Thanks to Jason Wright for suggesting the Golden Gate Assembly cloning strategy and Katherine Helming and members of Orkin lab, particularly Jian Xu, Guoji Guo, Elenoe Smith, and Partha Das for helpful discussions. This work was supported by NIH R01HL032259 and P30DK049216 (Center of Excellence in Molecular Hematology) to S.H.O. and NIDDK K08DK093705 to D.E.B.

1. CRISPR 디자인 <ol><li> 디자인 sgRNAs 수동으로 또는 무료로 사용할 수있는 온라인 툴도 7을 사용. 멀리 대상 사이트 (오프 - 타겟 효과)에서 절단의 위험을 줄이기 위해 동일한 유전자 일치 또는 거의 일치를 최소화 가이드 시퀀스를 식별하는 데 도움이 도구를 사용합니다. 가이드 서열이 게놈 인식 사이트에서 &quot;NGG&quot;순서 ( &quot;protospacer 인접 모티브&quot;또는 PAM)의 상류에 20 메르 ( &quot;protospacer 순서&quot;)로 구성되어 있는지 확인합니다. 참고 : 그림 1은 유전자와 비 코딩 요소에 대한 가능한 삭제 전략을 설명합니다. 유전자 녹아웃을 만들려면, 엑손에 위치한 두 sgRNA 기능의 손실도 monoallelic 삭제 클론을 풍부하게합니다. 이는 mRNA의 전사 (도 1b)의 붕괴 넌센스 매개로 이어지는 프레임 이동 돌연변이를 일으킬 가능성이 삭제되지 않은 대립 (12) 상에 형성된 삽입이나 삭제의 고주파에 기인한다. </li><li> 사용예를 들어 마우스의 Pim1의 의도 삭제 (; 표 1, 그림 2A 뮤스의 musculus)에 대해 안내합니다. 참고 :이 예에서, sgRNA-A의 protospacer 순서 및 PAM이 sgRNA-B의 protospacer 순서 및 PAM 상단 (왓슨) 스트랜드 (그림 2A)에 떨어지는 동안 바닥 (크릭) 가닥에 떨어지는 일이. 그러나, DSB는 상단 또는 하단 가닥 protospacer 순서 / PAM 상대의 방향을 독립적으로 발생합니다. </li><li> 각각의 가이드 시퀀스의 역 보완 (RC)를 결정합니다. 표 1 표 2에서 발견되는 예 Pim1 sgRNA의 보수 시퀀스를 역방향. </li><li> 클로닝 및 발현을 위해 추가 뉴클레오티드를 포함하여 각 가이드 및 관련 역 보완을위한 24 또는 25 메르 올리고를 얻습니다. 참고 : 여기에 우리가 pSpCas9 (BB) 플라스미드 (pX330) (Addgene 플라스미드 ID 42230)의 사용에 대해 설명합니다. 이 플라스미드를 동시에 허용sgRNA 및 SpCas9 만의 표현은 선택 7 마커가 포함되어 있지 않습니다. 다른 구조는 예컨대 GFP 및 퓨로 마이신과 같은 선별 마커를 각각 또는 여러 sgRNAs 단일 플라스미드로부터 발현 될 수있는 구조를 포함 pX458 (Addgene 플라스미드 ID 48138) 또는 pX459 (Addgene 플라스미드 ID 48139)로서, 이용 될 수있다. <ol><li> BbsI 제한 효소 (표 3)를 사용하여 pX330 벡터로의 복제를위한 가이드의 역 보완하기 전에 20 머 가이드 순서와 &quot;AAAC&quot;전에 &quot;CACC&quot;를 추가합니다. </li><li> 20 량체의 제 1 위치 CACC 시퀀스 후에 G 뉴클레오타이드 포함시킴으로써 향상된다 pX330 벡터의 U6 프로모터하지 G. sgRNA 식이면 CACC 서열 후 20 량체 전에 G 뉴클레오타이드 추가 . 상기 역방향 올리고 보체의 3 &#39;말단에서 C를 추가 (예 sgRNA-A 표 4). 결과 올리고 25 머 올리고 될 것이다. </li><li> 방법20 머 (protospacer 순서)의 첫 위치는 G의 경우 지금까지, 또 다른 G를 추가하지 않습니다 (예를 들어, sgRNA-B 표 4)와 역 보완 올리고의 최종 위치에 C를 추가하지 않습니다. 이 경우, 얻어진 올리고 24 량체 올리고 (표 4) 일 것이다. </li></ol></li></ol> 2. 디자인 삭​​제 상영 프라이머 <ol><li> ( &quot;삭제 밴드&quot;1도 - 2) 순서 내부 프라이머 디자인 한 세트 ( &quot;비 삭제 밴드&quot;)와 상류와 sgRNA 절단 부위의 다운 스트림 프라이머의 또 다른 세트를 삭제합니다. 삭제의 부재에서 &#39;결실 밴드 &quot;는 종종 효과적으로 증폭하기 위해 너무 크다. 일반적 검출 sgRNA 대상 부위에 작은 영향 INDEL되지 않을 수 있도록 예측 된 절단 부위로부터 프라이머를 적어도 100 BP를 사용한다. <ol><li> (흉터에 대한 sgRNA C에서 생산 된 작은 삽입이나 삭제를 분석하기 위해 추가 프라이머를 디자인의도 삭제하지 않고 leavage 사이트). 