Questo studio è stato sostenuto da una sovvenzione (2013R1A1A3005669) dal National Research Foundation di Corea e una borsa di studio (HI13C0016) del coreano Salute Technology R &amp; S del progetto, Ministero della Salute e del Welfare.

1. Preparazione della sonda <ol><li> Amplificazione PCR della sonda <ol><li> Per la P. Sonda gingivalis -specific, amplificare un frammento di DNA 343 bp di P. gingivalis 16S rRNA mediante PCR utilizzando DNA genomico di P. gingivalis e le seguenti primer: 5&#39;TGC AAC TTG CCT TAC AGA GG-3 &#39;e 5&#39;AGIRE CGT ATC GCC CGT TAT TC-3&#39; 10. Eseguire amplificazioni con le seguenti condizioni ciclo: 35 cicli a 95 ° C per 30 sec, 60 ° C per 30 sec e 72 ° C per 1 min 20 sec seguita da un&#39;estensione di 5 min a 72 ° C 10,11. </li><li> Amplificare la sonda eubatterica con un 70-bp frammento di DNA (5&#39;-CAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAG TCCCGCAACGAGCGCAACCC-3 &#39;) sintetizzato come oligonucleotide ed i seguenti primer: 5&#39;-CTG CAG GTR CMT GGY-3&#39; e 5&#39;-GTT AGG GCG CTC GTT-3 &#39;11. Eseguire amplificazioni con le seguenti condizioni ciclo: 40 ciclia 9 4 ° C per 30 sec, 60 ° C per 30 sec e 72 ° C per 1 min 20 s seguita da un&#39;estensione 5 min a 72 ° C 11,12. </li><li> Precipitare i prodotti di PCR (≥500 microlitri) aggiungendo 3 M acetato di sodio (pH 5.2) e 100% etanolo (a 10: 1: 2) e incubando a -20 ° C per 2 ore. </li><li> Centrifugare la miscela a 14.000 xg per 15 min, risospendere il pellet in 100 ml di tampone TE, e misurare la concentrazione di DNA dalla densità ottica a 260 nm. </li></ol></li><li> DIG-etichettatura utilizzando un sistema di etichettatura e il rilevamento kit DNA DIG <ol><li> Mescolare 3 ug della sonda con acqua ad un volume finale di 15 microlitri. </li><li> Denaturare il DNA a 95 ° C per 10 minuti e raffreddare rapidamente sul ghiaccio. </li><li> Aggiungere 2 ml di 10x hexanucleotide mix, 2 ml di dNTP etichettatura mix, e 1 ml di Klenow enzima per 15 ml di DNA denaturato. </li><li> Mescolare e incubare a 37 ° C per 24 ore a 48 ore e interrompere la reazione mediante riscaldamento a 65 ° C. </li></ol></li><li> Controllare la sensibilità della sonda DIG marcato utilizzando una etichettatura e Detection Kit DNA DIG <ol><li> Caricare manualmente 1 ml di diluizioni seriali della sonda di controllo positivo previste nel kit e 1 ng di sonda DIG marcato sulla membrana di nylon e asciutto per 5 minuti a temperatura ambiente. </li><li> Brevemente immergere la membrana in tampone 2x SSC (0,3 M NaCl, 30 mM citrato di sodio, pH 7,0) e incubare la membrana a 80 ° C per 1 ora per immobilizzare il DNA. </li><li> Brevemente immergere la membrana in tampone acido maleico (MAB, 0,1 M di acido maleico, 0,15 M di NaCl, pH 7,5) e incubare con DIG anti-fosfatasi alcalina (AP) anticorpale coniugata diluito (1: 5.000) in 6 ml di soluzione di blocco, previsto nel kit a temperatura ambiente per 30 min. </li><li> Lavare la membrana con MABT (MAB contenente 1% Tween 20) e applicare 40 microlitri della soluzione NBT / BCIP mescolato con 2 ml di tampone di rilevamento (0,1 M Tris-HCl, 0,1 M NaCl, 0,05 M MgCl 2, pH 9,5) sulla Membrana per 1 min. Se la sensibilità della sonda marcata ènon soddisfacente, ripetere i punti da 1.1.3 a 1.3.4. </li><li> Misurare la concentrazione di DNA della sonda marcata (OD260) e regolare la concentrazione di 100 ng ml -1. </li></ol></li><li> Controllare la specificità della sonda marcata con DIG <ol><li> Denaturare campioni di DNA genomico (25 ng 3 microlitri -1 per ogni campione) da varie specie batteriche, tra il batterio bersaglio dalla sonda specifica, a 95 ° C per 10 minuti e raffreddare rapidamente sul ghiaccio. </li><li> Caricare manualmente il DNA denaturato sulla membrana di nylon e asciugare per 20 minuti a RT. </li><li> Brevemente immergere la membrana in tampone 2x SSC e incubare la membrana a 80 ° C per 2 ore per immobilizzare il DNA. </li><li> Bloccare la membrana con una soluzione di saturazione a temperatura ambiente per 1 ora. </li><li> Diluire la sonda 1 ng ml -1 in tampone di ibridazione, denaturare le sonde diluito, e applicare sulla membrana. </li><li> Incubare la membrana a 45 ° C per 1 ora. </li><li> Lavare la membrana a trevolte con tampone 2x SSC. </li><li> Brevemente immergere la membrana in MAB. </li><li> Incubare con anticorpo anti-DIG AP-coniugato diluito (1: 2.000) in 6 ml di soluzione bloccante a temperatura ambiente per 1 ora. </li><li> Lavare la membrana con MABT e applicare 40 microlitri della soluzione NBT / BCIP mescolato con 2 ml di tampone di rilevamento. </li><li> Quando la sonda non raggiunge la specificità previsto, aumentare la