Name: a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters
Uploaded: 2016-03-09T13:00:00.000+00:00
Duration: 12 min 14 s
Description: Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

The authors have no acknowledgements.

1. test di mescole <ol><li> Fare le concentrazioni di 100 micromol / L stock per tutti i primer in acqua grado molecolare e sonde a TE pH 8 tampone [Entero F1A, Entero R1, GPL813TQ 12; HF183-1, BthetR1, BthetP1 3]. Nota: Sonde per i due obiettivi sono fluorescente con diversi fluorofori 7 come indicato nella lista dei materiali / attrezzature. </li><li> Preparare master mix mescolando, per reazione prevista, 12 ml digitale mix PCR (2x magazzino, vedere elenco dei materiali / attrezzature), 0.216 ml ciascuno in avanti e di fondo, 0,06 ml ciascuna sonda fluorescente inversa, e 5.016 ml di acqua priva di nucleasi (concentrazione finale : 900 nM ogni primer, 250 nm ogni sonda). Pipettare su e giù almeno 10 volte per mescolare tenendo attenzione a non introdurre bolle d&#39;aria nella soluzione. </li><li> Pipettare 18 ml Master Mix (dal punto 1.2) in un normale tubo di PCR o piatto, mescolando in DNA stampo 6 ml (estratto come descritto Precesly 13) per rendere la miscela test per la generazione di goccioline. Se si esegue i campioni in duplicato, pipetta 36 ml di master mix e 12 stampo di DNA microlitri in tutti i pozzetti. Lasciare le corrispondenti pozzi replicati vuoto sul piatto. Includere controlli positivi (vedi elenco dei materiali / attrezzature) ei controlli NTC (NTC) (cioè con acqua di grado molecolare utilizzato come modello). Nota: Controllo positivo è necessario assicurare il test viene eseguito correttamente e il NTC è necessaria per garantire che non vi è alcuna contaminazione all&#39;interno della piastra e per impostare la linea di base fluorescente successiva analisi dei dati. Prima dell&#39;uso si consiglia di utilizzare entrambi i campioni di DNA non diluiti e diluito. </li></ol> 2. Generation Droplet e configurazione Piastra PCR <ol><li> Mescolare le miscele di analisi pipettando su verso il basso di circa 15 volte con una pipetta multicanale. Assicurarsi che la punta della pipetta rimane all&#39;interno del liquido per evitare di fare le bolle in eccesso all&#39;interno della miscela. </li><li> inscartuccia ert 1 (contenente 8 pozzetti) in un contenitore della cartuccia bianca e fare clic sul supporto della cartuccia chiusa. Cartuccia 1 è ora saldamente in posizione e non può essere staccato dal suo supporto durante la generazione di goccioline. Utilizzando una pipetta multicanale, trasferire delicatamente 20 l di miscela test in posizione centrale della cartuccia indicata &#39;campione&#39; senza introdurre bolle d&#39;aria. </li><li> Pipettare in 70 ml di olio di generazione gocciolina al lato sinistro della cartuccia (contrassegnati &#39;olio&#39;). </li><li> Cartuccia copertura con una guarnizione assicurandosi che la guarnizione sia piana e tenuto in modo uniforme dal 4 zecche verso il bordo della cartuccia. Premere il tasto verde illuminato sul generatore droplet per aprire e inserire la cartuccia. Premere il tasto verde-illuminato di nuovo per chiudere il generatore. Nota: Una volta che la porta si chiude, il pulsante non è attivo, la porta non può essere riaperta e la generazione di goccioline inizia immediatamente proseguendo per circa 1 minuto. </li><li> Se facendo più di 8 reazioni, posto cartuccia 2 in una secondaportacartuccia bianco e preparare nella stessa maniera come cartuccia 1 mentre la generazione delle goccioline è in corso di risparmiare del tempo di programmazione. </li><li> Aprire la porta generatore gocciolina quando il pulsante dim illuminato diventa verde che indica il completamento della generazione di goccioline. Rimuovere il supporto bianco cartuccia contenente la cartuccia 1, messo da parte, e la cartuccia posto 2 sul generatore di goccia. </li><li> Rimuovere la guarnizione dalla cartuccia 1 e scartare. trasferire delicatamente il volume totale (circa 40 ml) di goccioline generate dalla terza colonna della cartuccia (contrassegnata &#39;Goccioline&#39;) su una piastra PCR finale (mantenuta a temperatura ambiente) per cicli termici. Nota: Non deselezionare il supporto della cartuccia bianca come l&#39;azione potrebbe rompersi le goccioline appena generato; aperto solo il supporto della cartuccia dopo le goccioline sono stati trasferiti al piatto finale. </li><li> Ripetere i passaggi 2,1-2,7 per i campioni supplementari. </li><li> Quando tutte le goccioline sono nella piastra finale PCR, posizionare un perforabilepellicola di copertura sulla parte superiore della piastra e posizionarlo su un foglio sigillante. Impostare il sigillante a 180 ° C, premere &#39;Play&#39; sul sigillante e lasciare tenuta per 10 sec. </li></ol> 3. ciclismo termica e Reading Droplet <ol><li> Posizionare la piastra sigillata nel termociclatore, uno compatibile con la piastra PCR finale utilizzato nella fase 2.7, e una