obiettivo di interesse&#39;. </li></ol></li><li> Etichettare due 50 ml tubi come &#39;controllo&#39; e &#39;oggetto di interesse&#39;. Lavare le cellule con PBS e aggiungere un volume adeguato di 0,25% tripsina / EDTA. Attendere che le stacca monostrato e raccogliere le cellule da ciascun flacone. Deposito la soluzione nel tubo appropriata. <ol><li> Contare le cellule e regolare il volume in modo che la concentrazione finale è 6.0x10 5 cellule / ml. Centrifuga e risospendere le cellule se la concentrazione iniziale è troppo bassa. </li></ol></li><li> Aggiungere 250 microlitri della soluzione di cellule per ogni chip biosensore nel gruppo appropriato (per un totale di 1.25x10 5 cellule per chip). Eseguire questa attività un gruppo alla volta per minimizzare il rischio di confondere i chip. Porre le capsule sterili contenenti i chip all&#39;interno di una camera di umidità per evitare l&#39;evaporazione, e posto le cha umiditàmber nell&#39;incubatrice O / N (37 ᵒC, 5% di CO 2). </li><li> La mattina dopo (giorno 1), aspirare accuratamente la media da ogni chip e sostituirlo con 250 ml di terreno di coltura addizionato con siero fetale bovino 0,2% (FBS) e 1x penicillina e la streptomicina (P / S). Incubare per 4 ore (37 ᵒC, 5% di CO 2). </li></ol> Preparazione sistema 3. Metabolismo Misurazione e Solution Preparazione <ol><li> Durante l&#39;incubazione, preparare le soluzioni farmacologiche necessarie e il sistema di misura del metabolismo per il test imminente. NOTA: Il sistema di misurazione del metabolismo contiene un totale di sei moduli. Ogni modulo ospita un gettone per ogni esperimento. <ol><li> Suddividere il dosaggio nei seguenti gruppi sperimentali: un chip di ciascuno degli &#39;di controllo&#39; e &#39;bersaglio di interesse&#39; gruppi per ricevere veicolo per la durata del test; due chip di ogni gruppo per ricevere il trattamento farmacologico per un periodo di tempo definito durante l&#39;unassay, seguito dal veicolo durante il periodo di washout. </li><li> Per gli studi di sensibilizzazione droga, modificare la lunghezza, la tempistica e concentrazione del trattamento farmacologico per adattarsi alla particolare farmaco in questione. NOTA: Per cisplatino, i seguenti passaggi sono stati determinati empiricamente con le cellule A549, e può variare a seconda della linea cellulare. Eseguire tutte le fasi con la portata di default di 4 ml / min. 6 ore di crescita a medio + 0,2% FBS e 1x P / S 24 ore di 6 micron cisplatino in media + 0,2% FBS 1x P / S 24 ore di crescita a medio + 0,2% FBS e 1x P / S 18 ore di crescita a medio + 0,2% FBS e 1x P / S 4 h di 0,1% Triton X- NOTA: deviazioni dalle seguente procedura richiederanno calcolo per determinare il volume di soluzioni medie e farmaco basato sulla portata desiderata e la durata dell&#39;esperimento. Le seguenti sezioni sono basate sulle fasi sopra descritte. </li></ol></li><li> Etichetta e riempire quattordici 50 ml provette con 50 ml di una crescita media + 0,2% FBS und 1x P / S. Inserire sei una misurazione metabolismo tubo sistema a cremagliera, sei in un altro, e gli altri due in una terza cremagliera tubo che contiene anche i tubi con cisplatino. Sigillare le prime due cremagliere con una membrana permeabile aria per evitare l&#39;evaporazione. </li><li> Preparare una soluzione di 6 micron cisplatino (del volume appropriato) in media + 0,2% FBS con 1x P / S. Dispensare il volume richiesto di soluzione di cisplatino in quattro etichettati 50 ml provette. <ol><li> Posizionare i tubi nelle restanti quattro slot nel terzo metabolismo tubo di misurazione rack. Assicurarsi che i tubi sono disposti in apposite feritoie corrispondenti