temperatura di ibridazione fino si osserva la specificità. </li></ol></li></ol> 2. In Situ Ibridazione Nota: per evitare l&#39;asciugatura dei campioni e dei reagenti, eseguire tutte le incubazioni in una camera umidificata foderato con carta da cucina bagnato. <ol><li> De-paraffinization e reidratazione di sezioni di tessuto <ol><li> Preparare 4 micron sezioni di tessuto di spessore dai blocchi inclusi in paraffina. Formalina, paraformaldeide e fissativo a base di zinco sono compatibili con questo protocollo. </li><li> Preparare tutti i reagenti con acqua DEPC-trattata. </li><li> Diapositive calore in un forno a secco a 60 ° C per 30 min e incubare vetrini a temperatura ambiente per 30 min. </li><li> Immergere i vetrini in 100% xilene per 5 minuti tre volte; utilizzare xilene fresco ogni volta. Nota: Effettuare questa procedura de-ceretta in una cappa. </li><li> Immergere i vetrini in etanolo al 100% per 5 minuti due volte, con l&#39;etanolo nuovo ogni volta, e reidratare i campioni in serie il 90%, 80% e le soluzioni di etanolo 70% per 5 minuti ciascuno. </li><li> Immergere i vetrini in acqua DEPC trattati per 1 min e lavare i vetrini in DEPC trattati con PBS (pH 7.4) per 6 min. </li></ol></li><li> Pretrattamenti di sezioni di tessuto <ol><li> Immergere i vetrini in acido cloridrico 0,1 N per 20 minuti e lavare i vetrini in acqua DEPC trattati per 30 sec. </li><li> Disegnare una barriera idrofobica campioni utilizzando una penna cera circostante. Nota: Le dimensioni della barriera idrofoba dipende dalle dimensioni dei campioni. Pertanto, i volumi dei reagenti usati nei seguenti passaggi variano a seconda delle dimensioni dei provini ma devono riempire il hybarriera drophobic (50 ml per i piccoli campioni e 400 ml per i grandi campioni). </li><li> Trattare campioni con 50 a 400 ml di proteinasi K (da 1 a 10 mcg ml -1 in DEPC trattati con PBS) in un forno a secco a 37 ° C per 30 minuti e lavare i vetrini in DEPC trattati 1x PBS per 1 min. </li><li> Immergere i vetrini in paraformaldeide al 4% in DEPC trattati con PBS per 10 minuti, poi lavare i vetrini in DEPC trattati con PBS per 1 min. </li><li> Immergere i vetrini in 0,1 M trietanolammina-HCl (pH 8.0) contenente 0,5% di anidride acetica per 20 minuti e lavare i vetrini in acqua DEPC trattati per 30 sec. </li></ol></li><li> Ibridazione con sonda e lavaggio <ol><li> Immergere i vetrini in tampone SSC 2x per 20 min. </li><li> Diluire la sonda a 1 ng ml -1 a tampone di ibridazione (4x SSC, il 50% [vol / vol] formammide, la soluzione di 1x Denhardt, il 10% [peso / volume] destrano solfato, 0.1% [peso / volume] solfato di sodio dodecil, 0,4 mg ml -1 sperma di salmone DNA). Per i controlli negativi, mescolare la sonda marcata conun 10-fold quantità in eccesso di sonda non marcata. </li><li> Denaturare le sonde diluito e applicare 50 a 400 ml su sezioni di tessuto. Posizionare un vetrino sul vetrino e sigillare con smalto. </li><li> Diapositive calore in macchina PCR a 90 ° C per 10 minuti e incubare vetrini in una camera umidificata O / N a 45 ° C o la temperatura ottimale determinato al punto 1.4.11. </li><li> Raffreddare i vetrini a 4 ° C per 30 min, rimuovere vetrini ed immergere i vetrini in tampone SSC seriale come seguenti: 4x SSC per 10 minuti, pre-riscaldato (45 ° C) 2x SSC per 20 minuti, 2x SSC per 10 min, e 0.2x SSC per 10 min. </li></ol></li><li> Detection con anticorpo anti-DIG AP-coniugato <ol><li> Lavare i vetrini in MABT per 5 min. </li><li> Blocco con 50 a 400 ml di soluzione 1% Tween 20 blocco per 20 min. </li><li> Aggiungere 50 a 400 ml di anticorpo anti-DIG-AP diluito in soluzione bloccante (1: 1.000) anld incubare a 37 ° C per 90 min. </li><li> Lavare i vetrini in MABT per 10 min. </li> &lt;li&gt; immergere i vetrini in tampone rilevamento contenente 1% Tween 20 per 5 min. </li><li> Trattare con 50 a 400 μ di 1 levamisolo mM (in tampone rilevamento contenente 1% Tween 20) per 5 minuti per inattivare fosfatasi alcalina endogena. </li><li> Distribuire 50 a 400 microlitri della soluzione premiscelata NBT / BCIP (diluito in tampone di rilevamento a 1: 100) su ciascun campione e incubare vetrini in una camera umidificata a temperatura ambiente per 2 o 3 ore finché il segnale sviluppato è soddisfacente. </li><li> Risciacquare i vetrini con acqua deionizzata per fermare la visualizzazione e applicare 50 a 400 ml di 0,05% [wt / vol] verde metile come una macchia contatore a 37 ° C per 10 min. </li><li> Risciacquare i vetrini con acqua deionizzata, disidratare in etanolo al 100%, ed immergere in xilene. </li><li> Applicare 80 ml di soluzione di montaggio su ogni vetrino e coprire con coprioggetto. </li></ol></li></ol>