velocità di rampa di temperatura di 2,0 ° C / sec. </li><li> Eseguire programma termica come segue: 10 min a 95 ° C, seguiti da 40 cicli di 30 secondi a 94 ° C e 60 secondi a 60 ° C, seguito da 10 min stretta a 98 ° C (opzionale: stretta finale a 4 o 15 ° C). </li><li> Al termine del ciclismo, trasferire la piastra ad un lettore di goccioline per la misurazione automatica della fluorescenza in ciascuna goccia in ciascun pozzetto. In alternativa, conservare la piastra a 4 ° C per un massimo di 3 giorni prima della lettura delle gocce. Assicurarsi che le goccioline siano a temperatura ambiente prima di procedere con la lettura. <ol><li> Aprire il software che accompagna per impostare la lettura delle gocce. Inil menu di default &#39;Setup&#39; contiene uno schema di una piastra da 96 pozzetti vuoto, fare doppio clic sul pozzetto A1 per aprire il menu che contiene tre sezioni: &#39;Campione,&#39; &#39;Saggio 1&#39; e &#39;Assay 2.&#39; </li><li> Nella sezione &#39;Sample&#39; digitare l&#39;ID campione nella casella &#39;Nome&#39; e premere Invio o controllare la casella a destra segnato &#39;Apply&#39;. Quindi, fai clic sul menu a discesa con l&#39;etichetta &#39;esperimento&#39; e scegliere &#39;Red&#39; (rilevamento di un evento raro) e premere Invio. </li><li> Spostare alla sezione indicata &#39;test 1.&#39; Nella sezione &#39;Nome&#39; compilare il test (ad esempio Enterococcus) e premere Invio. Nella casella sotto l&#39;etichetta &#39;Tipo&#39; fai clic sul menu a tendina e selezionare l &#39;Channel 1 Unknown&#39; e premere Invio. </li><li> Spostare alla sezione indicata &#39;Assay 2.&#39; Nella sezione &#39;Nome&#39; compilare il test (ad esempio, HF183) e premere Invio. Nella casella sotto l&#39;etichetta &#39;Tipo&#39; fai clic sul menu a discesa unad Scegliere &#39;Channel 2 Unknown&#39; e premere Invio. Tutte le informazioni da Piazza 3.3.2 a 3.3.4 è ora presente in ben A1. </li><li> Nome tutti i pozzetti successivi contenenti goccioline. Per risparmiare tempo di installazione totale, fare clic su &#39;Shift&#39; o &#39;Ctrl&#39;, di scegliere pozzi multipli contemporaneamente. </li><li> Quando la rappresentazione digitale della piastra rispecchia la piastra fisica, premere &#39;OK&#39; in basso a destra del menu. Nel nuovo menu che appare nella parte superiore dello schema piatto, sotto la sezione &#39;Modello&#39; scegliere &#39;Salva con nome&#39; e il nome e salvare la piastra. </li><li> A sinistra dello schermo, fare clic su &#39;Esegui&#39; e selezionare appropriate Dye Set nella finestra pop-out &quot;Opzioni di esecuzione&quot;. La raccolta dei dati inizia e viene visualizzata in tempo reale nel software. </li></ol></li></ol> 4. Analisi dei dati e reporting <ol><li> Quando il lettore è finito e un dialogo che affermando &#39;corsa completa&#39;, cliccare su &#39;OK&#39;. Nota: La morbidaware visualizza il file di dati finale nella sezione &#39;Analisi&#39; del software. In questa prospettiva, il software ha tutti i pozzetti della piastra selezionati e le impostazioni predefinite per tracciare i dati del &#39;2D Amplitude&#39;. </li><li> Controllare la separazione tra le goccioline positivi e negativi. Assicurarsi che la fluorescenza in tutte le goccioline nei pozzetti NTC sono vicino al basale. </li><li> Fare clic sul pulsante &#39;Eventi&#39;. A destra dell&#39;istogramma presentato clic sulla casella denominata &#39;Total&#39; e la casella denominata &quot;single&quot; in basso per visualizzare il numero totale di gocce accettati per pozzetto. Escludere i pozzetti contenenti &lt;10.000 goccioline 7 tenendo premuto il tasto Ctrl e facendo clic sul bene (s) da escludere. </li><li> Fare clic sul pulsante indicato come &#39;1D Amplitude&#39; per impostare la soglia di fluorescenza a circa una deviazione standard (500-700 unità di fluorescenza) sopra le goccioline negativi nei pozzi NTC per entrambi gli obiettivi. Al molto a sinistra dello schermo unof the &#39;Auto Analyze&#39; che mostra due pulsanti di soglia, scegliere l&#39;icona a destra che ha una linea orizzontale di colore rosa solido che l&#39;attraversa. </li><li> Fare clic nella casella a sinistra di &#39;soglia impostata&#39; sotto ciascuno dei grafici di ampiezza e di inserire i valori di soglia di fluorescenza appropriati. Le concentrazioni target di copia per reazione microlitri vengono calcolati automaticamente. Nota: Le soglie non devono essere identiche per i diversi target. </li><li> Esportare i risultati in un file .csv facendo clic sul pulsante &#39;Export&#39; nell&#39;angolo in alto a sinistra dello schermo 1D ampiezza. Nel file .csv, moltiplicare la concentrazione target esportati da 4 per la conversione da copia del bersaglio (23S gene di Enterococcus spp. O il marcatore HF183) per reazione microlitri per copiare del target per microlitri DNA stampo. </li></ol>

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

The authors declare that they have no competing financial interests.