alle biomodules desiderati. Sigillare le provette con una membrana permeabile all&#39;aria. </li></ol></li><li> Preparare ed etichettare sei 50 ml tubi e riempirli con 20 ml ciascuna di 0,1% soluzione Triton-X in mezzo. La soluzione di Triton-X lisare tutte le cellule rimanenti e fornire un valore &#39;zero&#39; per ogni chip. Porre i tubi in una quarta misura metabolismo tubo unità rack e sigillare with una membrana permable aria per evitare l&#39;eccessiva evaporazione. </li><li> Caricare i chip nelle biomodules e avviare l&#39;esperimento. </li></ol> Trattamento Drug 4. CAM Experiment e iniezione NOTA: I passi e le procedure per la preparazione di embrioni di pollo per un esperimento CAM sono descritte altrove 19 <ol><li> Iniziare l&#39;elaborazione del CAM esperimento a 48 ore dopo la trasfezione (Day 2). Sub-dividere il &#39;controllo&#39; e &#39;oggetto di interesse&#39; gruppi in due palloni per il veicolo, e due per cisplatino. Aspirare il supporto dai fiaschi e riempire sia con 3 ml di mezzo fresco, o 6 micron cisplatino. Incubare per 6 ore (37 ᵒC, 5% di CO 2). </li><li> Aspirare il mezzo, poi lavare e trypsinize le cellule; raccogliere le cellule trypsinized in soluzione in quattro opportunamente etichettati provette da 15 ml. <ol><li> Centrifuga e lavare le cellule tre volte con PBS. Risospendere il pellet cellulare in 5 ml di PBS und contare le cellule. </li><li> Regolare il volume in modo che la concentrazione cellulare finale è 1.0x10 6 cellule / ml. Trasferire la soluzione cella in etichettati 5 ml tubi per l&#39;iniezione, e disporli sul ghiaccio. Capovolgere delicatamente le provette prima dell&#39;iniezione per assicurare che le cellule sono ben miscelati. </li></ol></li><li> Mettere da parte un totale di 24 embrioni di pollo (9 giorni) per l&#39;iniezione (6 per gruppo). Effettuare l&#39;iniezione con un ago di vetro collegata ad un tubo flessibile collegato ad una siringa da 1 ml. L&#39;individuo esegue l&#39;iniezione deve essere accecato al gruppo di trattamento. <ol><li> Utilizzando un microscopio stereo, iniettare 1.0x10 5 cellule in un volume di 100 microlitri nella circolazione venosa della CAM. Utilizzare una lenta, tecnica pulsante di iniettare l&#39;intero volume delle cellule. Tamponare delicatamente il sito di iniezione con un morbido pulire per arginare il flusso di sangue e di assorbire eventuali perdite. Etichettare ogni contenitore embrione adeguatamente dopo ogni iniezione. </li></ol></li><li> Confermare la presenza e distribuzione di cellule fluorescenti nella vascolarizzazione della CAM dopo iniezione visualizzando utilizzando un microscopio a fluorescenza. Prendete nota di tutti gli embrioni in cui il numero di cellule tumorali appare bassa, o la distribuzione è scarsa. </li><li> Mettere gli embrioni di pollo in una camera umida e memorizzarli in un incubatore (37 ° C, 60% di umidità). Aspettare 7-9 giorni prima enumerazione foci metastatici. </li></ol> 5. metastatico fuoco Enumeration <ol><li> Durante il periodo di incubazione 7-9 giorni, monitorare gli embrioni e scartare eventuali morti. Assicurarsi che la camera di umidità rimane umida in qualsiasi momento durante il periodo di incubazione. </li><li> Utilizzando un microscopio stereo fluorescenza a 20 ingrandimenti, la scansione dell&#39;intera superficie superiore della CAM dell&#39;embrione in un modello a griglia regolare. </li><li> Contare il numero di focolai metastatico in ogni campo di vista, quindi coincidere il numero per un totale finale per embrione. In questo modo per i sei embrioni in ogni gruppo fornirà un numero o mediof foci metastatici per il trattamento. </li></ol>