<ol>
	<li>Takarada, H., Cattoni, M., Sugimoto, A., Rose, G. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructural+studies+of+human+gingiva.+II.+The+lower+part+of+the+pocket+epithelium+in+chronic+periodontitis.">Ultrastructural studies of human gingiva. II. The lower part of the pocket epithelium in chronic periodontitis.</a> J. Periodontol. 45 (3), 155-169 (1974).</li><li>Allenspach-Petrzilka, G. E., Guggenheim, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+invasion+of+the+periodontium;+an+important+factor+in+the+pathogenesis+of+periodontitis.">Bacterial invasion of the periodontium; an important factor in the pathogenesis of periodontitis.</a> J. Clin. Periodontol. 10 (6), 609-617 (1983).</li><li>Saglie, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+presence+of+bacteria+in+the+oral+epithelium+in+periodontal+disease.+II.+Immunohistochemical+identification+of+bacteria.">The presence of bacteria in the oral epithelium in periodontal disease. II. Immunohistochemical identification of bacteria.</a> J. Periodontol. 57 (8), 492-500 (1986).</li><li>Christersson, L. A., Albini, B., Zambon, J. J., Wikesj&#246;, U. M., Genco, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+localization+of+Actinobacillus+actinomycetemcomitans.+in+human+periodontitis.+I.+Light,+immunofluorescence+and+electron+microscopic+studies.">Tissue localization of Actinobacillus actinomycetemcomitans. in human periodontitis. I. Light, immunofluorescence and electron microscopic studies.</a> J. Periodontol. 58 (8), 529-539 (1987).</li><li>Saglie, F. R., Pertuiset, J., Rezende, M. T., Nestor, M., Marfany, A., Cheng, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ.+correlative+immuno-identification+of+mononuclear+infiltrates+and+invasive+bacteria+in+diseased+gingiva.">In situ. correlative immuno-identification of mononuclear infiltrates and invasive bacteria in diseased gingiva.</a> J. Periodontol. 59 (10), 688-696 (1988).</li><li>Rautemaa, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracellular+localization+of+Porphyromonas+gingivalis.+thiol+proteinase+in+periodontal+tissues+of+chronic+periodontitis+patients.">Intracellular localization of Porphyromonas gingivalis. thiol proteinase in periodontal tissues of chronic periodontitis patients.</a> Oral Dis. 10 (5), 298-305 (2004).</li><li>Marttila, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracellular+localization+of+Treponema+denticola.+chymotrypsin-like+proteinase+in+chronic+periodontitis.">Intracellular localization of Treponema denticola. chymotrypsin-like proteinase in chronic periodontitis.</a> J. Oral Microbiol. 6, (2014).</li><li>Colombo, A. V., da Silva, C. M., Haffajee, A., Colombo, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+intracellular+oral+species+within+human+crevicular+epithelial+cells+from+subjects+with+chronic+periodontitis+by+fluorescence+in+situ.+hybridization.">Identification of intracellular oral species within human crevicular epithelial cells from subjects with chronic periodontitis by fluorescence in situ. hybridization.</a> J. Periodontal Res. 42 (3), 236-243 (2007).</li><li>Abrams, K., Caton, J., Polson, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histologic+comparisons+of+interproximal+gingival+tissues+related+to+the+presence+or+absence+of+bleeding.">Histologic comparisons of interproximal gingival tissues related to the presence or absence of bleeding.</a> J. Periodontol. 55 (11), 629-632 (1984).</li><li>Kim, Y. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Presence+of+Porphyromonas+gingivalis.+and+plasma+cell+dominance+in+gingival+tissues+with+periodontitis.">Presence of Porphyromonas gingivalis. and plasma cell dominance in gingival tissues with periodontitis.</a> Oral Dis. 16 (4), 375-381 (2010).</li><li>Choi, Y. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Porphyromonas+gingivalis.+and+dextran+sodium+sulfate+induce+periodontitis+through+the+disruption+of+physical+barriers.">Porphyromonas gingivalis. and dextran sodium sulfate induce periodontitis through the disruption of physical barriers.</a> Eur. J. Inflammation. 10, 419-431 (2013).</li><li>Choi, Y. S., Kim, Y. C., Ji, S., Choi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Increased+bacterial+invasion+and+differential+expression+of+tight+junction+proteins,+growth+factors,+and+growth+factor+receptors+in+periodontal+lesions.">Increased bacterial invasion and differential expression of tight junction proteins, growth factors, and growth factor receptors in periodontal lesions.</a> J. Periodontol. 85 (8), e313-e322 (2014).</li><li>Baker, G. C., Smith, J. J., Cowan, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review+and+re-analysis+of+domain-specific+16S+primers.">Review and re-analysis of domain-specific 16S primers.</a> J. Microbiol. Methods. 55 (3), 541-555 (2003).</li><li>Hajishengallis, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Low-abundance+biofilm+species+orchestrates+inflammatory+periodontal+disease+through+the+commensal+microbiota+and+the+complement.">A Low-abundance biofilm species orchestrates inflammatory periodontal disease through the commensal microbiota and the complement.</a> Cell Host Microbe. 10 (5), 497-506 (2011).</li><li>Axon, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gastric+cancer+and+Helicobacter+pylori.">Gastric cancer and Helicobacter pylori.</a> Aliment. Pharmacol. Ther. 16 (suppl. 4), 83-88 (2002).</li><li>Fenhalls, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ.+detection+of+Mycobacterium+tuberculosis+transcripts+in+human+lung+granulomas+reveals+differential+gene+expression+in+necrotic+lesions.">In situ. detection of Mycobacterium tuberculosis transcripts in human lung granulomas reveals differential gene expression in necrotic lesions.</a> Infect. Immun. 70 (11), 6330-6338 (2002).</li></ol>