Ci sono alcuni passaggi critici nel protocollo. In primo luogo, la miscelazione delle miscele test può essere difficile, perché il master mix è più viscoso rispetto ai tradizionali Master Mix qPCR. Semplice vortex può portare a scarsa miscelazione, che a sua volta porta alla distribuzione non uniforme dei modelli di DNA nelle miscele di saggio e successivamente nelle goccioline. La tecnica di miscelazione-by-pipettaggio descritto nel protocollo deve essere seguita per garantire accurata quantificazione dPCR. In sec...

Metodi quantitativi PCR (qPCR) sono stati ampiamente utilizzati per il monitoraggio della qualità delle acque di ricreazione e microbiche applicazioni di tracciamento fonte perché sono più veloci, più flessibili e specifiche rispetto ai metodi di coltura a base di tradizionali. Di conseguenza, qPCR è consigliato per il raggiungimento di risultati di monitoraggio delle acque rapidi per gli indicatori fecali generali come Enterococcus spp. Nelle riviste USEPA ACQUATICI criteri di qualità 1. Molti saggi qPCR sono stati sviluppati e validati per identificare le fonti di contaminazione fecale nelle acque ambientali 2. Tra questi, i saggi marcatori HF183 sono tra le più frequentemente utilizzate per identificare la contaminazione fecale umana associata 3. Tuttavia, i risultati qPCR possono spesso essere prevenuto perché si basano su curve standard per la quantificazione. qPCR quantifica le concentrazioni sconosciute di bersaglio nei campioni interpolando il loro ciclo di quantificazione (CQ) da una stanCurva dard che descrive una relazione lineare tra Cq e quantità logaritmica di una serie di norme in serie diluiti. La mancanza di materiale di riferimento standard affidabile e coerente può quindi notevolmente BiAS risultati qPCR. Gli studi hanno dimostrato che i risultati qPCR differivano di circa mezzo di registro utilizzando standard di diversi fornitori di 4 e 2 volte con diversi lotti di standard dello stesso fornitore 5. La tecnologia digitale PCR (dPCR) quantifica un campione sconosciuto contando la frequenza di positivi in un gran numero di PCR in miniatura che vengono generati dal partizionamento di un qPCR massa in migliaia o milioni di nanolitro uniforme o reazioni picolitri 6. E &#39;indicato come gocciolina PCR digitali (cioè, questo articolo) o camera PCR digitali, rispettivamente se le partizioni sono acqua-in-olio gocce (ovvero questo articolo) o piccole camere su un chip. Una concentrazione più elevata del campione comporterà presenza di DNA bersaglio(PCR quindi positivo) in una proporzione maggiore di partizioni, una relazione approssimata dalla distribuzione di Poisson. Come tali, i risultati binari (PCR positiva o negativa) sono registrate e la frequenza delle goccioline positivi viene utilizzato per calcolare le concentrazioni dei campioni sconosciuti direttamente tramite Poisson approssimazione, eliminando la necessità di una curva standard come in qPCR. Questa natura binaria di quantificazione PCR digitale offre vantaggi supplementari rispetto qPCR 7. Poiché l&#39;amplificazione ritardato può ancora produrre un PCR positivo, dPCR quantificazione è più robusto contro l&#39;inibizione che riduce l&#39;efficienza di amplificazione. Analogamente, dPCR quantificazione non è influenzato dalla variabilità dei valori Cq come qPCR, portando ad una maggiore precisione di dPCR rispetto al qPCR 8-10. Inoltre, il processo di partizionamento assicura una piccola quantità di DNA bersaglio presente in ogni gocciolina, minimizzando efficace concorrenza substrato (durante amplification di differenti target di DNA) che sono ostacoli comuni al raggiungimento fronte-retro (cioè un saggio misura contemporaneamente due obiettivi di DNA) in qPCR. Come tale, eseguita in duplex o simplex (cioè un target viene misurato in un singolo test) dPCR produce quantificazione quasi indistinguibile di entrambi gli obiettivi 7,11. L&#39;obiettivo del test PCR digitale (EntHF183 dPCR) descritto in questo articolo è quello di ottenere una quantificazione diretta simultanea dell&#39;indicatore fecale generale Enterococcus spp. E il marcatore HF183 umano-fecale associata con una migliore precisione, la riproducibilità e la robustezza contro l&#39;inibizione rispetto al suo qPCR controparti. Questo test è stato utilizzato con successo per quantificare la contaminazione fecale in acqua dolce ambientale, acqua marina, e vario materiale fecale 7, ma può anche essere applicato a qualsiasi altro tipo di acque e acque di scarico. Questo test rappresenta una grande promessa per l&#39;analisi di sedimenti o suoli a causa di essas elevata tolleranza alla inibizione, ma ulteriori test è necessario a causa della complessità di inibitore mescola in questi tipi di campioni.