순방향의 쌍을 사용하여 (150 이내 - BP 350) 각각 sgRNA 대상 부위를 플 랭킹 역방향 프라이머 흉터 조사하기 sgRNA 대상 부위를 증폭. 이것은 monoallelic 결실 클론에서 삭제되지 않은 대립 유전자를 특성화하는 것이 유용 할 수있다. </li></ol></li><li> 삭제에 대해 작은 ( &quot;삭제 밴드&quot;여전히 증폭 수 있으므로), 크기가 결실의 존재 또는 부재와 일관성이 있는지 확인 영동 증폭 물을 해결. 이 방법의 경우, 단계 2.1에 기재된 내부 프라이머를 생략 할 수있다. </li></ol> 3. CRISPR의 복제 <ol><li> 어닐링 및 올리고을 인산화. <ol><li> DDH 2 O. 100 μM의 농도로 재현 탁 올리고 </li><li> 24 또는 25 메르 complemen 역, 1.0 μL의 sgRNA (참조 단계 1.4 100 μM) 1.0 μL의 sgRNA 24 또는 25 머 올리고 : 10 μL 반응마다 가이드에 대한 믹스와 그 역순으로 보완을 준비t 올리고, 1.0 ㎕의 10 배 T4 라이 게이션 완충액, 6.5 μL의 DDH 2 O 0.5 μL T4 폴리 뉴클레오티드 키나제 (PNK) (10,000 U / ㎖) (100 μM 단계 1.4 참조). 참고 : 인산화 올리고 대신 주문할 수 있습니다. 이 방식의 경우, T4 PNK의 사용을 생략한다. </li><li> 다음의 파라미터, 열 순환기에서 어닐링 : 30 분 동안 37 ° C를; 95 ° C 5 분 후 5 ℃ / 분에서 25 ° C까지 램프. </li><li> DDH 2 O에 올리고에게 1:10 희석 (예를 들어, 1.0 μl를 1 μM의 농도를 수득 올리고 + 9.0 μL의 DDH 2 O 어닐링). </li></ol></li><li> 골든 게이트 조립 복제 전략 (26)를 사용하여 pX330에 결찰 어닐링 올리고. <ol><li> 50 μL의 반응 혼합물을 준비 : 100ng의 원형 pX330 벡터, 1.0 μL 어닐링 올리고 (1 μM 단계 3.1.4 참조), 5.0 μL의 제한 효소 완충액 (10 배), 4.0 μL (20 U) BbsI 제한 효소 (5,000 U를 / ㎖) 5.0 μL 개의 ATP (10 mM)을 0.25 μL (5 μg의) BSA (20 ㎎ / ㎖), 0.375 μL (750 U) T4의 DNA 리가 제 (200 U / ㎖) 및 H 2 O 50 μL의 최종 부피. 필요한 경우이 반응은 작은 최종 부피를 축소 할 수있다. </li><li> 다음 매개 변수를 사용하여 열 순환기에 실행의 : 사이클 1-20 (5 분 37 ° C, 5 분 20 ° C) 21주기 (20 분 동안 80 ° C). 이러한 사이클링 조건은 하나의 반응 (단계 3.2 참조)에서 발생하는 소화 및 결찰 허용한다. </li><li> DH5α E. 10 μl를 변환 (- 3.2.2 3.2.1에서) 반응의 1 μL와 대장균 세포. </li><li> 100 ㎍ / ㎖의 앰피 실린, 37 ° C에서 O / N을 배양와 원성 국물 (LB) 한천 플레이트 위에 접시입니다. </li></ol></li><li> 3 식민지와 미니 준비 문화에 접종 - 2를 선택합니다. <ol><li> 각 샘플에 대해 미니 준비를 수행하고 U6 프로모터 정방향 프라이머를 사용하여 각 식민지를 시퀀싱 : CGTAACTTGAAAGTATTTCGATTTCTTGGC을. 이 아칸소epresentative 시퀀싱 프라이머; 기타 플 랭킹 프라이머가 이용 될 수있다. </li></ol></li><li> 일련의 검증 식민지를 선택하고 맥시 준비 문화로 접종. 준비 크기가 필요한 DNA 수율에 따라 확장 할 수있다. </li><li> 각 CRISPR / Cas9 구조에 대한 맥시 준비를 수행합니다. </li></ol> 4. 관심 세포에 CRISPRs 형질 감염 참고 :이 프로토콜은 전기 (27)에 의해 CRISPR / Cas9 플라스미드의 전달을 포함한다. 이 프로토콜은 뮤린 백혈병 (MEL) 세포 현탁 세포주 상세히 설명한다. 모든 단계에서 배지 MEL 셀에 사용되는 2 % 페니실린 / 스트렙토 마이신 및 1 % L- 글루타민, 보충 된 DMEM으로 구성. 그러나 CRISPR / Cas9 플라스미드 일시 발현 성공적 각 세포 유형에 대해 바람직한 배양 조건으로 형질 감염 전략을 사용하여 다수의 세포 유형에 적응 될 수있다. MEL 세포 현탁액은 세포, 세포 부착 시간 동안 설명하지만아베도 포함되었다. <ol><li> CRISPR 쌍 당 2 × 10 6 세포가 확인합니다. 전기 용액 100 ㎕에 2 × 10 6 세포를 재현 탁과 전기의 베트에 추가. <ol><li> 각 CRISPR / Cas9 구조 (10 μg의 총)의 5 μg의 추가. GFP 발현 구조 0.5 μg의 추가. </li></ol></li><li> 전기 시스템을 이용하여 2mm 큐벳 5 밀리 볼트와 250 세포 Electroporate. 