Gli autori non hanno nulla da rivelare.

Qui un protocollo per localizzare i batteri all&#39;interno dei tessuti inclusi in paraffina utilizzando una sonda di DNA DIG marcato è stato descritto. La sonda obiettivi dei DNA o RNA molecole batterica gene 16S rRNA, e le sonde 16S rRNA-mirate può essere progettato come entrambe le specie-specifico o universale. L&#39;ibridazione specifica del P. Sonda gingivalis -specific a P. gingivalis ma non ad altri batteri orali è stato mostrato in precedenza 10. Al contrario, la sonda e...

I batteri svolgono un ruolo nell&#39;eziologia di varie malattie orali come la parodontite, pulpite, pericoronite, cellulite e osteomielite. Per comprendere il ruolo dei batteri nella patogenesi della malattia e per monitorare l&#39;effetto dei trattamenti, localizzazione di batteri all&#39;interno del tessuto è importante. La presenza di batteri all&#39;interno del tessuto gengivale di pazienti con periodontite è stato dimostrato utilizzando vari metodi, tra cui la microscopia elettronica 1,2, immunoistochimica e immunofluorescenza usando specifici anticorpi batteri-3-7 e ibridazione in situ fluorescente (FISH) 8 utilizzando un fluorescence- sonda oligonucleotide etichettato mira 16S rRNA. Tuttavia, questi metodi non sono ampiamente utilizzati a causa di limitazioni o difficoltà tecniche. Rispetto anticorpi, sonde destinate 16S rRNA sono facili da produrre e realizzare specie specificità. FISH ha dimostrato di essere un ottimo strumento per la visualizzazione di bacteria nei loro ambienti naturali, come la placca biofilm. Tuttavia, l&#39;applicazione di FISH a campioni di tessuto è limitata a causa di autofluorescenza di varie componenti del tessuto. Ad esempio, il forte autofluorescenza di globuli rossi spesso ostacola l&#39;applicazione della tecnologia di fluorescenza ai tessuti infiammati quando coinvolgono sanguinamento 9. Per localizzare batteri all&#39;interno dei tessuti gengivali infiammati, quindi, un metodo di ibridazione in situ usando un digossigenina (DIG) sonda di DNA -labeled è stato sviluppato e applicato con successo 10,11. Qui un protocollo dettagliato per la localizzazione di batteri nei tessuti inclusi in paraffina utilizzando P. gingivalis sonde eubatteriche specifico d&#39;e universali è stata descritta. È particolarmente focalizzato sulla standardizzazione del metodo in modo che risultati simili possono essere riprodotti in altri laboratori. Questo protocollo permette la localizzazione dei batteri all&#39;interno del loro contesto istologica e il resuLTS sono altamente riproducibili. Il protocollo descritto può essere utilizzato per localizzare batteri sia in modo specie-specifico o universale in vari tessuti. La sonda universale è particolarmente utile per rilevare batteri nelle malattie polimicrobiche e studiare un potenziale ruolo dei batteri nelle malattie dove il ruolo di batteri specifici non è noto.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Acetic anhydride</td>
			<td>Sigma</td>
			<td>6404</td>
			<td></td>
		</tr>
		<tr>
			<td>50% Dextran sulfate solution</td>
			<td>Millipore</td>
			<td>S4030</td>
			<td></td>
		</tr>
		<tr>
			<td>50X Denhardt&#8217;s solution</td>
			<td>Sigma</td>
			<td>D2532</td>
			<td></td>
		</tr>
		<tr>
			<td>DEPC</td>
			<td>Sigma</td>
			<td>P159220</td>
			<td></td>
		</tr>
		<tr>
			<td>DIG DNA labeling and detection kit</td>
			<td>Roche</td>
			<td>11 093 657 910</td>
			<td></td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>Sigma</td>
			<td>F9037</td>
			<td></td>
		</tr>
		<tr>
			<td>ImmEdge&#8482; Pen</td>
			<td>Dako</td>
			<td>H-400</td>
			<td></td>
		</tr>
		<tr>
			<td>Levamisole</td>
			<td>Vector</td>
			<td>SP-5000</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium chloride</td>
			<td>Sigma</td>
			<td>246964</td>
			<td></td>
		</tr>
		<tr>
			<td>Maleic acid</td>
			<td>Sigma</td>
			<td>M0375</td>
			<td></td>
		</tr>
		<tr>
			<td>Methyl green</td>
			<td>Sigma</td>
			<td>M6776</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraformaldehyde</td>
			<td>Sigma</td>
			<td>P1648</td>
			<td></td>
		</tr>
		<tr>
			<td>Permount</td>
			<td>Fisher</td>
			<td>SP15-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Salmon sperm DNA solution</td>
			<td>Invitrogen</td>
			<td>#15632-011</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Sigma</td>
			<td>S9625</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium citrate</td>
			<td>Duksan</td>
			<td>D1420</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium dodecyl sulfate</td>
			<td>Amresco</td>
			<td>227</td>
			<td></td>
		</tr>
		<tr>
			<td>Triethanolamine-HCl</td>
			<td>Sigma</td>
			<td>90279</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl</td>
			<td>Research organics</td>
			<td>3098T</td>
			<td></td>
		</tr>
	</tbody>
</table>

in situ detection of bacteria within paraffin-embedded tissues using a digoxin-labeled dna probe targeting 16s rrna

The presence of bacteria within the pocket epithelium and underlying connective tissue in gingival biopsies from patients with periodontitis has been reported using various methods, including electron microscopy, immunohistochemistry or immunofluorescence using bacteria-specific antibodies, and fluorescent in situ hybridization (FISH) using a fluorescence-labeled oligonucleotide probe. Nevertheless, these methods are not widely used due to technical limitation or difficulties. Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled DNA probes has been introduced. The paraffin-embedded tissues are the most common form of biopsy tissues available from pathology banks. Bacteria can be detected either in a species-specific or universal manner. Bacterial signals are detected as either discrete forms (coccus, rod, fusiform, and hairy form) of bacteria or dispersed forms. The technique allows other histological information to be obtained: the epithelia, connective tissue, inflammatory infiltrates, and blood vessels are well distinguished. This method can be used to study the role of bacteria in various diseases, such as periodontitis, cancers, and inflammatory immune diseases.