<table><tbody><tr><td>Low Bind Microtubes</td><td>Costar</td><td>3207</td><td>For storage of reagents, samples/production of master mixes</td></tr><tr><td>Nuclease Free Water</td><td>FisherSci</td><td>BP2484-50</td><td></td></tr><tr><td>TE pH 8 buffer</td><td>FisherSci</td><td>BP2473-100</td><td></td></tr><tr><td>Hardshell 96 Well Plate</td><td>BioRad</td><td>HSP-9601</td><td>For initial master mix and sample inoculation</td></tr><tr><td>Aluminum Sealing Film</td><td>BioRad</td><td>359-0133</td><td>To seal sample plate</td></tr><tr><td>Droplet Generator</td><td>BioRad</td><td>186-3002</td><td></td></tr><tr><td>Droplet Generation Oil</td><td>BioRad</td><td>186-3005</td><td></td></tr><tr><td>Cartridge</td><td>BioRad</td><td>186-4008</td><td></td></tr><tr><td>DG8 Cartridge Holder</td><td>BioRad</td><td>186-3051</td><td></td></tr><tr><td>Gasket</td><td>BioRad</td><td>186-3009</td><td></td></tr><tr><td>20 &amp;#956;l pipet tips</td><td>Rainin</td><td>GP-L10F</td><td>For tansferring sample/master mix to cartidge</td></tr><tr><td>200 &amp;#956;l pipet tips</td><td>Rainin</td><td>GP-L200F</td><td>For transferring droplets to final Twin.Tec Plate</td></tr><tr><td>Twin.Tec 96 Well Plate</td><td>Eppendorf</td><td>951020320</td><td>For final droplets thermal cycling and reading</td></tr><tr><td>Pierceable Heat Seal Foil</td><td>BioRad</td><td>181-4040</td><td>To seal Twin.Tec plate before thermalcycling</td></tr><tr><td>PX1 PCR Plate Sealer</td><td>BioRad</td><td>181-4000</td><td></td></tr><tr><td>CFX96 Thermalcycler</td><td>BioRad</td><td>CFX96 and C1000</td><td>Only the thermal cycler is needed, no optics</td></tr><tr><td>QX100 Droplet Reader</td><td>BioRad</td><td>186-3001</td><td></td></tr><tr><td>Droplet Reader Oil</td><td>BioRad</td><td>186-3004</td><td></td></tr><tr><td>Droplet PCR Supermix&amp;nbsp;</td><td>BioRad</td><td>186-3024</td><td>&lt;em&gt;i.e.&lt;/em&gt; the digital PCR mix in manuscript</td></tr><tr><td>QuantaSoft software (v1.3.2)</td><td>Quantasoft&amp;nbsp;</td><td>QX100&amp;nbsp;</td><td>For viewing, analyzing, and exporting ddPCR data</td></tr><tr><td>Entero Forward Primer (Ent F1A)</td><td>Operon</td><td>GAGAAATTCCAAACGAACTTG</td><td>Alternative vendor can be used</td></tr><tr><td>Entero Reverse Primer (Ent R1)</td><td>Operon</td><td>CAGTGCTCTACCTCCATCATT</td><td>Alternative vendor can be used</td></tr><tr><td>Entero Probe (GPL813TQ)</td><td>Operon</td><td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td><td>Alternative vendor can be used, but the florophore has to be FAM</td></tr><tr><td>HF183 Forward Primer (HF183-1)</td><td>Operon</td><td>ATCATGAGTTCACATGTCCG</td><td>Alternative vendor can be used</td></tr><tr><td>HF183 Reverse Primer (BthetR1)</td><td>Operon</td><td>CGTAGGAGTTTGGACCGTGT</td><td>Alternative vendor can be used</td></tr><tr><td>HF183 Probe (BthetP1)</td><td>Operon</td><td>[6-HEX]-CTGAGAGGAAGGTCCCCC&lt;br/&gt; ACATTGGA-[BHQ1]</td><td>Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&amp;nbsp;</td></tr><tr><td>Positive control</td><td></td><td></td><td>Mixture of &lt;em&gt;E. faecalis&lt;/em&gt; genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing &lt;em&gt;E. faecalis&lt;/em&gt; and sequences of the ordered HF183 plasmid, please see Cao &lt;em&gt;et al.&lt;/em&gt; 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available &lt;em&gt;Enterococcus&lt;/em&gt; DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared &lt;em&gt;E. faecalis&lt;/em&gt; genomic DNA.</td></tr></tbody></table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