참고 : 또는 양이온 리포좀 기반 형질로 다른 형질 전환 방법을 사용합니다. 게놈 편집 전에 강력한 플라스미드 전달을 보장하는 리포터 구조체와 함께 각각의 세포주에 형질 감염을위한 조건을 최적화한다. </li><li> 전기 천공 후 즉시 배양액 1㎖를 큐벳에서 용액으로 옮긴다. 세포 생존 능력을 향상시키기 위해 전기와 미디어로 이액 사이의 시간을 최소화한다. </li><li> 72 시간 - 24 37 °의 C - 30 품어. 게놈을 향상시킬 수 30 ° C의효율성을 편집,하지만 37 ° C가 허용됩니다. </li></ol> 형질 감염된 세포들 (FACS)를 정리 5. 형광 활성 세포 <ol><li> FACS 튜브에 50 μm의 필터를 통해 필터링하여 FACS에 대한 세포를 준비합니다. </li><li> FACS는 CRISPR의 높은 수준을받은 세포 풍부하게하기 위해 GFP 양성 세포의 3 ~ 상단 %를 정렬 / Cas9을 구성한다. </li><li> 개별적으로 분류기를 사용하여 96 웰 둥근 바닥 판에 96 웰 둥근 바닥 판 30 세포에서 제한 희석을 사용하여 플레이트 분류 세포. 종래 확실 96- 웰 플레이트 당 약 30 세포를 얻기 위해,이 단계를 수행하기에 한계 희석에 사용되는 세포 유형 도금 최적화. </li><li> 세포 배양 매체 잘 당 100 μl를 포함합니다. </li><li> 도금되지 않은 나머지 분류 세포 ( &quot;대량&quot;)의 경우, 미래 도금 세포의 절반을 동결. 검사 및 프라이머 검증을 위해 다른 반 플레이트 (6 단계 참조). 참고 :이 페이지rotocol 현탁 세포입니다. 개개의 단일 세포 유래 클론 꺾어 평평한 바닥 96 웰 플레이트에 이동할 수 있도록 부착 세포는 96- 웰 편평 바닥 플레이트에서 또는 저농도 10cm 접시에서 개별 세포를 성장 할 수 있습니다. </li><li> 7 일 클론 (7) 37 ℃에서 배양 할 수 있도록 - - 14 일 대량의 세포가 3, 37 ° C에서 배양 할 수 있습니다. 이 시간은 사용되는 세포주의 배가 시간에 따라 다릅니다. 참고 :이 배양 시간은 PCR에 의한 의도 삭제 게놈 DNA (gDNA를)을 선별하기에 충분한 세포 증식 (단계 6.1 및 7.1 참조) 할 수 있습니다. 농도를 초과하면 벌크 세포 충분히 100,000 세포 / ㎖ 또는 접착 세포 증식을 위해 ~ 한 세포를 ~ 80 % 합류점에 도달했다. 클론은 충분히 ~ 2mm 직경 번 거시적으로 볼 수 급증했다. </li></ol> 6. 프라이머 검증 및 CRISPR 선별 / Cas9 매개 삭제 <ol><li> DNA 추출 용액 50 μL에서 부모 및 대량 세포 펠렛을 재현 탁하여 부모 및 대량 분류 세포에서 gDNA를을 분리합니다. 주 : 셀 번호 광범위한 허용하지만 일반적 ~ 100,000 세포, DNA 추출을 위해 사용된다. 대량 분류 세포 sgRNA-A와 sgRNA-B에 노출 된 클론 인구로 구성되어 있습니다 (5 단계 참조). 다음의 PCR 프라이머는 목적 및 의도를 검증 유전자 결실의 존재를 확인하는 것이다. </li><li> 열 순환기에서 샘플을 실행하고 다음 프로그램을 실행 : 65 ° C를 6 분 동안 98 ° C를 2 분 동안의 gDNA를 추출 할 수 있습니다. DNA 농도를 측정한다. 주 : 단계 6.1 및 6.2은 DNA 추출을 위해 효율적인 방법을 권장하지만, 게놈 DNA의 분리를위한 임의의 방법은 단계 6.3에서 PCR을 수행 할 수 있도록 이용 될 수있다. </li><li> 10 _ (10 μl의 2 배 PCR 믹스, 0.5 μL 정방향 프라이머 : 다음과 같은 구성 요소와 20 μl의 PCR을 조립6; M), 0.5 μL 역방향 프라이머 (10 μM), 50 ~ 100 ng의 gDNA를, 20 μL까지 H 2 O. 위의 2 단계에서 디자인 된 프라이머를 사용합니다. 별도의 반응에서 &quot;비 - 삭제 밴드&quot;와 &quot;삭제 밴드&quot;에 대한 PCR을 실시한다. 참고 : 다수의 중합 단계 6.3을 사용할 수있다. <ol><li> 10 분에서 15 분 동안 95 ° C (30 초, 1 분, 60 ° C, 1 분, 72 ° C, 95 ° C)의 35 사이클, 그리고 72 ° C : 다음과 같은 매개 변수를 사용하여 열 순환기에서 실행 샘플 . 대량 분류 세포를 테스트를 기반으로 설계된 각각의 프라이머 쌍에 대한 PCR 조건을 최적화 할 수 있습니다. </li></ol></li><li> 1X 트리스 - 아세테이트 - EDTA (TAE) 버퍼를 사용하여 10 V / cm에서 2 % 아가 로스 겔에 샘플을 실행합니다. </li><li> 비 삭제 및 삭제 밴드 (그림 2)의 존재 / 부재에 대한 샘플을 검사합니다. 멀티플렉싱 &quot;삭​​제&quot;와 &quot;비 삭제&quot;하나의 반응에서 PCR 프라이머 쌍을 고려하십시오. 