La figura 1 mostra puntino assorbente di sonde DIG-marcate rispetto con la sonda di controllo positivo fornito nel kit per determinare la loro sensibilità. Il 343 bp P. Sonda gingivalis -specific è 25 volte più sensibile rispetto alla sonda eubatterica 70 bp. La figura 2 mostra l&#39;ibridazione in situ dei tessuti gengivali ottenuti da pazienti con parodontite cronica per il rilevamento di P. gingivalis e eubatteri. I segnali batteriche, mostrati ...

Watch this Scientific Journal Video about In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA at JoVE.com

In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled 16S rRNA-targeting DNA probes has been described. This protocol can be applied to study the role of bacteria in various diseases such as periodontitis, cancers, and inflammatory immune diseases.

In Situ rilevamento di batteri all&#39;interno dei tessuti in paraffina utilizzando una sonda DNA Digossina marcato targeting 16S rRNA

The presence of bacteria within the pocket epithelium and underlying connective tissue in gingival biopsies from patients with periodontitis has been ...

in-situ-detection-bacteria-within-paraffin-embedded-tissues-using

Research

JoVE Journal

Immunology and Infection

In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

10.9K Views.  School of Dentistry and Dental Research Institute, Seoul National University. Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled 16S rRNA-targeting DNA probes has been described. This protocol can be applied to study the role of bacteria in various diseases such as periodontitis, cancers, and inflammatory immune diseases.

Video: In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in situ hybridization (FISH) for rapid culture-independent detection of Salmonella spp. Cell-charged tapes can also be placed face-down on selective agar for solid-phase enrichment prior to detection. Alternatively, low-volume liquid enrichments (liquid surface miniculture) can be performed on the surface of the tape in non-selective broth, followed by FISH and analysis via flow cytometry. To begin, sterile adhesive tape is brought into contact with fresh produce, gentle pressure is applied, and the tape is removed, physically extracting microbes present on these surfaces. Tapes are mounted sticky-side up onto glass microscope slides and the sampled cells are fixed with 10% formalin (30 min) and dehydrated using a graded ethanol series (50, 80, and 95%; 3 min each concentration). Next, cell-charged tapes are spotted with buffer containing a Salmonella-targeted DNA probe cocktail and hybridized for 15 - 30 min at 55&deg;C, followed by a brief rinse in a washing buffer to remove unbound probe. Adherent, FISH-labeled cells are then counterstained with the DNA dye 4',6-diamidino-2-phenylindole (DAPI) and results are viewed using fluorescence microscopy. For solid-phase enrichment, cell-charged tapes are placed face-down on a suitable selective agar surface and incubated to allow in situ growth of Salmonella microcolonies, followed by FISH and microscopy as described above. For liquid surface miniculture, cell-charged tapes are placed sticky side up and a silicone perfusion chamber is applied so that the tape and microscope slide form the bottom of a water-tight chamber into which a small volume (&le; 500 &mu;L) of Trypticase Soy Broth (TSB) is introduced. The inlet ports are sealed and the chambers are incubated at 35 - 37&deg;C, allowing growth-based amplification of tape-extracted microbes. Following incubation, inlet ports are unsealed, cells are detached and mixed with vigorous back and forth pipetting, harvested via centrifugation and fixed in 10% neutral buffered formalin. Finally, samples are hybridized and examined via flow cytometry to reveal the presence of Salmonella spp. As described here, our "tape-FISH" approach can provide simple and rapid sampling and detection of Salmonella on tomato surfaces. We have also used this approach for sampling other types of fresh produce, including spinach and jalape&ntilde;o peppers.

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple adhesive-tape-based approach for sampling of tomato and other fresh produce surfaces, followed by rapid whole cell detection of Salmonella using fluorescence in situ hybridization (FISH).

Combinazione di nastro adesivo a base di campionamento e di fluorescenza In situ</emIbridazione> per il rilevamento rapido di Salmonella Su prodotti freschi

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in ...

Ricerca

Immunologia e infezioni

ampliPHOX Colorimetric Detection on a DNA Microarray for Influenza

DNA microarrays have emerged as a powerful tool for pathogen detection.1-5 For instance, many examples of the ability to type and subtype influenza virus have been demonstrated.6-11 The identification and subtyping of influenza on DNA microarrays has applications in both public health and the clinic for early detection, rapid intervention, and minimizing the impact of an influenza pandemic. Traditional fluorescence is currently the most commonly used microarray detection method. However, as microarray technology progresses towards clinical use,1 replacing expensive instrumentation with low cost detection technology exhibiting similar performance characteristics to fluorescence will make microarray assays more attractive and cost-effective.
The ampliPHOX colorimetric detection technology is intended for research applications, and has a limit of detection within one order of magnitude of traditional fluorescence11, with a main advantage being an approximate ten-fold lower instrument cost compared to the confocal microarray scanners required for fluorescence microarray detection. Another advantage is the compact size of the instrument which allows for portability and flexibility, unlike traditional fluorescence instruments. Because the polymerization technology is not as inherently linear as fluorescence detection, however, it is best suited for lower density microarray applications in which a yes/no answer for the presence of a certain sequence is desired, such as for pathogen detection arrays. Currently the maximum spot density compatible with ampliPHOX detection is &tilde;1800 spots/array. Because of the spot density limitations, higher density microarrays are not suitable for ampliPHOX detection.
Here, we present ampliPHOX colorimetric detection technology as a method of signal amplification on a low density microarray developed for the detection and characterization of influenza viruses (FluChip). Although this protocol uses the FluChip (a DNA microarray) as one specific application of ampliPHOX detection, any microarray incorporating biotinylated target can be labeled and detected in a similar manner. The microarray design and biotinylation of the target to be captured are the responsibility of the user. Once the biotinylated target has been captured on the array, ampliPHOX detection can be performed by first tagging the array with a streptavidin-label conjugate (ampliTAG). Upon light exposure using the ampliPHOX Reader instrument, polymerization of a monomer solution (ampliPHY) occurs only in regions containing ampliTAG-labeled targets. The polymer formed can be subsequently stained with a non-toxic solution to improve visual contrast, followed by imaging and analysis using a simple software package (ampliVIEW). The entire FluChip assay from un-extracted sample to result can be performed in about 6 hours, and the ampliPHOX detection steps described above can be completed in about 30 min.

ampliPHOX colorimetric detection technology is presented as an inexpensive alternative to fluorescence detection for microarrays. Based on photopolymerization, ampliPHOX produces solid polymer spots visible to the naked eye in just a few minutes. Results are then imaged and automatically interpreted with a simple yet powerful software package.

ampliPHOX rilevazione colorimetrica su un DNA microarray per l&#39;influenza

DNA microarrays have emerged as a powerful tool for pathogen detection.1-5  For instance, many examples of the ability to type and subtype influenza virus ...