<ol>
	<li>Bouwman, P., Jonkers, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+deregulated+DNA+damage+signalling+on+cancer+chemotherapy+response+and+resistance.">The effects of deregulated DNA damage signalling on cancer chemotherapy response and resistance.</a> Nat Rev Cancer. 12, 587-598 (2012).</li><li>Bozic, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+dynamics+of+cancer+in+response+to+targeted+combination+therapy.">Evolutionary dynamics of cancer in response to targeted combination therapy.</a> Elife. 2, e00747 (2013).</li><li>Diaz, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+evolution+of+acquired+resistance+to+targeted+EGFR+blockade+in+colorectal+cancers.">The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers.</a> Nature. 486, 537-540 (2012).</li><li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+BRCA2+and+Thymidylate+Synthase+Creates+Multidrug+Sensitive+Tumor+Cells+via+the+Induction+of+Combined+'Complementary+Lethality'.">Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined 'Complementary Lethality'.</a> Mol Ther Nucleic Acids. 2, e78 (2013).</li><li>Lord, C. J., Ashworth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA+damage+response+and+cancer+therapy.">The DNA damage response and cancer therapy.</a> Nature. 481, 287-294 (2012).</li><li>Helleday, T., Petermann, E., Lundin, C., Hodgson, B., Sharma, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+repair+pathways+as+targets+for+cancer+therapy.">DNA repair pathways as targets for cancer therapy.</a> Nat Rev Cancer. 8, 193-204 (2008).</li><li>Shaheen, M., Allen, C., Nickoloff, J. A., Hromas, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+lethality:+exploiting+the+addiction+of+cancer+to+DNA+repair.">Synthetic lethality: exploiting the addiction of cancer to DNA repair.</a> Blood. 117, 6074-6082 (2011).</li><li>Green, S., Benedetti, J., Smith, A., Crowley, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Clinical trials in oncology. 28, (2012).</li><li>Begley, C. G., Ellis, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drug+development:+Raise+standards+for+preclinical+cancer+research.">Drug development: Raise standards for preclinical cancer research.</a> Nature. 483, 531-533 (2012).</li><li>Galluzzi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+definitions+of+cell+death+subroutines:+recommendations+of+the+Nomenclature+Committee+on+Cell+Death+2012.">Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012.</a> Cell Death Differ. 19, 531-533 (2012).</li><li>Ruggeri, B. A., Camp, F., Miknyoczki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+disease:+pre-clinical+animal+models+of+cancer+and+their+applications+and+utility+in+drug+discovery.">Animal models of disease: pre-clinical animal models of cancer and their applications and utility in drug discovery.</a> Biochem Pharmacol. 87, 150-161 (2014).</li><li>Kwon, M. C., Berns, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+for+lung+cancer.">Mouse models for lung cancer.</a> Mol Oncol. 7, 165-177 (2013).</li><li>Young, M., Ordonez, L., Clarke, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+are+the+best+routes+to+effectively+model+human+colorectal+cancer.">What are the best routes to effectively model human colorectal cancer.</a> Mol Oncol. 7, 178-189 (2013).</li><li>Sharma, S. V., Haber, D. A., Settleman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-based+platforms+to+evaluate+the+therapeutic+efficacy+of+candidate+anticancer+agents.">Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents.</a> Nat Rev Cancer. 10, 241-253 (2010).</li><li>Garnett, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+genomic+markers+of+drug+sensitivity+in+cancer+cells.">Systematic identification of genomic markers of drug sensitivity in cancer cells.</a> Nature. 483, 570-575 (2012).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+monitoring+of+cisplatin-induced+cell+death.">Real-time monitoring of cisplatin-induced cell death.</a> PLoS One. 6, e19714 (2011).</li><li>Cvetkovic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KISS1R+induces+invasiveness+of+estrogen+receptor-negative+human+mammary+epithelial+and+breast+cancer+cells.">KISS1R induces invasiveness of estrogen receptor-negative human mammary epithelial and breast cancer cells.</a> Endocrinology. 154, 1999-2014 (2013).</li><li>Leong, H. S., Chambers, A. F., Lewis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessing+cancer+cell+migration+and+metastatic+growth+in+vivo+in+the+chick+embryo+using+fluorescence+intravital+imaging.">Assessing cancer cell migration and metastatic growth in vivo in the chick embryo using fluorescence intravital imaging.</a> Methods Mol Biol. 872, 1-14 (2012).</li><li>Hung, Y. P., Albeck, J. G., Tantama, M., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+cytosolic+NADH-NAD(+)+redox+state+with+a+genetically+encoded+fluorescent+biosensor.">Imaging cytosolic NADH-NAD(+) redox state with a genetically encoded fluorescent biosensor.</a> Cell Metab. 14, 545-554 (2011).</li><li>Tantama, M., Hung, Y. P., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+intracellular+pH+in+live+cells+with+a+genetically+encoded+red+fluorescent+protein+sensor.">Imaging intracellular pH in live cells with a genetically encoded red fluorescent protein sensor.</a> J Am Chem Soc. 133, 10034-10037 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BRCA2+inhibition+enhances+cisplatin-mediated+alterations+in+tumor+cell+proliferation,+metabolism,+and+metastasis.">BRCA2 inhibition enhances cisplatin-mediated alterations in tumor cell proliferation, metabolism, and metastasis.</a> Mol. Onc. 8 (8), 1429-1440 (2014).</li></ol>

