도덕적 지원을위한 아름다운 젤과 토비아스 크라우스 울라 Kobalz에 계속 지원을위한 Janett Birkenfeld에 현장에서 열정적 인 시료 채취에 대한 실케 키퍼, 사라 키퍼, 마이클 와이즈, 코니 BARTSCH 및 실케 보이트 - Heucke에 많은 감사.

모든 절차는 동물 보호 (TierSchG)에 대한 독일의 법률을 준수 하였다. 시약 및 소모품의 1. 준비 <ol><li> 분자 수준의 물에 5 % (w / w) Chelex-100 솔루션을 준비합니다. 표준 1.5 ml의 반응 튜브에 200 ㎕의 분취 량을 준비합니다. Chelex 수지 현탁액으로부터 빠른 침전이 그것의 분취 량을 준비하는 동안 계속해서 다시 균질화 정지 할 필요가있다. 그것은 하나의 일괄 처리로 50 ㎖ 이상을 준비하고 자기 교반기를 사용하여 균질 현탁액을 유지하는 것이 바람직합니다. Chelex 용액은 주위 조건에서 수년 동안 저장 될 수있다. </li><li> 테스트 할 수있는 새의 부리 폭보다 작은 폭 와트 만의 종이 조각을 잘라. 용지의 길이는 샘플을 채취하는 방법에 따라 다릅니다 : <ol><li> 집게를 사용하여 조각은 새의 부리에 삽입되는 집게​​없이 샘플 수집을 가능하게 충분히 길어야한다. 로대략적인 견적은 0.5 cm의 부리 길이 1cm의 길이와 종이가 잘해야한다. </li><li> 집게를 사용하지 않는 경우, 매 이상이어야하지만 매의 강성은 여전히​​ 상피 세포의 샘플링을 허용한다. </li></ol></li><li> 분석 할 수있는 각각의 샘플에 대해 PCR 프리믹스 중 하나 나누어지는을 준비합니다. μL (25)의 총 부피에서 PCR을 위해 믹스 0.18 밀리미터의 dNTPs, 2 mM의 MgCl2를, 70 mM 트리스 - 염산, 17.25 mM의 황산 암모늄, 0.1 % 트윈 -20, 0.32 μM의 P2 프라이머 (TCTGCATCGCTAAATCCTTT), 0.32 μM의 P8을 포함 프라이머 (CTCCCAAGGATGAGRAAYTG) (16)와 2 기의 DNA 형성 촉매 효소. 집에서 만든 DNA 형성 촉매 효소 (17)는 사용할 수 있습니다. DNA-솔루션의 최대 금액의 추가를 허용하려면 6 μL 프리믹스는 몇 주 동안 준비하고 -20 ° C에 저장할 수 있습니다. </li></ol> 2. 시료 채취 장갑을 착용하는 것은 PCR 프라이머는 인간의 DNA에 어닐링 할 수 없기 때문에 조류의 성별 결정에 필수적인 것은 아니다. 에다른 유전자형의 목적은 권할 수 있습니다. <ol><li> 그 새를 캡처하고 부드럽게 &#39;벨소리의 그립&#39;(18)와 한 손 예에 고정. 새를 짜내하지 않도록하십시오. </li><li> 집게로 왓트 만 종이 조각을 잡고 뺨, 혀와 choana의 내부를 가로 질러 여러 번 슬쩍. 보통 샘플은 30 초 미만 내에​​서 얻어진다. <ol><li> 성인 동물 : 종류에 따라 그것의 부리를 열고 새를 얻을 어려울 수 있습니다. 보통 부리의면을 만지지 부드러운 압력을 적용하여 작동합니다. </li><li> 는 nestlings : 새끼 나는 nestlings에서 샘플링하는 것은 자신의 구걸 행위가 부리의 내부에 쉽게 액세스를 제공,이 기술을 사용하여 특히 쉽습니다. 