Multiplex Detection of Bacteria in Complex Clinical and Environmental Samples using Oligonucleotide-coupled Fluorescent Microspheres

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated to a microbiota dominated by a number of bacterial species, including Gardnerella vaginalis, Atopobium vaginae, and others1-3. This condition is associated with a range of negative health outcomes, including HIV acquisition4, and it can be difficult to manage clinically5. Furthermore, diagnosis of BV has relied on the use of Gram stains of vaginal swab smears that are scored on various numerical criteria6,7. While this diagnostic is simple, inexpensive, and well suited to resource-limited settings, it can suffer from problems related to subjective interpretations and it does not give a detailed profile of the composition of the vaginal microbiota8. Recent deep sequencing efforts have revealed a rich, diverse vaginal microbiota with clear differences between samples taken from individuals that are diagnosed with BV compared to those individuals that are considered normal9,10, which has resulted in the identification of a number of potential targets for molecular diagnosis of BV11,12. These studies have provided a wealth of useful information, but deep sequencing is not yet practical as a diagnostic method in a clinical setting. We have recently described a method for rapidly profiling the vaginal microbiota in a multiplex format using oligonucleotide-coupled fluorescent beads with detection on a Luminex platform13. This method, like current Gram stain-based methods, is rapid and simple but adds the additional advantage of exploiting molecular knowledge arising from sequencing studies in probe design. This method therefore provides a way to profile the major microorganisms that are present in a vaginal swab that can be used to diagnose BV with high specificity and sensitivity compared to Gram stain while providing additional information on species presence and abundance in a semi-quantitative and rapid manner. This multiplex method is expandable well beyond the range of current quantitative PCR assays for particular organisms, which is currently limited to 5 or 6 different assays in a single sample14. Importantly, the method is not limited to the detection of bacteria in vaginal swabs and can be easily adapted to rapidly profile nearly any microbial community of interest. For example, we have recently begun to apply this methodology to the development of diagnostic tools for use in wastewater treatment plants.

We describe a multiplex method for the detection of microorganisms within a sample using oligonucleotide-coupled fluorescent beads. Amplicon from all organisms within a sample is hybridized to a panel of probe-coupled beads. A Luminex or Bio-Plex instrument is used to query each bead for bead type and hybridization signal.

Rilevazione multiplex di batteri in campioni clinici complessi ed Ambientali con oligonucleotidi accoppiati microsfere fluorescenti

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated ...

Detection of Bacteria Using Fluorogenic DNAzymes

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses each and every year. Prevention of such outbreaks and minimization of the impact of an ongoing epidemic place an ever-increasing demand for analytical methods that can accurately identify culprit pathogens at the earliest stage. Although there is a large array of effective methods for pathogen detection, none of them can satisfy all the following five premier requirements embodied for an ideal detection method: high specificity (detecting only the bacterium of interest), high sensitivity (capable of detecting as low as a single live bacterial cell), short time-to-results (minutes to hours), great operational simplicity (no need for lengthy sampling procedures and the use of specialized equipment), and cost effectiveness. For example, classical microbiological methods are highly specific but require a long time (days to weeks) to acquire a definitive result.1 PCR- and antibody-based techniques offer shorter waiting times (hours to days), but they require the use of expensive reagents and/or sophisticated equipment.2-4 Consequently, there is still a great demand for scientific research towards developing innovative bacterial detection methods that offer improved characteristics in one or more of the aforementioned requirements. Our laboratory is interested in examining the potential of DNAzymes as a novel class of molecular probes for biosensing applications including bacterial detection.5
DNAzymes (also known as deoxyribozymes or DNA enzymes) are man-made single-stranded DNA molecules with the capability of catalyzing chemical reactions.6-8 These molecules can be isolated from a vast random-sequence DNA pool (which contains as many as 1016 individual sequences) by a process known as "in vitro selection" or "SELEX" (systematic evolution of ligands by exponential enrichment).9-16 These special DNA molecules have been widely examined in recent years as molecular tools for biosensing applications.6-8
Our laboratory has established in vitro selection procedures for isolating RNA-cleaving fluorescent DNAzymes (RFDs; Fig. 1) and investigated the use of RFDs as analytical tools.17-29 RFDs catalyze the cleavage of a DNA-RNA chimeric substrate at a single ribonucleotide junction (R) that is flanked by a fluorophore (F) and a quencher (Q). The close proximity of F and Q renders the uncleaved substrate minimal fluorescence. However, the cleavage event leads to the separation of F and Q, which is accompanied by significant increase of fluorescence intensity.
More recently, we developed a method of isolating RFDs for bacterial detection.5 These special RFDs were isolated to "light up" in the presence of the crude extracellular mixture (CEM) left behind by a specific type of bacteria in their environment or in the media they are cultured (Fig. 1). The use of crude mixture circumvents the tedious process of purifying and identifying a suitable target from the microbe of interest for biosensor development (which could take months or years to complete). The use of extracellular targets means the assaying procedure is simple because there is no need for steps to obtain intracellular targets.
Using the above approach, we derived an RFD that cleaves its substrate (FS1; Fig. 2A) only in the presence of the CEM produced by E. coli (CEM-EC).5 This E. coli-sensing RFD, named RFD-EC1 (Fig. 2A), was found to be strictly responsive to CEM-EC but nonresponsive to CEMs from a host of other bacteria (Fig. 3).
Here we present the key experimental procedures for setting up E. coli detection assays using RFD-EC1 and representative results.