Gli autori non hanno nulla da rivelare.

A causa del costo inerente e rischi associati a test clinici, vi è la necessità di sviluppare una migliore e più rigorosa metodologia di test pre-clinici per valutare adeguatamente nuovi regimi di trattamento anti-cancro. Attuali tecniche comunemente utilizzate tutte debolezze mostrano che possono limitare la loro capacità di discriminare tra potenzialmente promettenti terapeutici target / agenti, e quelli che possono essere meno efficaci. Abbiamo ideato un protocollo per valutare nuovi approcci anti-tumorali che af...

Resistenza mirata e / o trattamento del cancro citotossico è un importante problema clinico che può portare al fallimento del trattamento, ricaduta acquisita, e un aumento della mortalità del paziente 1. Dato l&#39;elevato livello di eterogeneità nella maggior parte dei tumori, è una certezza matematica che un tumore del numero sufficientemente elevato di cellule conterrà un sottoinsieme di cellule resistenti alle terapie singole o combinate rivolte vie molecolari in cui tali cellule dipendono per la sopravvivenza 2,3. Tali cellule tumorali possono essere selezionate positivamente per durante il trattamento, determinando una recidiva di malattia. Sviluppo di nuove terapie che contemporaneamente colpiscono diversi meccanismi di sopravvivenza delle cellule del cancro, prima o dopo la selezione del trattamento-mediata, è quindi clinicamente importante. Un alto livello di instabilità del genoma e la mutazione nei genomi tumorali è una caratteristica fondamentale che distingue le cellule tumorali da cellule ospiti non-tumorali 4. Di conseguenza, un usefustrategia l per aumentare l&#39;efficacia delle attività lesiva sul DNA chemioterapia e per prevenire lo sviluppo di resistenza è di inibire attivamente la riparazione del DNA nelle cellule tumorali 5. Si tratta di un tema di indagine e una varietà di nuovi bersagli di riparazione del DNA vengono esplorati in un contesto pre-clinico. Un certo numero di piccole molecole o inibitori a base antisenso-di questi obiettivi sono stati sviluppati e in attesa di collaudo 6-8. L&#39;obiettivo è quello di individuare le più promettenti candidati pre-clinici e valutare la loro sicurezza ed efficacia in studi clinici. L&#39;alto costo degli studi clinici e il rischio di fallimento (per una serie di motivi, tra cui la valutazione pre-clinica non ottimale) sono formidabili ostacoli al progresso nello sviluppo di nuove terapie 9. L&#39;uso di modelli adeguati e rigorosi pre-clinico per valutare adeguatamente nuovi bersagli terapeutici e farmaci candidati può diminuire il tasso di fallimento delle sperimentazioni cliniche 10 </sup&gt;. Alcuni metodi pre-clinici di uso comune per valutare l&#39;efficacia di nuovi regimi anti-cancro sono: a) la misura di capacità di ridurre la proliferazione delle cellule tumorali in vitro (saggi di proliferazione cellulare), b) la riduzione della terapia indotta della capacità delle cellule tumorali di colonie di coltura tissutale (forma saggi formazione di colonie), c) la riduzione terapia indotta in cellule tumorali attività metabolica in vitro (conversione redox-dye), d) induzione terapia indotta vitro morte delle cellule tumorali in (apoptosi, necrosi, autophagic, associato con la mitosi e altri) 11, ed e) in vivo riduzione della crescita o ablazione umano e topo eterotrapianti 12-14 terapia indotta. Una delle principali debolezze dei metodi elencati in vitro è che nessuno di loro forniscono valutazione continua in tempo reale l&#39;effetto di terapie candidati. Piuttosto, forniscono informazioni solo in selezionati, momenti ampiamente separatidurante il corso del trattamento. Tali misurazioni sono diminuiti capacità di riflettere con precisione l&#39;entità e la tempistica delle risposte delle cellule tumorali. In vivo i modelli del mouse xenotrapianto sono limitati da costi elevati, la lunghezza di tempo per completare, e il rischio di dosaggio e trattamento tempistica sub-ottimali (scheduling). Inoltre, vi sono prove che i modelli roditori xenotrapianto sono predittori limitati di efficacia clinica negli esseri umani, rispetto alla valutazione in vitro delle risposte delle cellule primarie tumorali umane e stabilite linee cellulari tumorali umane a candidati interventi terapeutici 15,16. Abbiamo ideato un protocollo nuova combinazione di valutare nuove combinazioni di farmaci pre-clinica, in modo che affronta le debolezze delle procedure più comuni elencati sopra. In luogo di proliferazione, formazione di colonie, o redox-dye test di conversione, abbiamo utilizzato un&#39;unità di misura del metabolismo di analizzare l&#39;adesione delle cellule, la respirazione, e l&#39;acidificazione in tempo realedurante l&#39;intero periodo di trattamento 17. Allo stesso tempo, abbiamo studiato gli effetti della combinazione di trattamento in vivo, utilizzando un embrione di pollo corioallantoidea membrana (CAM) il modello di invasione e metastasi 18,19. Abbiamo usato questi metodi per valutare la capacità di un oligonucleotide antisenso (ASO) rivolti BRCA2 potenziare l&#39;efficacia del cisplatino farmaco chemioterapico comunemente usato.