다중 최적화클론 인구에서 개별 클론을 선별하기 전에 (즉, 대부분은 세포를 분류). 그것은 삭제 및 비 삭제 증폭 산물 쉽게 다중화 아가 로스 젤에 해결하는 것이 중요합니다. </li></ol> 7. 심사 CRISPR / 삭제되거나 복제 선택을위한 Cas9 클론 <ol><li> 현탁 세포, 이미 150 μL의 최종 부피에 대해 웰 당 50 ㎕의 세포 배양 배지를 포함하는 하나의 96- 웰 플레이트의 모든 클론을 전송. 이것은 멀티 채널 피펫 7 단계에서 나머지 단계에 사용될 수 있도록하여 선별을 용이하게한다. <ol><li> 각각의 전송에서 50 μl의 웰 멀티 채널 피펫을 사용하여 96 웰 PCR 플레이트 (각 웰에 100 μl를 떠나). </li><li> 5 분 400 XG에 원심 분리기 PCR 플레이트와는 싱크대 PCR 플레이트를 가볍게 치면 뜨는을 제거. 잘 재현 탁 당 DNA 추출 용액 50 μl를 추가합니다. 서스펜션 세포 7.3 단계로 계속합니다. </리&gt; </ol></li><li> 부착 세포, 기음 미디어하십시오. 클론 선물을 각 웰에 0.05 % 트립신 EDTA 20 μl를 추가합니다. <ol><li> 미디어의 200 μL에 재현 탁 세포. 피펫 세포를 분리 섞는다. </li><li> 두 개의 96 웰 바닥이 평평한 판에 각 μL 플레이트 (100). 클론의 성장과 삭제에 대해 각각의 클론을 선별 다른 판을 사용할 수 있도록 한 판을 보관하십시오. </li><li> 200 μL의 총 부피에 대한 각 웰에 추가로 100 μl를 추가합니다. 세포가 성장 할 수 있도록 72 시간 - 24 기다립니다. </li><li> 기음 미디어. 96 - 웰 PCR 플레이트에 잘 재현 탁 및 전송 당 50 μl의 DNA 추출 솔루션을 추가합니다. 7.3 단계로 계속합니다. </li></ol></li><li> 클론에서 gDNA를 압축을 풉니 다. 열 순환기에서 샘플을 실행 : 6 분 65 ° C와 2 분의 gDNA를 추출하기위한 98 ° C. </li><li> PCR 프라이머와 벌크 세포상에서 최적화 된 반응 조건을 이용하여 각각의 동일한 클론 선별한다 (단계 6). </li><li> 클론의 iDEN을 선택원하는 삭제를 때만, 그리고 성장을위한 큰 접시 또는 플라스크로 이동합니다. </li></ol> 배체 삭제 클론 8. 확인 <ol><li> 얻어진 클론의 특성 및 성공적인 검증을 녹아웃하기 위해, 클론에서 DNA뿐만 아니라 RNA 및 / 또는 단백질 수준을 평가한다. <ol><li> 플라스미드 벡터에 (PCR 클로닝 키트 예) 증폭 산물을, DNA를 평가 교정 중합 효소와 배체 삭제 클론에서 삭제 대역을 증폭 및 복제합니다. DH5α 플라스미드로 E. 변형 관련 항생제와 LB 한천 플레이트 상에 대장균 세포와 판. 여러 식민지, 미니 준비 각각을 선택하고 각 삭제 대립 유전자 (28)의 특성을 생거 시퀀싱 각 복제 대상 - (30). 초기 화면 후 삭제를위한 PCR 시험을 반복하면 정확한 클론을 선택 및 결과의 재현성을 보장 하였다. </li><li> RNA를 평가하기 위해 세대를위한 RT-qPCR에 수행관련 유전자 30, 31의 전자 식입니다. </li><li> 단백질을 평가하기 위해, 관련 단백질 (33)에 대한 항체를 이용한 면역 블롯을 수행한다. </li></ol></li></ol>

<ol>
	<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+human+genome+engineering+via+Cas9.">RNA-guided human genome engineering via Cas9.</a> Science. 339 (6121), 823-826 (2013).</li><li>Gaj, T., Gersbach, C. A., Barbas, C. F. Z. F. N., TALEN, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas-based+methods+for+genome+engineering.">CRISPR/Cas-based methods for genome engineering.</a> Trends in Biotechnology. 31 (7), 397-405 (2013).</li><li>Barrangou, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+provides+acquired+resistance+against+viruses+in+prokaryotes.">CRISPR provides acquired resistance against viruses in prokaryotes.</a> Science. 315, 1709-1712 (2007).