We have recently reported a novel approach for generating fluorogenic DNAzyme probes that can be applied to set up a simple, "mix-and-read" fluorescent assay for bacterial detection. These special DNA probes catalyze the cleavage of a chromophore-modified DNA-RNA chimeric substrate in the presence of crude extracellular mixture (CEM) produced by a specific bacterium, thereby translating bacterial detection into fluorescence signal generation. In this report we will describe key experimental procedures where a specific DNAzyme probe denoted "RFD-EC1" is employed for the detection of the model bacterium, Escherichia coli (E. coli).

Rilevazione di batteri utilizzando DNAzimi fluorogenici

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses ...

Fluorescence in situ Hybridizations (FISH) for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells and can be further modified to visualize other components in the cell such as infection with viruses and bacteria. Spatial localization and visualization of viruses and bacteria during the infection process is an essential step that complements expression profiling experiments such as microarrays and RNAseq in response to different stimuli. Understanding the spatiotemporal infections with these agents complements biological experiments aimed at understanding their interaction with cellular components. Several techniques for visualizing viruses and bacteria such as reporter gene systems or immunohistochemical methods are time-consuming, and some are limited to work with model organisms&#160;and involve complex methodologies. FISH that targets RNA or DNA species in the cell is a relatively easy and fast method for studying spatiotemporal localization of genes and for diagnostic purposes. This method can be robust and relatively easy to implement when the protocols employ short hybridizing, commercially-purchased probes, which are not expensive. This is particularly robust when sample preparation, fixation, hybridization, and microscopic visualization do not involve complex steps. Here we describe a protocol for localization of bacteria and viruses in insect and plant tissues. The method is based on simple preparation, fixation, and hybridization of insect whole mounts and dissected organs or hand-made plant sections, with 20 base pairs short DNA probes conjugated to fluorescent dyes on their 5&#39; or 3&#39; ends. This protocol has been successfully applied to a number of insect and plant tissues, and can be used to analyze expression of mRNAs or other RNA or DNA species in the cell.

Fluorescence in situ Hybridizations FISH for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

We describe here a simple fluorescence in situ hybridization (FISH) method for the localization of viruses and bacteria in insect and plant tissues. This protocol can be extended for the visualization of mRNA in whole mount and microscopic sections.

Fluorescenza<em&gt; In situ</em&gt; Ibridazioni (FISH) per la localizzazione di virus e batteri endosimbiontica a Plant e Insetti tessuti

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells ...

Rapid Identification of Gram Negative Bacteria from Blood Culture Broth Using MALDI-TOF Mass Spectrometry

An important role of the clinical microbiology laboratory is to provide rapid identification of bacteria causing bloodstream infection. Traditional identification requires the sub-culture of signaled blood culture broth with identification available only after colonies on solid agar have matured. MALDI-TOF MS is a reliable, rapid method for identification of the majority of clinically relevant bacteria when applied to colonies on solid media. The application of MALDI-TOF MS directly to blood culture broth is an attractive approach as it has potential to accelerate species identification of bacteria and improve clinical management. However, an important problem to overcome is the pre-analysis removal of interfering resins, proteins and hemoglobin&#160;contained in blood culture specimens which, if not removed, interfere with the MS spectra and can result in insufficient or low discrimination identification scores. In addition it is necessary to concentrate bacteria to develop spectra of sufficient quality. The presented method describes the concentration, purification, and extraction of Gram negative bacteria allowing for the early identification of bacteria from a signaled blood culture broth.

The application of matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) mass spectrometry (MS) directly to blood culture broth expedites the identification of bacteria. The presented method is a rapid and reliable method for identification of Gram negative bacteria directly from blood culture broth.

Rapida identificazione dei batteri Gram-negativi dal sangue brodo di coltura Uso MALDI-TOF

An important role of the clinical microbiology laboratory is to provide rapid identification of bacteria causing bloodstream infection. Traditional ...

In Situ Detection of Autoreactive CD4 T Cells in Brain and Heart Using Major Histocompatibility Complex Class II Dextramers

This report demonstrates the use of major histocompatibility complex (MHC) class II dextramers for detection of autoreactive CD4 T cells in situ in myelin proteolipid protein (PLP) 139-151-induced experimental autoimmune encephalomyelitis (EAE) in SJL mice and cardiac myosin heavy chain-&#945; (Myhc) 334-352-induced experimental autoimmune myocarditis (EAM) in A/J mice. Two sets of cocktails of dextramer reagents were used, where dextramers+ cells were analyzed by laser scanning confocal microscope (LSCM): EAE, IAs/PLP 139-151 dextramers (specific)/anti-CD4 and IAs/Theiler&#8217;s murine encephalomyelitis virus (TMEV) 70-86 dextramers (control)/anti-CD4; and EAM, IAk/Myhc 334-352 dextramers/anti-CD4 and IAk/bovine ribonuclease (RNase) 43-56 dextramers (control)/anti-CD4. LSCM analysis of brain sections obtained from EAE mice showed the presence of cells positive for CD4 and PLP 139-151 dextramers, but not TMEV 70-86 dextramers suggesting that the staining obtained with PLP 139-151 dextramers was specific. Likewise, heart sections prepared from EAM mice also revealed the presence of Myhc 334-352, but not RNase 43-56-dextramer+ cells as expected. Further, a comprehensive method has also been devised to quantitatively analyze the frequencies of antigen-specific CD4 T cells in the &#8216;Z&#8217; serial images.

In Situ Detection of Autoreactive CD4 T Cells in Brain and Heart Using Major Histocompatibility Complex Class II Dextramers

The protocol to detect self-reactive CD4 T cells in brain and heart by direct staining with major histocompatibility complex class II dextramers has been described in this report. For comprehensive analysis, a reliable method to enumerate the frequencies of antigen-specific CD4+ T cells in situ is also devised.