<table border="0" cellpadding="0" cellspacing="0" >
	<tbody>
		<tr >
			<td >Name of Material/ Equipment</td>
			<td >Company</td>
			<td >Catalog Number</td>
			<td >Comments/Description</td>
		</tr>
		<tr >
			<td >A549 cells</td>
			<td >ATCC</td>
			<td >CCL-185</td>
			<td>http://www.atcc.org/products/all/CCL-185.aspx</td>
		</tr>
		<tr >
			<td >AeraSeal film&#160;</td>
			<td >Carl Roth GmbH</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >AMEM</td>
			<td >Wisent Bioproducts</td>
			<td >210-011-QK</td>
			<td></td>
		</tr>
		<tr >
			<td >Antisense oligodeoxynucleotides</td>
			<td >Avecia</td>
			<td ></td>
			<td>BRCA2 target sequence: 5&#39; - UAAGGAACGUCAAGAGAUAC - 3&#39; (bases 7241-7259 )</td>
		</tr>
		<tr >
			<td >Axio Zoom V16 Microscope</td>
			<td >Carl Zeiss</td>
			<td ></td>
			<td>http://www.zeiss.ca/microscopy/en_ca/products/stereo-zoom-microscopes/axio-zoom-v16.html</td>
		</tr>
		<tr >
			<td >Bionas Biosensor Chips</td>
			<td >Bionas GmbH and Micronas GmbH</td>
			<td >BIS8001D</td>
			<td></td>
		</tr>
		<tr >
			<td >Bionas Discovery 2500 System&#160;</td>
			<td >Bionas GmbH</td>
			<td ></td>
			<td>http://www.bionas-discovery.com/prodservices/instruments/system2500/</td>
		</tr>
		<tr >
			<td >Cisplatin</td>
			<td >Sigma Aldrich</td>
			<td >479306</td>
			<td></td>
		</tr>
		<tr >
			<td >Fertilized chicken eggs</td>
			<td >Sourced locally</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Fetal bovine serum&#160;</td>
			<td >Gibco - Life Technologies</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Lipofectamine 2000&#160;</td>
			<td >Invitrogen - Life Technologies&#160;</td>
			<td >12566014</td>
			<td>http://www.lifetechnologies.com/ca/en/home/life-science/protein-expression-and-analysis/transfection-selection/lipofectamine-2000.html</td>
		</tr>
		<tr >
			<td >PBS</td>
			<td >Wisent Bioproducts</td>
			<td >311-010-CL</td>
			<td></td>
		</tr>
		<tr >
			<td >Trypsin (0.25%)/EDTA</td>
			<td >Wisent Bioproducts</td>
			<td >325-043-CL</td>
			<td></td>
		</tr>
	</tbody>
</table>

evaluating the effectiveness of cancer drug sensitization in vitro and in vivo

Dato l&#39;elevato livello di eterogeneità e di mutazioni inerenti tumori umani, terapie singoli agenti, o regimi di associazione che prendono di mira la stessa via, sono destinate a fallire. L&#39;accento deve essere posto sulla inibizione di percorsi che sono responsabili per la resistenza intrinseca e / o adattabile alla terapia. Un campo di ricerca attiva è lo sviluppo e la sperimentazione di inibitori di riparazione del DNA che promuovono l&#39;azione di, e prevenire la resistenza a, comunemente chemioterapia e la radioterapia utilizzata. Abbiamo utilizzato un nuovo protocollo per valutare l&#39;efficacia di inibizione BRCA2 come mezzo per sensibilizzare le cellule tumorali al DNA dannoso cisplatino farmaco. Metabolismo cellulare tumorale (acidificazione e respirazione) è stata monitorata in tempo reale per un periodo di 72 ore per delineare efficacia del trattamento su un minuto da basi minuti. In combinazione, abbiamo effettuato una valutazione della frequenza metastatico con una membrana corioallantoidea embrione di pollo (CAM) il modello di stravaso e l&#39;invasione. Questoprotocollo affronta alcuni dei punti deboli di uso comune in vitro e in vivo i metodi per valutare nuovi regimi di terapia del cancro. Può essere utilizzato in aggiunta ai metodi comuni come saggi di proliferazione cellulare, saggi di morte cellulare, e studi in vivo xenotrapianto murini, discriminare più strettamente tra target e agenti candidati, e selezionare solo i candidati più promettenti per ulteriore sviluppo.

Risultati e figure adattato con il permesso di lavoro pubblicato 22. Inibizione BRCA2 induce una diminuzione della respirazione nelle cellule tumorali trattate cisplatino Cellule tumorali A549 polmonari umani trattati con BRCA2-targeting ASO e cisplatino esibito una diminuzione precoce e irreversibile nella respirazione, rispetto alle cellule che hanno ricevuto il controllo ASO e cisplatino da solo; dopo 24 ore di trattamento con cisplatino di...

Watch this Scientific Journal Video about Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo at JoVE.com

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics.

Valutare l&#39;efficacia delle Cancer Drug Sensibilizzazione<em&gt; In Vitro</em&gt; E<em&gt; In Vivo</em

Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same ...

evaluating-effectiveness-cancer-drug-sensitization-vitro

Research

JoVE Journal

Medicine

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

8.2K Views.  Western University. Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics. 