</li><li>Ding, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+efficiency+of+human+pluripotent+stem+cell+genome+editing+through+replacing+TALENs+with+CRISPRs.">Enhanced efficiency of human pluripotent stem cell genome editing through replacing TALENs with CRISPRs.</a> Cell Stem Cell. 12 (4), 393-394 (2013).</li><li>Ran, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+using+the+CRISPR-Cas9+system.">Genome engineering using the CRISPR-Cas9 system.</a> Nature Protocols. 8 (11), 2281-2308 (2013).</li><li>Ran, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double+nicking+by+RNA-guided+CRISPR+Cas9+for+enhanced+genome+editing+specificity.">Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity.</a> Cell. 154 (6), 1380-1389 (2013).</li><li>Larson, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+interference+(CRISPRi)+for+sequence-specific+control+of+gene+expression.">CRISPR interference (CRISPRi) for sequence-specific control of gene expression.</a> Nature Protocols. 8 (11), 2180-2196 (2013).</li><li>Yang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+generation+of+mice+carrying+reporter+and+conditional+alleles+by+CRISPR/Cas-mediated+genome+engineering.">One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering.</a> Cell. 154 (6), 1370-1379 (2013).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/Cas-mediated+genome+engineering.">One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering.</a> Cell. 153 (4), 910-918 (2013).</li><li>Canver, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Genomic+Deletion+Efficiency+Mediated+by+CRISPR/Cas9+in+Mammalian+Cells.">Characterization of Genomic Deletion Efficiency Mediated by CRISPR/Cas9 in Mammalian Cells.</a> Journal of Biological Chemistry. 289 (31), 21312-21324 (2014).</li><li>Xiao, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosomal+deletions+and+inversions+mediated+by+TALENs+and+CRISPR/Cas+in+zebrafish.">Chromosomal deletions and inversions mediated by TALENs and CRISPR/Cas in zebrafish.</a> Nucleic Acids Research. 41 (14), e141 (2013).</li><li>Zhou, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+sgRNAs+facilitate+CRISPR/Cas9+mediated+mouse+genome+targeting.">Dual sgRNAs facilitate CRISPR/Cas9 mediated mouse genome targeting.</a> The FEBS Journal. , (2014).</li><li>Wang, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+screens+in+human+cells+using+the+CRISPR-Cas9+system.">Genetic screens in human cells using the CRISPR-Cas9 system.</a> Science. 343 (6166), 80-84 (2014).