Questo manoscritto descrive una PCR digitale duplex (EntHF183 dPCR) per la quantificazione simultanea di Enterococcus spp. E il marcatore HF183 fecale-associata umana. Il EntHF183 duplex dPCR (denominato come EntHF183 dPCR esso contenute) saggio utilizza gli stessi primer e sonda sequenze come le sue singole controparti pubblicati PCR quantitativa (qPCR). Allo stesso modo, le stesse procedure di filtrazione dell&#39;acqua e di estrazione del DNA come eseguita prima di qPCR sono seguiti prima di eseguire dPCR. Tuttavia, il test dPCR duplex ha diversi vantaggi rispetto ai saggi qPCR. Più importante, il dosaggio dPCR elimina la necessità per l&#39;esecuzione di una curva standard e, quindi, la distorsione e variabilità associata, dalla quantificazione diretta dei suoi obiettivi. Inoltre, mentre la stampa duplex (ovvero la quantificazione simultanea) Enterococcus e HF183 in qPCR spesso porta a grave sottovalutazione del target meno abbondanti in un campione, dPCR fornisce la quantificazione coerente di entrambi gli obiettivi, stuzzicarela quantificato singolarmente o contemporaneamente nella stessa reazione. Il dosaggio dPCR è anche in grado di tollerare concentrazioni di inibitori di PCR che sono uno o due ordini di grandezza superiori a quelle tollerate dal qPCR. Questi vantaggi rendono il saggio EntHF183 dPCR particolarmente interessante perché fornisce contemporaneamente informazioni precise e ripetibili sia contaminazione fecale generale e umana associati nelle acque ambientali senza la necessità di eseguire due saggi qPCR separati. Nonostante i suoi vantaggi rispetto qPCR, il limite superiore quantificazione del test dPCR con strumentazione attualmente disponibile è di circa quattro ordini di grandezza inferiore a quella ottenibile con qPCR. Di conseguenza, la diluizione è necessaria per la misura di concentrazioni elevate di organismi bersaglio come quelli tipicamente osservati dopo fuoriuscite di liquami.

Una buona corsa EntHF183 duplex dPCR dovrebbe risultare in numero relativamente elevato di goccioline accettati (circa 10,000-17,000) e differenza relativamente grande (circa 5.000) tra i valori di fluorescenza per le goccioline negativi e positivi 7. Insolitamente basso numero di goccioline probabilmente indica problemi nel processo di generazione delle gocce, e un taglio di 10.000 goccioline è suggerito basato su dati empirici dal sistema dPCR gocciolina u...

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Questo manoscritto descrive un saggio PCR duplex digitale che può essere utilizzato per quantificare contemporaneamente Enterococcus spp. E marcatori genetici HF183 come indicatori di contaminazione fecale generale e umana associati nelle acque ricreative.

Un Test PCR duplex digitale per simultanea quantificazione del<em&gt; Enterococcus spp.</em&gt; E l&#39;umano fecale associata HF183 Marker in Waters

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

a-duplex-digital-pcr-assay-for-simultaneous-quantification

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

9.8K Views.  Southern California Costal Water Research Project Authority.  Questo manoscritto descrive un saggio PCR duplex digitale che può essere utilizzato per quantificare contemporaneamente Enterococcus spp. E marcatori genetici HF183 come indicatori di contaminazione fecale generale e umana associati nelle acque ricreative. 

Video: A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR

EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. This method was developed with the goal of having a standardized method for use in multiple analytical laboratories during monitoring period 3 of the Unregulated Contaminant Monitoring Rule. Herein we present the protocol for extraction of viral ribonucleic acid (RNA) from water sample concentrates and for quantitatively measuring enterovirus and norovirus concentrations using reverse transcription-quantitative PCR (RT-qPCR). Virus concentrations for the molecular assay are calculated in terms of genomic copies of viral RNA per liter based upon a standard curve. The method uses a number of quality controls to increase data quality and to reduce interlaboratory and intralaboratory variation. The method has been evaluated by examining virus recovery from ground and reagent grade waters seeded with poliovirus type 3 and murine norovirus as a surrogate for human noroviruses. Mean poliovirus recoveries were 20% in groundwaters and 44% in reagent grade water. Mean murine norovirus recoveries with the RT-qPCR assay were 30% in groundwaters and 4% in reagent grade water.

Here we present a procedure to quantify enterovirus and norovirus in environmental and drinking waters using reverse transcription-quantitative PCR. Mean virus recovery from groundwater with this standardized procedure from EPA Method 1615 was 20% for poliovirus and 30% for murine norovirus.

Metodo EPA 1615. Misura di Enterovirus e Norovirus Presenza in Water di Cultura e RT-qPCR. Parte III. Rilevamento virus mediante RT-qPCR

EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. This method was developed with the goal of having a ...