Video: Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent until many years after removal of the primary tumor and adjuvant therapy. A likely explanation of this phenomenon is that tumor cells have seeded metastatic sites, are resistant to conventional therapies, and remain dormant for long periods of time 1-4.
The existence of dormant cancer cells at secondary sites has been described previously as quiescent solitary cells that neither proliferate nor undergo apoptosis 5-7. Moreover, these solitary cells has been shown to disseminate from the primary tumor at an early stage of disease progression 8-10 and reside growth-arrested in the patients' bone marrow, blood and lymph nodes 1,4,11. Therefore, understanding mechanisms that regulate dormancy or the switch to a proliferative state is critical for discovering novel targets and interventions to prevent disease recurrence. However, unraveling the mechanisms regulating the switch from tumor dormancy to metastatic growth has been hampered by the lack of available model systems.
in vivo and ex vivo model systems to study metastatic progression of tumor cells have been described previously 1,12-14. However these model systems have not provided in real time and in a high throughput manner mechanistic insights into what triggers the emergence of solitary dormant tumor cells to proliferate as metastatic disease. We have recently developed a 3D in vitro system to model the in vivo growth characteristics of cells that exhibit either dormant (D2.OR, MCF7, K7M2-AS.46) or proliferative (D2A1, MDA-MB-231, K7M2) metastatic behavior in vivo . We demonstrated that tumor cells that exhibit dormancy in vivo at a metastatic site remain quiescent when cultured in a 3-dimension (3D) basement membrane extract (BME), whereas cells highly metastatic in vivo readily proliferate in 3D culture after variable, but relatively short periods of quiescence. Importantly by utilizing the 3D in vitro model system we demonstrated for the first time that the ECM composition plays an important role in regulating whether dormant tumor cells will switch to a proliferative state and have confirmed this in in vivo studies15-17. Hence, the model system described in this report provides an in vitro method to model tumor dormancy and study the transition to proliferative growth induced by the microenvironment.

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

A modified 3-D in vitro system is presented in which growth characteristics of several tumor cell lines in reconstituted basement membrane correlate with the dormant or proliferative behavior of the tumor cells at a metastatic secondary site in vivo.

Un In Vitro Sistema per studio dormienza tumorale e l&#39;interruttore di crescita metastatica

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent ...

Ricerca

Medicina

Live Imaging of Drug Responses in the Tumor Microenvironment in Mouse Models of Breast Cancer

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional co-culture systems are frequently used to explicate tumor-stroma interactions, including their role in drug responses. However, many of the interactions that occur in vivo in the intact microenvironment cannot be completely replicated in these in vitro settings. Thus, direct visualization of these processes in real-time has become an important tool in understanding tumor responses to therapies and identifying the interactions between cancer cells and the stroma that can influence these responses. Here we provide a method for using spinning disk confocal microscopy of live, anesthetized mice to directly observe drug distribution, cancer cell responses and changes in tumor-stroma interactions following administration of systemic therapy in breast cancer models. We describe procedures for labeling different tumor components, treatment of animals for observing therapeutic responses, and the surgical procedure for exposing tumor tissues for imaging up to 40 hours. The results obtained from this protocol are time-lapse movies, in which such processes as drug infiltration, cancer cell death and stromal cell migration can be evaluated using image analysis software.

We describe a method for imaging response to anti-cancer treatment in vivo and at single cell resolution.

Vivo Imaging di risposte droga nel microambiente tumorale in modelli murini di cancro al seno

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional ...

Slow-release Drug Delivery through Elvax 40W to the Rat Retina: Implications for the Treatment of Chronic Conditions

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these diseases. Chronic retinal diseases such as retinal oedema or neovascularization usually require multiple intraocular injections to effectively treat the condition. However, the risks associated with these injections increase with repeated delivery of the drug. Therefore, alternative delivery methods need to be established in order to minimize the risks of reinjection. Several other investigations have developed methods to deliver drugs over extended time, through materials capable of releasing chemicals slowly into the eye. In this investigation, we outline the use of Elvax 40W, a copolymer resin, to act as a vehicle for drug delivery to the adult rat retina. The resin is made and loaded with the drug. The drug-resin complex is then implanted into the vitreous cavity, where it will slowly release the drug over time. This method was tested using 2-amino-4-phosphonobutyrate (APB), a glutamate analogue that blocks the light response of the retina. It was demonstrated that the APB was slowly released from the resin, and was able to block the retinal response by 7 days after implantation. This indicates that slow-release drug delivery using this copolymer resin is effective for treating the retina, and could be used therapeutically with further testing.

This paper details how Elvax 40W can be used as a slow-release method for drug delivery to the adult rat retina. The protocol for preparing, loading, and delivering the drug-resin complex to the eye is described.

Lento rilascio Drug Delivery attraverso Elvax 40W al Rat Retina: Implicazioni per il trattamento di condizioni croniche

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these ...