자신의 nestbox가 열릴 때 쉽게 예를 구걸로도, 전혀 취급하지 않고 샘플을 얻을 수있을 수 있습니다. </li></ol></li><li> 즉시 준비된 반응 관 contai에서 용지를 저장할5 %의 닝 200 μL (W / W) Chelex-100 솔루션입니다. </li></ol> 당신은 또한 /하려는 경우 6 장에서 설명한대로 지금 바로, 병아리를 표시해야합니다. DNA 추출하기 전에 샘플 3. 저장 <ol><li> -20 ° C에서 실험실에서 작업하는 경우, 저장 샘플 이 주위 온도에서 저장 샘플 수 또는 (현장에서 예) 어려운되지 않습니다. </li><li> 샘플은 실내 온도에서 -20 ℃까지의 온도 범위에서 3 년 이상 저장 될 수있다 </li></ol> 4. DNA 추출 <ol><li> 시료가 동결되면, 상온 해동. </li><li> 종이 조각이 Chelex-100 용액에 잠긴 튜브의 바닥에 있는지 확인합니다. </li><li> 56 ℃에서 15 분 동안 샘플을 품어 </li><li> 소용돌이 짧게 튜브의 내용을 스핀 다운. </li><li> 100 ℃에서 8 분의 샘플을 품어 </li><li> 3 분 동안 15,000 XG에서 샘플을 스핀. </li><li> 의를 사용하여이후의 유전자형에 upernatant. </li></ol> 5. 분자 성 결정 <ol><li> 샘플 당 6 μL 프리믹스 플러스 마이너스 (필수)과 양성 대조군 (옵션)에 대한 두 개의 추가 튜브 하나 PCR 튜브를 준비합니다. 일상적인 성 결정에 대한 긍정적 인 컨트롤과 마지막으로 성공한 sexing의 샘플이 (가) 있습니다. </li><li> PCR 프리믹스로 DNA 추출에서 상층의 19 μl를 추가합니다. Chelex 비즈의 이월을 방지하기 위해 용액의 표면에서 피펫해야합니다. Chelex는 양이온 교환 체이며, 따라서 심각 모든 효소 반응을 억제로서 이것은 중요하다. </li><li> 3 분, 72 °에서 45 초 신장 단계에서 다음 55 ° C에서 30 초 어닐링 단계, 다음에 30 초 용융 단계 94 ° C, 45 회 각각 94 ° C에서 배양 다음 PCR 프로그램을 실행 C. 최종 추적 오프 단계에서, 반응은 72 ℃에서 5 분 동안 배양 </li><li> 2 %의 기준 TBE 또는 TAE의 agaro 준비<html> PCR 제품을 분리하는 자체 젤. </li><li> 적절한 전압 설정을 사용하여 아가 로스 젤을 실행합니다. </li><li> UV 빛의 밑에 밴드를 시각화하고 사진 촬영을합니다. 여성에서 발생하는 샘플의 두 밴드가 잘 분리되어 있는지 확인하십시오. </li><li> 하나 (남성) 또는 2 개 (여성) 밴드의 존재에 의해 여성의 샘플에서 남성을 구분합니다. </li></ol> 6.는 nestlings 마킹 <ol><li> 종 / 연구를위한 일정 적절한에 부화 된 병아리에 둥지를 확인 (대부분의 병아리가 부화 다음과 같이 아침에 예를 들어 매일 검사가 권장됩니다.) </li><li> 다른 특성 위치에 둥지 내의 각 여자의 아래로 깃털을 잘라. 얼룩말 핀치에서 다운의 술은 새 새끼의 몸 (그림 4A)에 걸쳐 네 개의 특성과 별개의 지역에서 성장. 각 병아리를 들어 하나의 영역 (그림 4B)를 잘라. 한 둥지 사이 개 이상의 병아리가 있다면, 고유 한 넷 &#39;이발&#39;는 결합 될 수있다. </li></ol>얼룩말 핀치에 대한&gt; &quot;ove_content : 아래로 깃털을 감지하고 새끼의 크기가 울리는 허용 어려워 때 부화 포스트 십일에 다리 밴드를 적용합니다.