</li><li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells.">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li><li>Niu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+Gene-Modified+Cynomolgus+Monkey+via+Cas9/RNA-Mediated+Gene+Targeting+in+One-Cell+Embryos.">Generation of Gene-Modified Cynomolgus Monkey via Cas9/RNA-Mediated Gene Targeting in One-Cell Embryos.</a> Cell. 156 (4), 836-843 (2014).</li><li>Guo, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+RNA/Cas9-mediated+genome+editing+in+Xenopus+tropicalis.">Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis.</a> Development. 141 (3), 707-714 (2014).</li><li>Xie, K., Yang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+genome+editing+in+plants+using+a+CRISPR-Cas+system.">RNA-guided genome editing in plants using a CRISPR-Cas system.</a> Molecular Plant. 6 (6), 1975-1983 (2013).</li><li>Waaijers, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-targeted+mutagenesis+in+Caenorhabditis+elegans.">CRISPR/Cas9-targeted mutagenesis in Caenorhabditis elegans.</a> Genetics. 195 (3), 1187-1191 (2013).</li><li>Bassett, A. R., Liu, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9+and+Genome+Editing+in+Drosophila.">CRISPR/Cas9 and Genome Editing in Drosophila.</a> Journal of Genetics and Genomics. 41 (1), 7-19 (2014).</li><li>Schwank, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+Repair+of+CFTR+by+CRISPR/Cas9+in+Intestinal+Stem+Cell+Organoids+of+Cystic+Fibrosis+Patients.">Functional Repair of CFTR by CRISPR/Cas9 in Intestinal Stem Cell Organoids of Cystic Fibrosis Patients.</a> Cell Stem Cell. 13 (6), 653-658 (2013).</li><li>Wu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correction+of+a+Genetic+Disease+in+Mouse+via+Use+of+CRISPR-Cas9.">Correction of a Genetic Disease in Mouse via Use of CRISPR-Cas9.</a> Cell Stem Cell. 13 (6), 659-662 (2013).</li><li>Lappalainen, T. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+and+genome+sequencing+uncovers+functional+variation+in+humans.">Transcriptome and genome sequencing uncovers functional variation in humans.</a> Nature. 501 (7468), 506-511 (2013).</li><li>Bauer, D. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Erythroid+Enhancer+of+BCL11A+Subject+to+Genetic+Variation+Determines+Fetal+Hemoglobin+Level.">An Erythroid Enhancer of BCL11A Subject to Genetic Variation Determines Fetal Hemoglobin Level.</a> Science. 342 (6155), 253-257 (2013).