Carotid Artery Infusions for Pharmacokinetic and Pharmacodynamic Analysis of Taxanes in Mice

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study model. As the use of mouse models are often a vital step in preclinical drug discovery and drug development1-8, it is necessary to design a system to introduce drugs into mice in a uniform, reproducible manner. Ideally, the system should permit the collection of blood samples at regular intervals over a set time course. The ability to measure drug concentrations by mass-spectrometry, has allowed investigators to follow the changes in plasma drug levels over time in individual mice1, 9, 10. In this study, paclitaxel was introduced into transgenic mice as a continuous arterial infusion over three hours, while blood samples were simultaneously taken by retro-orbital bleeds at set time points. Carotid artery infusions are a potential alternative to jugular vein infusions, when factors such as mammary tumors or other obstructions make jugular infusions impractical. Using this technique, paclitaxel concentrations in plasma and tissue achieved similar levels as compared to jugular infusion. In this tutorial, we will demonstrate how to successfully catheterize the carotid artery by preparing an optimized catheter for the individual mouse model, then show how to insert and secure the catheter into the mouse carotid artery, thread the end of the catheter out through the back of the mouse&#8217;s neck, and hook the mouse to a pump to deliver a controlled rate of drug influx. Multiple low volume retro-orbital bleeds allow for analysis of plasma drug concentrations over time.

This method was developed with the goal of delivering a steady drug solution via the carotid artery, to assess the pharmacokinetics of novel drugs in mouse models.

Infusi carotide di farmacocinetica e di farmacodinamica Analisi dei taxani nei topi

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study ...

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of women are alive 5 years after diagnosis. The omentum is a preferred site of HGSC metastasis formation. Despite the clinical importance of this microenvironment, the contribution of omental adipose tissue to ovarian cancer progression remains understudied. Omental adipose is unusual in that it contains structures known as milky spots, which are comprised of B, T, and NK cells, macrophages, and progenitor cells surrounding dense nests of vasculature. Milky spots play a key role in the physiologic functions of the omentum, which are required for peritoneal homeostasis. We have shown that milky spots also promote ovarian cancer metastatic colonization of peritoneal adipose, a key step in the development of peritoneal metastases. Here we describe the approaches we developed to evaluate and quantify milky spots in peritoneal adipose and study their functional contribution to ovarian cancer cell metastatic colonization of omental tissues both in vivo and ex vivo. These approaches are generalizable to additional mouse models and cell lines, thus enabling the study of ovarian cancer metastasis formation from initial localization of cells to milky spot structures to the development of widespread peritoneal metastases.

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

We outline a protocol that implements both in vivo and ex vivo approaches to study ovarian cancer colonization of peritoneal adipose tissues, particularly the omentum. Furthermore, we present a protocol to quantitate and analyze immune cell-structures in the omentum known as milky spots, which promote metastases of peritoneal adipose.

In vivo ed ex vivo approcci per studiare il cancro ovarico metastatico colonizzazione delle strutture Lattea Spot in peritoneale adiposo

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

Studiare cancro del pancreas staminali caratteristiche cellulari per lo sviluppo di nuove strategie di trattamento

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Depletion of Mouse Cells from Human Tumor Xenografts Significantly Improves Downstream Analysis of Target Cells

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic patient tumors in different assays1. Human tumor xenografts represent the gold standard with respect to tumor biology, drug discovery, and metastasis research 2-4. Tumor xenografts can be derived from different types of material like tumor cell lines, tumor tissue from primary patient tumors4 or serially transplanted tumors. When propagated in vivo, xenografted tissue is infiltrated and vascularized by cells of mouse origin. Multiple factors such as the tumor entity, the origin of xenografted material, growth rate and region of transplantation influence the composition and the amount of mouse cells present in tumor xenografts. However, even when these factors are kept constant, the degree of mouse cell contamination is highly variable.
Contaminating mouse cells significantly impair downstream analyses of human tumor xenografts. As mouse fibroblasts show high plating efficacies and proliferation rates, they tend to overgrow cultures of human tumor cells, especially slowly proliferating subpopulations. Mouse cell derived DNA, mRNA, and protein components can bias downstream gene expression analysis, next-generation sequencing, as well as proteome analysis 5. To overcome these limitations, we have developed a fast and easy method to isolate untouched human tumor cells from xenografted tumor tissue. This procedure is based on the comprehensive depletion of cells of mouse origin by combining automated tissue dissociation with the benchtop tissue dissociator and magnetic cell sorting. Here, we demonstrate that human target cells can be can be obtained with purities higher than 96% within less than 20 min independent of the tumor type.

Human tumor xenografts are vascularized and infiltrated by cells of mouse origin during the growth phase in vivo. To circumvent the bias caused by these contaminating cells during downstream analysis, we developed a method allowing for comprehensive depletion of all mouse cells by magnetic cell sorting.