<ol>
	<li>Russell, W. M. S., Burch, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+principles+of+humane+experimental+technique.">The principles of humane experimental technique.</a> , (1959).</li><li>Robertson, B. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+sexing+of+individual+kakapo,+Strigops+habroptilus+Aves,+from+feces.">Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces.</a> Mol. Ecol. 8, 1349-1350 (1999).</li><li>Yannic, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Description+of+microsatellite+markers+and+genotyping+performances+using+feathers+and+buccal+swabs+for+the+Ivory+gull+(Pagophila+eburnea).">Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea).</a> Mol. Ecol. Resour. 11, 877-889 (2011).</li><li>Bello, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+feathers.">Isolation of genomic DNA from feathers.</a> J. Vet. Diagn. Invest. 13, 162-164 (2001).</li><li>Handel, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+buccal+swabs+for+sampling+DNA+from+nestling+and+adult+birds.">Use of buccal swabs for sampling DNA from nestling and adult birds.</a> Wildl. Soc. Bull. 34, 1094-1100 (2006).</li><li>Brubaker, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+noninvasive,+direct+real-time+PCR+method+for+sex+determination+in+multiple+avian+species.">A noninvasive, direct real-time PCR method for sex determination in multiple avian species.</a> Mol. Ecol. Resour. 11, 415-417 (2011).</li><li>Arima, H., Ohnishi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Usefulness+of+avian+buccal+cells+for+molecular+sexing.">Usefulness of avian buccal cells for molecular sexing.</a> Ornithological Science. 5, 139-143 (2006).</li><li>Seki, S. -. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+sexing+of+individual+Ryukyu+Robins+Erithacus+komadori+using+buccal+cells+as+a+non-invasive+source+of+DNA.">Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA.</a> Ornithological Science. 2, 135-137 (2003).</li><li>Wellbrock, A. H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Buccal+swabs+as+a+reliable+source+of+DNA+for+sexing+young+and+adult+Common+Swifts+(Apus+apus).">Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus).</a> J. Ornithol. 153, 991-994 (2012).</li><li>Marion, W. R., Shamis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Annotated-Bibliography+of+Bird+Marking+Techniques.">Annotated-Bibliography of Bird Marking Techniques.</a> Bird Banding. 48, 42-61 (1977).</li><li>Scharff, C., Adam, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurogenetics+of+birdsong.">Neurogenetics of birdsong.</a> Curr. Opin. Neurobiol. , (2012).</li><li>Griffith, S. C., Buchanan, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Zebra+Finch:+the+ultimate+Australian+supermodel.">The Zebra Finch: the ultimate Australian supermodel.</a> Emu. 110, 5-12 (2010).</li><li>Fee, M. S., Scharff, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+songbird+as+a+model+for+the+generation+and+learning+of+complex+sequential+behaviors.">The songbird as a model for the generation and learning of complex sequential behaviors.</a> Ilar J. 51, 362-377 (2010).</li><li>Honarmand, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stressful+dieting:+nutritional+conditions+but+not+compensatory+growth+elevate+corticosterone+levels+in+zebra+finch+nestlings+and+fledglings.">Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings.</a> PLoS On. 5, (1371).</li><li>Krause, E. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebra+finch+nestlings+beg+more+under+better+nutritional+conditions.">Zebra finch nestlings beg more under better nutritional conditions.</a> Behaviour. 148, 1239-1255 (2011).</li><li>Griffiths, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+DNA+test+to+sex+most+birds.">A DNA test to sex most birds.</a> Mol. Ecol. 7, 1071-1075 (1998).</li><li>Pluthero, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+purification+of+high-activity+Taq+DNA+polymerase.">Rapid purification of high-activity Taq DNA polymerase.</a> Nucleic Acids Res. 21, 4850-4851 (1993).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Joint+Working+Group+on+Refinement.+Laboratory+birds:+refinements+in+husbandry+and+procedures.+Fifth+report+of+BVAAWF/FRAME/RSPCA/UFAW+Joint+Working+Group+on+Refinement.">Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement.</a> Lab Anim. 35, 1-163 (2001).</li></ol>