Ricerca

Ambiente

Cost-effective Method for Microbial Source Tracking Using Specific Human and Animal Viruses

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant limitations, viruses are more resistant to many inactivation processes and standard fecal indicators do not inform on the source of contamination. The development of cost-effective methods for the concentration of viruses from water and molecular assays facilitates the applicability of viruses as indicators of fecal contamination and as microbial source tracking (MST) tools. Adenoviruses and polyomaviruses are DNA viruses infecting specific vertebrate species including humans and are persistently excreted in feces and/or urine in all geographical areas studied. In previous studies, we suggested the quantification of human adenoviruses (HAdV) and JC polyomaviruses (JCPyV) by quantitative PCR (qPCR) as an index of human fecal contamination. Recently, we have developed qPCR assays for the specific quantification of porcine adenoviruses (PAdV) and bovine polyomaviruses (BPyV) as animal fecal markers of contamination with sensitivities of 1-10 genome copies per test tube. In this study, we present the procedure to be followed to identify the source of contamination in water samples using these tools. As example of representative results, analysis of viruses in ground water presenting high levels of nitrates is shown.
Detection of viruses in low or moderately polluted waters requires the concentration of the viruses from at least several liters of water into a much smaller volume, a procedure that usually includes two concentration steps in series. This somewhat cumbersome procedure and the variability observed in viral recoveries significantly hamper the simultaneous processing of a large number of water samples.
In order to eliminate the bottleneck caused by the two-step procedures we have applied a one-step protocol developed in previous studies and applicable to a diversity of water matrices. The procedure includes: acidification of ten-liter water samples, flocculation by skimmed milk, gravity sedimentation of the flocculated materials, collection of the precipitate and centrifugation, resuspension of the precipitate in 10 ml phosphate buffer. The viral concentrate is used for the extraction of viral nucleic acids and the specific adenoviruses and polyomaviruses of interest are quantified by qPCR. High number of samples may be simultaneously analyzed using this low-cost concentration method.
The procedure has been applied to the analysis of bathing waters, seawater and river water and in this study, we present results analyzing groundwater samples. This high-throughput quantitative method is reliable, straightforward, and cost-effective.

The study describes a cost-effective method for the identification of the source of fecal/urine contamination or contamination by nitrates in water using qPCR for the specific quantification of human/porcine/bovine DNA viruses, adenoviruses and polyomaviruses, proposed as MST tools.

Costo-efficace metodo per il rilevamento di origine microbica Utilizzando specifici virus umani e animali

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant ...

Immunologia e infezioni

Multiplex Detection of Bacteria in Complex Clinical and Environmental Samples using Oligonucleotide-coupled Fluorescent Microspheres

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated to a microbiota dominated by a number of bacterial species, including Gardnerella vaginalis, Atopobium vaginae, and others1-3. This condition is associated with a range of negative health outcomes, including HIV acquisition4, and it can be difficult to manage clinically5. Furthermore, diagnosis of BV has relied on the use of Gram stains of vaginal swab smears that are scored on various numerical criteria6,7. While this diagnostic is simple, inexpensive, and well suited to resource-limited settings, it can suffer from problems related to subjective interpretations and it does not give a detailed profile of the composition of the vaginal microbiota8. Recent deep sequencing efforts have revealed a rich, diverse vaginal microbiota with clear differences between samples taken from individuals that are diagnosed with BV compared to those individuals that are considered normal9,10, which has resulted in the identification of a number of potential targets for molecular diagnosis of BV11,12. These studies have provided a wealth of useful information, but deep sequencing is not yet practical as a diagnostic method in a clinical setting. We have recently described a method for rapidly profiling the vaginal microbiota in a multiplex format using oligonucleotide-coupled fluorescent beads with detection on a Luminex platform13. This method, like current Gram stain-based methods, is rapid and simple but adds the additional advantage of exploiting molecular knowledge arising from sequencing studies in probe design. This method therefore provides a way to profile the major microorganisms that are present in a vaginal swab that can be used to diagnose BV with high specificity and sensitivity compared to Gram stain while providing additional information on species presence and abundance in a semi-quantitative and rapid manner. This multiplex method is expandable well beyond the range of current quantitative PCR assays for particular organisms, which is currently limited to 5 or 6 different assays in a single sample14. Importantly, the method is not limited to the detection of bacteria in vaginal swabs and can be easily adapted to rapidly profile nearly any microbial community of interest. For example, we have recently begun to apply this methodology to the development of diagnostic tools for use in wastewater treatment plants.

We describe a multiplex method for the detection of microorganisms within a sample using oligonucleotide-coupled fluorescent beads. Amplicon from all organisms within a sample is hybridized to a panel of probe-coupled beads. A Luminex or Bio-Plex instrument is used to query each bead for bead type and hybridization signal.

Rilevazione multiplex di batteri in campioni clinici complessi ed Ambientali con oligonucleotidi accoppiati microsfere fluorescenti

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated ...

A Modified EPA Method 1623 that Uses Tangential Flow Hollow-fiber Ultrafiltration and Heat Dissociation Steps to Detect Waterborne Cryptosporidium and Giardia spp.