L&#39;esaurimento delle cellule di topo da xenotrapianti tumorali umani migliora in modo significativo Analisi A valle delle cellule bersaglio

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant CFTR channel in subjects with cystic fibrosis (CF). Identification of subjects that may benefit from these drugs is challenging because of the extensive heterogeneity of CFTR mutations, as well as other unknown factors that contribute to individual drug efficacy. Here, we describe a simple and relatively rapid assay for measuring individual CFTR function and response to CFTR modulators in vitro. Three dimensional (3D) epithelial organoids are grown from rectal biopsies in standard organoid medium. Once established, the organoids can be bio-banked for future analysis. For the assay, 30-80 organoids are seeded in 96-well plates in basement membrane matrix and are then exposed to drugs. One day later, the organoids are stained with calcein green, and forskolin-induced swelling is monitored by confocal live cell microscopy at 37 &#176;C. Forskolin-induced swelling is fully CFTR-dependent and is sufficiently sensitive and precise to allow for discrimination between the drug responses of individuals with different and even identical CFTR mutations. In vitro swell responses correlate with the clinical response to therapy. This assay provides a cost-effective approach for the identification of drug-responsive individuals, independent of their CFTR mutations. It may also be instrumental in the development of future CFTR modulators.

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

This protocol describes an assay for measuring CFTR function and CFTR modulator responses in cultured tissue from subjects with cystic fibrosis (CF). Biopsy-derived intestinal organoids swell in a cAMP-driven fashion, a response that is defective (or strongly reduced) in CF organoids and can be restored by exposure to CFTR modulators.

Forskolin indotta Gonfiore intestinale organoidi: An<em&gt; In Vitro</em&gt; Test per la valutazione della risposta farmacologica nella fibrosi cistica pazienti

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic study in the liver. Here, numerous assays are described to comprehensively measure the phenotype and parameters of hepatic steatosis in mouse and hepatocyte models. 
Combining the physiological, histological, and biochemical methods, this system can be used to assess the progress of hepatic steatosis. In vivo, the measurements of body weight and nuclear magnetic resonance (NMR) provide a general understanding of mice in a non-invasive manner. Hematoxylin and Eosin (H&amp;E) and Oil Red O staining determine the histological morphology and lipid deposition of liver tissue under nutrient overload conditions, such as high-fat diet feeding. Next, the total lipid contents are isolated by chloroform/methanol extraction, which are followed by a biochemical analysis for triglyceride and cholesterol. Moreover, mouse primary hepatocytes are treated with high glucose plus insulin to stimulate lipid accumulation, an efficient in vitro model to mimic diet-induced hyperglycemia and hyperinsulinemia in vivo. Then, the lipid deposition is measured by Oil Red O staining and chloroform/methanol extraction. Oil Red O staining determines intuitive hepatic steatotic phenotypes, while the lipid extraction analysis determines the parameters that can be analyzed statistically. The present protocols are of interest to scientists in the fields of fatty liver diseases, insulin resistance, and type 2 diabetes.

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Here, optimized methods to generate in vivo and in vitro models of hepatic steatosis and to analyze the steatotic phenotypes and related physiological parameters are described.

Analisi ottimizzata delle<em&gt; In Vivo</em&gt; e<em&gt; In Vitro</em&gt; Epatica steatosi

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Preparation of Herbal Medicine: Er-Xian Decoction and Er-Xian-containing Serum for In Vivo and In Vitro Experiments

Traditional herbal medicine, an alternative medicine in the clinical setting, has received increased attention in recent years. Before delivery to the body, an additional extraction procedure is commonly required to release the active constituents from raw herbs. Water decoction is a classical extraction procedure that is still broadly used in the clinical settings. Here, we propose a detailed protocol for er-xian decoction (EXD) in order to apply herbal decoctions to experimental studies. The calculation of an animal-appropriate dose is described, as well as the four main steps of EXD: soaking, water decoction, filtration, and concentration. In addition, serum-containing EXD is introduced to rats as a means of in vitro validation. Here, rats were orally administered EXD for three days. Blood samples were then collected, inactivated, centrifuged, and filtered. The serum, diluted with the culture medium, can be utilized to treat cells or tissues in vitro. For example, EXD was applied to both in vivo and in vitro studies and demonstrated that EXD enhances osteogenesis. This protocol can be used as a reference for the preparation and application of herbal medicines.

Preparation of Herbal Medicine: Er-Xian Decoction and Er-Xian-containing Serum for In Vivo and In Vitro Experiments

Here, we present the preparation of an er-xian decoction (EXD) in four steps&#8212;soaking, decoction, filtration, and concentration&#8212;and demonstrate the administration of a prepared EXD-containing serum to rats. These methods are applicable to the in vivo and in vitro study of herbal decoctions such as traditional Chinese medicines.

Preparazione della medicina a base di erbe: Eruzione di Er-Xian e Serum contenente Er-Xian per<em&gt; In Vivo</em&gt; E<em&gt; In vitro</em&gt; Esperimenti

Traditional herbal medicine, an alternative medicine in the clinical setting, has received increased attention in recent years. Before delivery to the ...