저자가 공개하는 게 없다.

Chelex를 이용한 구강 면봉 Sexing는 매우 높은 성공률을 나타내었다. 다리 밴딩이 가능해질 때까지 절단 해츨링의 다운 깃털는 nestlings 사이에 차별화를 가능하게했다. 구강 면봉 Chelex-DNA 추출이 성공적 분자 sexing을 수행하기에 충분한 DNA를 얻었다. 성별 결정은 성적으로 동종 이형의 깃털에 의해 확인으로 100 % 정확했다. 여기에보고 성공률이 이전의 연구에서보고 된 7,9</sup...

개별 인식, sexing과 유전자형이 실험 연구의 다양한 기본 전제 조건이다. DNA 베어링 재료를 얻기 및 (심지어 어린 나이에) 명확하게 주제를 표시하는 생리, 행동, 그리고 생존에 미치는 영향을 최소화해야한다. 가능하면, 침략적인 절차는 RRR 원칙 1에 따라 피해야한다. 비 침습적 인 방법뿐만 아니라 동물에 대한 도움이됩니다뿐만 아니라 동물이 적은 치료에 의해 영향으로 얻어진 데이터를 향상시킬 수 있습니다. 조류, DNA의 sexing는 배설물이, 깃털 3,4 또는 구강 면봉 3,5,9와 같은 비 침습적으로 얻을 수있는 재료의 수에 수행 할 수 있습니다. 그들이 수행 쉽기 때문에 상관없이 피사체의 상태와 연령 구강 면봉의 조류 sexing에 대한 선택의 방법은 거의 실패하지 않습니다 및 취급이 짧고,,입니다. 구강 면봉 지금까지 DNA시판 키트 3,6 또는 시간 표준 DNA 추출 프로토콜 3,6-8 소모로 추출 하였다. 장비뿐만 아니라 오히려 비싸지 만, 자신의 프로토콜은 현장 작업을위한 과제를 부과 할 수 있습니다. 일부 세부 절차, 예를 들면 건조 및 샘플의 배양은, 현장에서 실제 없습니다. 특히 실험 프로토콜이 이미 몇 분 후 부화로에서 섹스 의존 치료를 필요로 설정의 결과를 얻을 수있는, 빠르고 비 침습적, 믿을 수있는 쉬운 방법을 촉구있다. 조류 분류군에 걸쳐 표시 개인을위한 많은 도구 상자 (10)를 개발하고있다. 사용 가능한 기술의 광범위한 연구의 목적, 종류 및 예산의 다양한 차지한다. 그러나, 작은는 nestlings를 표시하는 추가 과제와 연구자를 직면하고있다. 어떤 종에서 (예를 들면 passerines) 병아리 다리 밴드를 적용하기에 너무 작고 다른 방법을 필요로하는부모 - 자식의 동작을 변경하지 않습니다. 인식과 동물 복지 현장 및 실험실 연구에서 기술 향상에 대한 관심이 증가함에 따라, 비 침습 기술의 사용을 강력하게 권장하고 바람직하다. 이 프로토콜은 개별적으로 다리 밴드를 적용하기 전에 아주 어린는 nestlings를 표시하는 비 침습, 빠르고, 쉽게 인식하고 지속적인 방법을 제공하는 것은 가능하다. 이 표시 방법은 가장 중요한 조류 실험실 모델 종 중 하나, 얼룩말 핀치 (Taeniopygia의 guttata) 11 ~ 13에 도입된다. 이 프로토콜은 개별 마킹 기술 10 이전에 게시 된 모든 목적을 준수하며 이미 성공적으로 14, 15을 적용하고있다.

<table border="0" cellpadding="0" cellspacing="0" width="702">
	<tbody>
		<tr height="75">
			<td height="75" style="height:75px;width:191px;">Whatman 3MM Chromatography paper</td>
			<td style="width:163px;">e.g. Fisher Scientific</td>
			<td style="width:269px;">No.:3030-153</td>
			<td style="width:80px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:191px;">Chelex 100 Resin</td>
			<td style="width:163px;">Biorad</td>
			<td style="width:269px;">#143-2832</td>
			<td></td>
		</tr>
		<tr height="50">
			<td height="50" style="height:50px;width:191px;">Taq polymerase</td>
			<td style="width:163px;">addgene</td>
			<td style="width:269px;">http://www.addgene.org/25712/</td>
			<td></td>
		</tr>
		<tr height="75">
			<td height="75" style="height:75px;width:191px;">leg band (Flexi number rings for birds, diameter 2,5 mm)</td>
			<td style="width:163px;">Horst Stengel &#38; Sohn</td>
			<td style="width:269px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

who is who? non-invasive methods to individually sex and mark altricial chicks

대부분의 실험은 초기 자손의 성별을 결정뿐만 아니라 초기에 개별 인정 신생아의 표시를 필요로합니다. 적용 할 때마다 동물 복지 가이드 라인에 따르면, 비 침습 기술을 선호한다. 우리 그룹에서, 우리는 실험실과 현장에서 노래 조류의 종에서 작동하고, 우리는 성공적으로 섹스에 비 침습적 인 방법을 적용하고 개별적으로 병아리를 표시합니다. 이 문서는 포괄적 인 비 침습 도구 상자를 제공합니다. 새를 Sexing하기 전에 보조 성적 특성의 발현을 PCR을위한 DNA 함유 물질의 수집이 필요합니다. 우리는 구강 면봉의 DNA를 추출하여 모든 연령 (포스트 부화)의 성 조류에 빠르고 쉬운 방법을 설립했다. 결과, 3 시간 내에 얻을 수있다. 개별 표시 병아리의 다운 깃털이 부화 순서 내에서 빠른 식별을 허용하는 특정 패턴으로 트리밍됩니다하십시오. 방법의이 세트는 표준 장비 실험실에서 쉽게 적용 가능하며 일하고에 특히 적합특별한 장비와 같은 분야에서 G는 샘플링과 저장을 위해 필요합니다. 병아리의 취급을 최소화하고 표시 및 sexing 기술함으로써 동물 복지 가이드 라인의 RRR 원리를 지원하는 비 침습된다.