</li><li>Engler, C., Kandzia, R., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one+pot,+one+step,+precision+cloning+method+with+high+throughput+capability.">A one pot, one step, precision cloning method with high throughput capability.</a> PloS One. 3, e3647 (2008).</li><li>Gehl, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation:+theory+and+methods,+perspectives+for+drug+delivery,+gene+therapy+and+research.">Electroporation: theory and methods, perspectives for drug delivery, gene therapy and research.</a> Acta Physiologica Scandinavica. 177, 437-447 (2003).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+Plasmid+DNA+from+Bacterial+Colonies+Using+the+Qiagen+Miniprep+Kit.">Purifying Plasmid DNA from Bacterial Colonies Using the Qiagen Miniprep Kit.</a> J. Vis. Exp. (6), e247 (2007).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+Plasmid+DNA+into+E.+coli+Using+the+Heat+Shock+Method.">Transformation of Plasmid DNA into E. coli Using the Heat Shock Method.</a> J. Vis. Exp. (6), e253 (2007).</li><li>Finney, M., Nisson, P. E., Rashtchian, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+cloning+of+PCR+products.">Molecular cloning of PCR products.</a> Current Protocols in Molecular Biology. Chapter 15. (Unit 15.4), (2001).</li><li>Gordanpour, A., Nam, R. K., Sugar, L., Bacopulos, S., Seth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+Detection+in+Prostate+Tumors+by+Quantitative+Real-time+PCR+(qPCR).">MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR (qPCR).</a> J. Vis. Exp. (63), e3874 (2012).</li><li>Schularick, N. M., Clark, J. J., Hansen, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+Culture+of+Human+Vestibular+Schwannomas.">Primary Culture of Human Vestibular Schwannomas.</a> J. Vis. Exp. (89), e51093 (2014).</li><li>Eslami, A., Lujan, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Western+Blotting:+Sample+Preparation+to+Detection.">Western Blotting: Sample Preparation to Detection.</a> J. Vis. Exp. (44), e2359 (2010).</li><li>McVey, M., Lee, S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MMEJ+repair+of+double-strand+breaks+(director&#8217;s+cut):+deleted+sequences+and+alternative+endings.">MMEJ repair of double-strand breaks (director&#8217;s cut): deleted sequences and alternative endings.</a> Trends in Genetics. 24 (11), 529-538 (2008).</li><li>Symington, L. S., Gautier, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double-strand+break+end+resection+and+repair+pathway+choice.">Double-strand break end resection and repair pathway choice.