In Situ Rilevamento di Autoreattivi CD4 cellule T nel cervello e nel cuore Utilizzo Maggiore di Istocompatibilità Dextramers classe Complex II

This report demonstrates the use of major histocompatibility complex (MHC) class II dextramers for detection of autoreactive CD4 T cells in situ in myelin ...

A Novel Microdissection Approach to Recovering Mycobacterium tuberculosis Specific Transcripts from Formalin Fixed Paraffin Embedded Lung Granulomas

Microdissection has been used for the examination of tissues at DNA, RNA, and protein levels for over a decade. Laser capture microscopy (LCM) is the most common microdissection technique used today. In this technique, a laser is used to focally melt a thermoplastic membrane that overlies a dehydrated tissue section1. The tissue section composite is then lifted and separated from the membrane. Although this technique can be used successfully for tissue examination, it is time consuming and expensive. Furthermore, the successful completion of procedures using this technique requires the use of a laser, thus limiting its use. A new more affordable and practical microdissection approach called mesodissection is a possible solution to the pitfalls of LCM. This technique employs the MESO-1/MeSectr system to mill the desired tissue from a slide mounted tissue sample while concurrently dispensing and aspirating fluid to recover the desired tissue sample into a consumable mill bit. Before the dissection process begins, the user aligns the formalin fixed paraffin embedded (FFPE) slide with a hematoxylin and eosin stained (H&#38;E) reference slide. Thereafter, the operator annotates the desired dissection area and proceeds to dissect the appropriate segment. The program generates an archived image of the dissection. The main advantage of mesodissection is the short duration needed to dissect a slide, taking an average of ten minutes from set up to sample generation in this experiment. Additionally, the system is significantly more cost effective and user friendly. A slight disadvantage is that it is not as precise as laser capture microscopy. In this article we demonstrate how mesodissection can be used to extract RNA from slides from FFPE granulomas caused by Mycobacterium tuberculosis (Mtb).

A Novel Microdissection Approach to Recovering Mycobacterium tuberculosis Specific Transcripts from Formalin Fixed Paraffin Embedded Lung Granulomas

Microdissection has been extensively employed for the examination of DNA, RNA, and protein within tissue. Laser capture microscopy (LCM) is the most commonly used method, but a new milling technique, mesodissection, is recently available. We demonstrate RNA extraction from mesodissected formalin fixed paraffin embedded tissue slides of Mycobacterium tuberculosis granulomas.

Un nuovo approccio Microdissezione per recuperare<em&gt; Mycobacterium tuberculosis</em&gt; Trascrizioni specifici da formalina paraffina fisso incorporato Lung granulomi

Microdissection has been used for the examination of tissues at DNA, RNA, and protein levels for over a decade. Laser capture microscopy (LCM) is the most ...

Identification of Rare Bacterial Pathogens by 16S rRNA Gene Sequencing and MALDI-TOF MS

There are a number of rare and, therefore, insufficiently described bacterial pathogens which are reported to cause severe infections especially in immunocompromised patients. In most cases only few data, mostly published as case reports, are available which investigate the role of such pathogens as an infectious agent. Therefore, in order to clarify the pathogenic character of such microorganisms, it is necessary to conduct epidemiologic studies which include large numbers of these bacteria. The methods used in such a surveillance study have to meet the following criteria: the identification of the strains has to be accurate according to the valid nomenclature, they should be easy to handle (robustness), economical in routine diagnostics and they have to generate comparable results among different laboratories. Generally, there are three strategies for identifying bacterial strains in a routine setting: 1) phenotypic identification characterizing the biochemical and metabolic properties of the bacteria, 2) molecular techniques such as 16S rRNA gene sequencing and 3) mass spectrometry as a novel proteome based approach. Since mass spectrometry and molecular approaches are the most promising tools for identifying a large variety of bacterial species, these two methods are described. Advances, limitations and potential problems when using these techniques are discussed.

Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) and molecular techniques (16S rRNA gene sequencing) permit the identification of rare bacterial pathogens in routine diagnostics. The goal of this protocol lies in the combination of both techniques which leads to more accurate and reliable data.

Identificazione di batteri patogeni rari da 16S rRNA sequenziamento del gene e MALDI-TOF MS

There are a number of rare and, therefore, insufficiently described bacterial pathogens which are reported to cause severe infections especially in ...

A Method for Targeted 16S Sequencing of Human Milk Samples

Studies of microbial communities have become widespread with the development of relatively inexpensive, rapid, and high throughput sequencing. However, as with all these technologies, reproducible results depend on a laboratory workflow that incorporates appropriate precautions and controls. This is particularly important with low-biomass samples where contaminating bacterial DNA can generate misleading results. This article details a semi-automated workflow to identify microbes from human breast milk samples using targeted sequencing of the 16S ribosomal RNA (rRNA) V4 region on a low- to mid-throughput scale. The protocol describes sample preparation from whole milk including: sample lysis, nucleic acid extraction, amplification of the V4 region of the 16S rRNA gene, and library preparation with quality control measures. Importantly, the protocol and discussion consider issues that are salient to the preparation and analysis of low-biomass samples including appropriate positive and negative controls, PCR inhibitor removal, sample contamination by environmental, reagent, or experimental sources, and experimental best practices designed to ensure reproducibility. While the protocol as described is specific to human milk samples, it is adaptable to numerous low- and high-biomass sample types, including samples collected on swabs, frozen neat, or stabilized in a preservation buffer.

A semi-automated workflow is presented for targeted sequencing of 16S rRNA from human milk and other low-biomass sample types.

Un metodo per il sequenziamento del 16S mirato di campioni di latte umano

Studies of microbial communities have become widespread with the development of relatively inexpensive, rapid, and high throughput sequencing. However, as ...