<html> 협측 면봉 작은 조류의 다양한 성 결정을위한 DNA를 얻기 위해 사용될 수있다 , 카나리아 (Serinus 카나리아), 벵골 피리새 류 (Lonchura의 선조체), 나이팅게일 (Luscinia의 megarhynchos), 박새 (Parus 주요)와 찌르레기 (Turdus - 샘플은 얼룩말 피리새 류 (5 년 Taeniopygia의 guttata, 99 개인, 0 세 일간)에서 수집 된 merula) (다른 종 : 샘플 크기 1-3, 나...

Watch this Scientific Journal Video about Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks at JoVE.com

Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks

이 프로토콜은 매우 빠르고, 쉽고, 비 침습, 신뢰성과 저비용 수 방법의 편리한 세트, 조류의 분자 성 결정과 자신의 비 침습, 빠르고, 안전하고 쉽게 알아볼 곧 부화 후 마킹을 제공합니다. 병아리의 제한된 처리가 필요합니다. 방법이 편리한 도구는 RRR-지침을 완전히 준수합니다.

누구는 누구입니까? 비 침습적 인 방법 개별적으로 섹스와 마크 Altricial 병아리

Many experiments require early determination of offspring's sex as well as early marking of newborns for individual recognition. According to animal ...

who-is-who-non-invasive-methods-to-individually-sex-mark-altricial

Research

JoVE Journal

Biology

18.2K 조회수.  Freie Universität Berlin.  이 프로토콜은 매우 빠르고, 쉽고, 비 침습, 신뢰성과 저비용 수 방법의 편리한 세트, 조류의 분자 성 결정과 자신의 비 침습, 빠르고, 안전하고 쉽게 알아볼 곧 부화 후 마킹을 제공합니다. 병아리의 제한된 처리가 필요합니다. 방법이 편리한 도구는 RRR-지침을 완전히 준수합니다. 

비디오: Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks

Labeling hESCs and hMSCs with Iron Oxide Nanoparticles for Non-Invasive in vivo Tracking with MR Imaging

In recent years, stem cell research has led to a better understanding of developmental biology, various diseases and its potential impact on regenerative medicine. A non-invasive method to monitor the transplanted stem cells repeatedly in vivo would greatly enhance our ability to understand the mechanisms that control stem cell death and identify trophic factors and signaling pathways that improve stem cell engraftment. MR imaging has been proven to be an effective tool for the in vivo depiction of stem cells with near microscopic anatomical resolution. In order to detect stem cells with MR, the cells have to be labeled with cell specific MR contrast agents. For this purpose, iron oxide nanoparticles, such as superparamagnetic iron oxide particles (SPIO), are applied, because of their high sensitivity for cell detection and their excellent biocompatibility. SPIO particles are composed of an iron oxide core and a dextran, carboxydextran or starch coat, and function by creating local field inhomogeneities, that cause a decreased signal on T2-weighted MR images. This presentation will demonstrate techniques for labeling of stem cells with clinically applicable MR contrast agents for subsequent non-invasive in vivo tracking of the labeled cells with MR imaging.

For the evaluation of new stem cell therapies it is important to non-invasively track the injected cells in vivo. This video will show you how to label human mesenchymal and embryonic stem cells with iron oxide based contrast agents in vivo for subsequent MR imaging in vivo.

이런 산화물로 hESCs과 hMSCs을 라벨링하는 MR 영상과 생체내 추적 비침습에 대한 Nanoparticles

In recent years, stem cell research has led to a better understanding of developmental biology, various diseases and its potential impact on regenerative ...

연구

생물학

Labeling Stem Cells with Fluorescent Dyes for non-invasive Detection with Optical Imaging

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo labeling of stem cells with a fluorescent dye, subsequent intravenous injection of the labeled cells and visualization of their accumulation in specific target organs or pathologies. The presented technique demonstrates how we label human mesenchymal stem cells (hMSC) by simple incubation with the lipophilic fluorescent dye DiD (C67H103CIN2O3S) and how we label human embryonic stem cells (hESC) with the FDA approved fluorescent dye Indocyanine Green (ICG). The uptake mechanism is via adherence and diffusion of the lypophilic dye across the phospholipid cell membrane bilayer. The labeling efficiency is usually improved if the cells are incubated with the dye in serum-free media as opposed to incubation in serum-containing media. Furthermore, the addition of the transfection agent Protamine Sulfate significantly improves contrast agent uptake.