Cryptosporidium and Giardia species are two of the most prevalent protozoa that cause waterborne diarrheal disease outbreaks worldwide. To better characterize the prevalence of these pathogens, EPA Method 1623 was developed and used to monitor levels of these organisms in US drinking water supplies 12. The method has three main parts; the first is the sample concentration in which at least 10 L of raw surface water is filtered. The organisms and trapped debris are then eluted from the filter and centrifuged to further concentrate the sample. The second part of the method uses an immunomagnetic separation procedure where the concentrated water sample is applied to immunomagnetic beads that specifically bind to the Cryptosporidium oocysts and Giardia cysts allowing for specific removal of the parasites from the concentrated debris. These (oo)cysts are then detached from the magnetic beads by an acid dissociation procedure. The final part of the method is the immunofluorescence staining and enumeration where (oo)cysts are applied to a slide, stained, and enumerated by microscopy.
Method 1623 has four listed sample concentration systems to capture Cryptosporidium oocysts and Giardia cysts in water: Envirochek filters (Pall Corporation, Ann Arbor, MI), Envirochek HV filters (Pall Corporation), Filta-Max filters (IDEXX, Westbrook, MA), or Continuous Flow Centrifugation (Haemonetics, Braintree, MA). However, Cryptosporidium and Giardia (oo)cyst recoveries have varied greatly depending on the source water matrix and filters used1,14. A new tangential flow hollow-fiber ultrafiltration (HFUF) system has recently been shown to be more efficient and more robust at recovering Cryptosporidium oocysts and Giardia cysts from various water matrices; moreover, it is less expensive than other capsule filter options and can concentrate multiple pathogens simultaneously1-3,5-8,10,11. In addition, previous studies by Hill and colleagues demonstrated that the HFUF significantly improved Cryptosporidium oocysts recoveries when directly compared with the Envirochek HV filters4. Additional modifications to the current methods have also been reported to improve method performance. Replacing the acid dissociation procedure with heat dissociation was shown to be more effective at separating Cryptosporidium from the magnetic beads in some matrices9,13 .
This protocol describes a modified Method 1623 that uses the new HFUF filtration system with the heat dissociation step. The use of HFUF with this modified Method is a less expensive alternative to current EPA Method 1623 filtration options and provides more flexibility by allowing the concentration of multiple organisms.

A Modified EPA Method 1623 that Uses Tangential Flow Hollow-fiber Ultrafiltration and Heat Dissociation Steps to Detect Waterborne Cryptosporidium and Giardia spp.

This protocol describes the use of a tangential flow hollow-fiber ultrafiltration sample concentration system and a heat dissociation as alternative steps for the detection of waterborne Cryptosporidium and Giardia species using EPA Method 1623.

Un metodo modificato EPA 1623 che utilizza flusso tangenziale a fibre cave di ultrafiltrazione e di calore passi dissociazione per rilevare Waterborne<em&gt; Cryptosporidium</em&gt; E<em&gt; Giardia spp.</em

Cryptosporidium and Giardia species are two of the most prevalent protozoa that cause waterborne diarrheal disease outbreaks worldwide. To better ...

Capture of Environmental DNA (eDNA) from Water Samples by Flocculation

The analysis of environmental DNA (eDNA) has become a widely used approach to problem solving in species management. The detection of cryptic species including invasive and (or) species at risk is the goal, typically accomplished by testing water and sediment for the presence of characteristic DNA signatures. Reliable and efficient procedures for the capture of eDNA are required, especially those that can be performed easily in the field by personnel with limited training and citizen scientists. The capture of eDNA using membrane filtration is widely used currently. This approach has inherent issues that include the choice of filter material and porosity, filter fouling, and time required on site for the process to be performed. Flocculation offers an alternative that can be easily implemented and applied to sampling regimes that strive to cover broad territories in limited time.

<meta charset="utf8"></head><body>Acquisizione di DNA ambientale eDNA da campioni d'acqua mediante flocculazione

Environmental DNA (eDNA) is typically captured from water samples using alcohol precipitation, filtration, or flocculation. Presented here is an alternative protocol that uses lanthanum chloride to enable collection of dissolved and particulate-bound nucleic acids from water samples containing eukaryotic cells, prokaryotic cells, and virus.

Acquisizione del DNA ambientale (eDNA) da campioni d'acqua mediante flocculazione

The analysis of environmental DNA (eDNA) has become a widely used approach to problem solving in species management. The detection of cryptic species ...

Development and Testing of Species-specific Quantitative PCR Assays for Environmental DNA Applications

New, non-invasive methods for detecting and monitoring species presence are being developed to aid in fisheries and wildlife conservation management. The use of environmental DNA (eDNA) samples for detecting macrobiota is one such group of methods that is rapidly becoming popular and being implemented in national management programs. Here we focus on the development of species-specific targeted assays for probe-based quantitative PCR (qPCR) applications. Using probe-based qPCR offers greater specificity than is possible with primers alone. Furthermore, the ability to quantify the amount of DNA in a sample can be useful in our understanding of the ecology of eDNA and the interpretation of eDNA detection patterns in the field. Careful consideration is needed in the development and testing of these assays to ensure the sensitivity and specificity of detecting the target species from an environmental sample. In this protocol we will delineate the steps needed to design and test probe-based assays for the detection of a target species; including creation of sequence databases, assay design, assay selection and optimization, testing assay performance, and field validation. Following these steps will help achieve an efficient, sensitive, and specific assay that can be used with confidence. We demonstrate this process with our assay designed for populations of the mucket (Actinonaias ligamentina), a freshwater mussel species found in the Clinch River, USA.

Environmental DNA assays require rigorous design, testing, optimization and validation before the collection of field data can begin. Here, we present a protocol to take users through each step of designing a species-specific, probe-based qPCR assay for the detection and quantification of a target species DNA from environmental samples.