This video shows techniques for labeling of human embryonic stem cells and mesenchymal stem cells with fluorescent dyes. This technique can be used for an in vivo tracking of transplanted stem cells with optical imaging and for histopathological correlations with fluorescence microscopy.

광학 이미징과 비침습 감지를위한 형광 염료와 함께 줄기 세포를 라벨링

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo ...

Non-invasive 3D-Visualization with Sub-micron Resolution Using Synchrotron-X-ray-tomography

Little is known about the internal organization of many micro-arthropods with body sizes below 1 mm. The reasons for that are the small size and the hard cuticle which makes it difficult to use protocols of classical histology. In addition, histological sectioning destroys the sample and can therefore not be used for unique material. Hence, a non-destructive method is desirable which allows to view inside small samples without the need of sectioning.
We used synchrotron X-ray tomography at the European Synchrotron Radiation Facility (ESRF) in Grenoble (France) to non-invasively produce 3D tomographic datasets with a pixel-resolution of 0.7&micro;m. Using volume rendering software, this allows us to reconstruct the internal organization in its natural state without the artefacts produced by histological sectioning. These date can be used for quantitative morphology, landmarks, or for the visualization of animated movies to understand the structure of hidden body parts and to follow complete organ systems or tissues through the samples.

We used synchrotron X-ray tomography at the European Synchrotron Radiation Facility (ESRF) to non-invasively produce 3D tomographic datasets with a pixel-resolution of 0.7&micro;m. Using volume rendering software, this allows the reconstruction of internal structures in their natural state without the artefacts produced by histological sectioning.

싱크로 트론 - X - 레이 - tomography를 사용하여 서브 마이크론 해상도로 비침습 3D - 시각화

Little is known about the internal organization of many micro-arthropods with body sizes below 1 mm. The reasons for that are the small size and the hard ...

A Magnetic Tether System to Investigate Visual and Olfactory Mediated Flight Control in Drosophila

It has been clear for many years that insects use visual cues to stabilize their heading in a wind stream. Many animals track odors carried in the wind. As such, visual stabilization of upwind tracking directly aids in odor tracking. But do olfactory signals directly influence visual tracking behavior independently from wind cues? Also, the recent deluge of research on the neurophysiology and neurobehavioral genetics of olfaction in Drosophila has motivated ever more technically sophisticated and quantitative behavioral assays. Here, we modified a magnetic tether system originally devised for vision experiments by equipping the arena with narrow laminar flow odor plumes. A fly is glued to a small steel pin and suspended in a magnetic field that enables it to yaw freely. Small diameter food odor plumes are directed downward over the fly s head, eliciting stable tracking by a hungry fly. Here we focus on the critical mechanics of tethering, aligning the magnets, devising the odor plume, and confirming stable odor tracking.

Here we describe how to tether a fly in an olfactory magnetic-tether (OMT) apparatus. We describe how to align the rare-earth magnets and odor ports, and how to set mass flow rates for both the stimulus delivery and vacuum suction to achieve optimal odor tracking.

Drosophila에서 Visual과 강한 중재 플라이트 컨트롤을 맡은 이후로 자기 테더 시스템

It has been clear for many years that insects use visual cues to stabilize their heading in a wind stream. Many animals track odors carried in the wind. ...

Cell Block Preparation from Cytology Specimen with Predominance of Individually Scattered Cells

This video demonstrates Shidham's method for preparation of cell blocks from liquid based cervicovaginal cytology specimens containing individually scattered cells and small cell groups. This technique uses HistoGel (Thermo Scientific) with conventional laboratory equipment.
The use of cell block sections is a valuable ancillary tool for evaluation of non-gynecologic cytology. They enable the cytopathologist to study additional morphologic specimen detail including the architecture of the lesion. Most importantly, they allow for the evaluation of ancillary studies such as immunocytochemistry, in-situ hybridization tests (FISH/CISH) and in-situ polymerase chain reaction (PCR). Traditional cell block preparation techniques have mostly been applied to non-gynecologic cytology specimens, typically for body fluid effusions and fine needle aspiration biopsies.
Liquid based cervicovaginal specimens are relatively less cellular than their non-gynecologic counterparts with many individual scattered cells. Because of this, adequate cellularity within the cell block sections is difficult to achieve. In addition, the histotechnologist sectioning the block cannot visualize the level at which the cells are at the highest concentration. Therefore, it is difficult to monitor the appropriate level at which sections can be selected to be transferred to the glass slides for testing. As a result, the area of the cell block with the cells of interest may be missed, either by cutting past or not cutting deep enough. Current protocol for Shidham's method addresses these issues. Although this protocol is standardized and reported for gynecologic liquid based cytology specimens, it can also be applied to non-gynecologic specimens such as effusion fluids, FNA, brushings, cyst contents etc for improved quality of diagnostic material in cell block sections.

Shidham's method for preparation of cell blocks with AV-marker from cytology specimens containing individually scattered cells and small cell groups.

개별적으로 흩어져 셀의 우위와 세포학 표본에서 셀 블록 준비

This video demonstrates Shidham's method for preparation of cell blocks from liquid based cervicovaginal cytology specimens containing individually ...

A Practical Approach to Genetic Inducible Fate Mapping: A Visual Guide to Mark and Track Cells In Vivo

Fate maps are generated by marking and tracking cells in vivo to determine how progenitors contribute to specific structures and cell types in developing and adult tissue. An advance in this concept is Genetic Inducible Fate Mapping (GIFM), linking gene expression, cell fate, and cell behaviors in vivo, to create fate maps based on genetic lineage.
GIFM exploits X-CreER lines where X is a gene or set of gene regulatory elements that confers spatial expression of a modified bacteriophage protein, Cre recombinase (CreERT). CreERT contains a modified estrogen receptor ligand binding domain which renders CreERT sequestered in the cytoplasm in the absence of the drug tamoxifen. The binding of tamoxifen releases CreERT, which translocates to the nucleus and mediates recombination between DNA sequences flanked by loxP sites. In GIFM, recombination typically occurs between a loxP flanked Stop cassette preceding a reporter gene such as GFP.
Mice are bred to contain either a region- or cell type-specific CreER and a conditional reporter allele. Untreated mice will not have marking because the Stop cassette in the reporter prevents further transcription of the reporter gene. We administer tamoxifen by oral gavage to timed-pregnant females, which provides temporal control of CreERT release and subsequent translocation to the nucleus removing the Stop cassette from the reporter. Following recombination, the reporter allele is constitutively and heritably expressed. This series of events marks cells such that their genetic history is indelibly recorded. The recombined reporter thus serves as a high fidelity genetic lineage tracer that, once on, is uncoupled from the gene expression initially used to drive CreERT.
We apply GIFM in mouse to study normal development and ascertain the contribution of genetic lineages to adult cell types and tissues. We also use GIFM to follow cells on mutant genetic backgrounds to better understand complex phenotypes that mimic salient features of human genetic disorders.
This video article guides researchers through experimental methods to successfully apply GIFM. We demonstrate the method using our well characterized Wnt1-CreERT;mGFP mice by administering tamoxifen at embryonic day (E)8.5 via oral gavage followed by dissection at E12.5 and analysis by epifluorescence stereomicroscopy. We also demonstrate how to micro-dissect fate mapped domains for explant preparation or FACS analysis and dissect adult fate-mapped brains for whole mount fluorescent imaging. Collectively, these procedures allow researchers to address critical questions in developmental biology and disease models.

A Practical Approach to Genetic Inducible Fate Mapping: A Visual Guide to Mark and Track Cells In Vivo

Genetic Inducible Fate Mapping (GIFM) marks and tracks cells with fine spatial and temporal control in vivo and elucidates how cells from a specific genetic lineage contribute to developing and adult tissues. Demonstrated here are the techniques required to fate map E12.5 mouse embryos for epifluorescent and explant analysis.

유전자 Inducible의 운명 매핑에 대한 실용적인 접근법 : 셀을 선택하고 추적하는 비주얼 가이드 VIVO에서</em

Fate maps are generated by marking and tracking cells in vivo to determine how progenitors contribute to specific structures and cell types in developing ...