Sviluppo e test di test quantitativi PCR specifici per specie per applicazioni del DNA ambientale

New, non-invasive methods for detecting and monitoring species presence are being developed to aid in fisheries and wildlife conservation management. The ...

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

Enterohemorrhagic Escherichia coli O157:H7 has been linked to both waterborne and foodborne illnesses, and remains a threat despite the food- and water-screening methods used currently. While conventional bacterial detection methods, such as polymerase chain reaction (PCR) and enzyme-linked immunosorbent assays (ELISA) can specifically detect pathogenic contaminants, they require extensive sample preparation and lengthy waiting periods. In addition, these practices demand sophisticated laboratory instruments and settings, and must be executed by trained professionals. Herein, a protocol is proposed for a simpler diagnostic technique that features the unique combination of magnetic and fluorescent parameters in a nanoparticle-based platform. The proposed multiparametric magneto-fluorescent nanosensors (MFnS) can detect E. coli O157:H7 contamination with as little as 1 colony-forming unit present in solution within less than 1 h. Furthermore, the ability of MFnS to remain highly functional in complex media such as milk and lake water has been verified. Additional specificity assays were also used to demonstrate the ability of MFnS to only detect the specific target bacteria, even in the presence of similar bacterial species. The pairing of magnetic and fluorescent modalities allows for the detection and quantification of pathogen contamination in a wide range of concentrations, exhibiting its high performance in both early- and late-stage contamination detection. The effectiveness, affordability, and portability of the MFnS make them an ideal candidate for point-of-care screening for bacterial contaminants in a wide range of settings, from aquatic reservoirs to commercially packaged foods.

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

The overall goal of this protocol is to synthesize functional nanosensors for the portable, cost-effective, and rapid detection of specifically targeted pathogenic bacteria through a combination of magnetic relaxation and fluorescence emission modalities.

Agenti patogeni di origine alimentare Screening utilizzando Magneto-fluorescente nanosensore: Rilevazione rapida di e. Coli O157: H7

Enterohemorrhagic Escherichia coli O157:H7 has been linked to both waterborne and foodborne illnesses, and remains a threat despite the food- and ...

Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

Polymerase chain reaction (PCR) is a traditional method employed for the amplification of a target gene that has played an important role in biomolecular diagnostics. However, traditional PCR is very time-consuming because of the low-temperature variation efficiency. This work proposes a continuous-flow-PCR (CF-PCR) system based on a microfluidic chip. The amplification time can be greatly reduced by running the PCR solution into a microchannel placed on heaters set at different temperatures. Moreover, as capillary electrophoresis (CE) is an ideal way to differentiate positive and false-positive PCR products, a CE system was built to achieve efficient separation of the DNA fragments. This paper describes the process of amplification of Escherichia coli (E. coli) by the CF-PCR system built in-house and the detection of the PCR products by CE. The results demonstrate that the target gene of E. coli was successfully amplified within 10 min, indicating that these two systems can be used for the rapid amplification and detection of nucleic acids.

Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

This protocol describes how to build a continuous-flow-polymerase chain system based on a microfluidic chip and how to build a capillary electrophoresis system in the lab. It presents a simple method for the analysis of nucleic acids in the lab.

Amplificazione di Escherichia coli in un chip microfluidico PCR a flusso continuo e sua rilevazione con un sistema di elettroforesi capillare

Polymerase chain reaction (PCR) is a traditional method employed for the amplification of a target gene that has played an important role in biomolecular ...

Bioingegneria

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A qPCR assay was developed for detection of Escherichia coli O157:H7 targeting a unique genetic marker, Z3276. The qPCR was combined with propidium monoazide (PMA) treatment for live cell detection. This protocol has been modified and adapted to a 96-well plate format for easy and consistent handling of numerous samples

Rilevamento dal vivo<em&gt; Escherichia coli</em&gt; O157: H7 Celle di PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

Un Test PCR duplex digitale per simultanea quantificazione del

Riepilogo

Esplora Altri Video

Capitoli in questo video

Metodo EPA 1615. Misura di Enterovirus e Norovirus Presenza in Water di Cultura e RT-qPCR. Parte III. Rilevamento virus mediante RT-qPCR

Costo-efficace metodo per il rilevamento di origine microbica Utilizzando specifici virus umani e animali

Rilevazione multiplex di batteri in campioni clinici complessi ed Ambientali con oligonucleotidi accoppiati microsfere fluorescenti

Un metodo modificato EPA 1623 che utilizza flusso tangenziale a fibre cave di ultrafiltrazione e di calore passi dissociazione per rilevare Waterborne

Acquisizione del DNA ambientale (eDNA) da campioni d'acqua mediante flocculazione

Acquisizione del DNA ambientale (eDNA) da campioni d'acqua mediante flocculazione

Sviluppo e test di test quantitativi PCR specifici per specie per applicazioni del DNA ambientale

Agenti patogeni di origine alimentare Screening utilizzando Magneto-fluorescente nanosensore: Rilevazione rapida di e. Coli O157: H7

Amplificazione di Escherichia coli in un chip microfluidico PCR a flusso continuo e sua rilevazione con un sistema di elettroforesi capillare

Rilevamento dal vivo