A Reversible, Non-invasive Method for Airway Resistance Measurements and Bronchoalveolar Lavage Fluid Sampling in Mice

Airway hyperreactivity (AHR) measurements and bronchoalveolar lavage (BAL) fluid sampling are essential to experimental asthma models, but repeated procedures to obtain such measurements in the same animal are generally not feasible.  Here, we demonstrate protocols for obtaining from mice repeated measurements of AHR and bronchoalveolar lavage fluid samples.  Mice were challenged intranasally seven times over 14 days with a potent allergen or sham treated.  Prior to the initial challenge, and within 24 hours following each intranasal challenge, the same animals were anesthetized, orally intubated and mechanically ventilated.  AHR, assessed by comparing dose response curves of respiratory system resistance (RRS) induced by increasing intravenous doses of acetylcholine (Ach) chloride between sham and allergen-challenged animals, were determined.  Afterwards, and via the same intubation, the left lung was lavaged so that differential enumeration of airway cells could be performed.  These studies reveal that repeated measurements of AHR and BAL fluid collection are possible from the same animals and that maximal airway hyperresponsiveness and airway eosinophilia are achieved within 7-10 days of initiating allergen challenge.  This novel technique significantly reduces the number of mice required for longitudinal experimentation and is applicable to diverse rodent species, disease models and airway physiology instruments.  

Repeated measurements of rodent respiratory physiology and sampling of airway inflammatory cells are desirable, but generally not feasible. Here we describe a repeatable method for orally intubating mice that permits repeated measurements of airway hyperreactivity and sampling of airway inflammatory cells.

에어웨이 저항 측정 및 마우스에 Bronchoalveolar 세척 유체 샘플링에 대한 가역, 비침습 방법

Airway hyperreactivity (AHR) measurements and bronchoalveolar lavage (BAL) fluid sampling are essential to experimental asthma models, but repeated ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

대변​​ 글루코 코르티코이드 분석 : equids는 비 침습적 부신 모니터링

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

Methods to Discover Alternative Promoter Usage and Transcriptional Regulation of Murine Bcrp1

Gene expression in different tissues is often controlled by alternative promoters that result in the synthesis of mRNA with unique &#8212; usually untranslated &#8212; first exons. Bcrp1 (Abcg2), the murine orthologue of the ABC transporter Breast Cancer Resistance Protein (BCRP, ABCG2), has at least four alternative promoters that are designated by the corresponding four alternative first exons produced: E1U, E1A, E1B, and E1C. Herein, in-silico protocols are presented to predict alternative promoter usage for Bcrp1. Furthermore, reporter assay methods are described to produce reporter constructs for alternative promoters and to determine the functionality of putative promoters upstream of the alternative first exons that are identified.

With the murine ABC transporter Bcrp1 (Abcg2) as an example, in-silico protocols are presented to detect alternative promoter usage in genes expressed in mouse tissues, and to evaluate the functionality of the alternative promoters identified using reporter assays.

방법은 쥐 Bcrp1의 대체 발기인 사용 및 전사 규정을 발견 할 수

Gene expression in different tissues is often controlled by alternative promoters that result in the synthesis of mRNA with unique &#8212; usually ...

Methods to Classify Cytoplasmic Foci as Mammalian Stress Granules

Cells are often challenged by sudden environmental changes. Stress Granules (SGs), cytoplasmic ribonucleoprotein complexes that form in cells exposed to stress conditions, are implicated in various aspects of cell metabolism and survival. SGs modulate cellular signaling pathways, post-transcriptional gene expression, and stress response programs. The formation of these mRNA-containing granules is directly connected to cellular translation. SG assembly is triggered by inhibited translation initiation, and SG disassembly is promoted by translation activation or by inhibited translation elongation. This relationship is further highlighted by SG composition. Core SG components are stalled translation pre-initiation complexes, mRNA, and selected RNA-binding Proteins (RBPs). The purpose of SG assembly is to conserve cellular energy by sequestering translationally stalled housekeeping mRNAs, allowing for the enhanced translation of stress-responsive proteins. In addition to the core constituents, such as stalled translation preinitiation complexes, SGs contain a plethora of other proteins and signaling molecules. Defects in SG formation can impair cellular adaptation to stress and can thus promote cell death. SGs and similar RNA-containing granules have been linked to a number of human diseases, including neurodegenerative disorders and cancer, leading to the recent interest in classifying and defining RNA granule subtypes. This protocol describes assays to characterize and quantify mammalian SGs.

Stress Granules (SGs) are nonmembranous cytoplasmic structures that form in cells exposed to a variety of stresses. SGs contain mRNAs, RNA-binding proteins, small ribosomal subunits, translation-related factors, and various cell signaling proteins. This protocol describes a workflow that uses several experimental approaches to detect, characterize, and quantify bona fide SGs.

포유류 스트레스 과립으로 세포질 초점을 분류하는 방법

Cells are often challenged by sudden environmental changes. Stress Granules (SGs), cytoplasmic ribonucleoprotein complexes that form in cells exposed to ...