</a> Annual Review of Genetics. 45, 247-271 (2011).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nature Biotechnology. 31 (9), 822-826 (2013).</li><li>Wu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+binding+of+the+CRISPR+endonuclease+Cas9+in+mammalian+cells.">Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells.</a> Nature Biotechnology. , (2014).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nature Biotechnology. 31 (9), 827-832 (2013).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+CRISPR-Cas+nuclease+specificity+using+truncated+guide+RNAs.">Improving CRISPR-Cas nuclease specificity using truncated guide RNAs.</a> Nature Biotechnology. 32, 279-284 (2014).</li><li>Alem&#225;n, L. M., Doench, J., Sharp, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=a+Comparison+of+siRNA-induced+off-target+RNA+and+protein+effects.">a Comparison of siRNA-induced off-target RNA and protein effects.</a> RNA. 13 (3), 385-395 (2007).</li><li>Anderson, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+validation+of+the+importance+of+seed+complement+frequency+to+siRNA+specificity+Experimental+validation+of+the+importance+of+seed+complement+frequency+to+siRNA+specificity.">Experimental validation of the importance of seed complement frequency to siRNA specificity Experimental validation of the importance of seed complement frequency to siRNA specificity.</a> RNA. 14, 853-861 (2008).</li><li>Marine, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Common+seed+analysis+to+identify+off-target+effects+in+siRNA+screens.">Common seed analysis to identify off-target effects in siRNA screens.</a> Journal of Biomolecular Screening. 17 (3), 370-378 (2012).</li></ol>

We have no conflicts of interest related to this report.

CRISPR / Cas9 시스템 등 다양한 크기의 게놈의 결실을 생성하기 위해 사용될 수있다. 우리는 삭제의 주파수가 의도 삭제 크기에 대하여 반비례 관찰했지만, 우리는 정기적으로 여러 배체 삭제 클론을 얻을 1백킬로바이트까지 최대 1 메가의 삭제 및 삭제를 복구 할 수 있었다. 우리는 세포 라인에 순차적으로 도입 삭제의 효율 손실을 관찰 없다. 이 전략은 다수의 유전자와 요소의 조합 삭제의 생성에 사용할 수 있습니다. 삭제 배체 클론을 얻는 과정은 12 배체 결실 클론의 수를 얻기 위해 결실 크기에 따라 선별 될 필요 클론의 최소 수를 추정함으로써 신속 할 수있다. 확률 분포 배체 삭제 부재와 monoallelic 삭제를 수득하는 능력은 완전한 기능의 상실과 관련된 세포 치사를 나타낼 수있다. 낮은 FRequency 결석 삭제는 가난한 형질 전환, 비효율적 sgRNAs 또는 (때문에 양성 대조군의 부족으로 삭제 화면에 PCR 프라이머의 유효성을 검사) 비효율적 인 PCR 검사 프라이머를 포함하는 시나리오의 수를 반영 할 수있다. GFP + 세포는 형질 전환 효율 (단계 5.2 참조) 대용으로 사용할 수 있도록 GFP + 세포의 감소 가능성이 불량한 형질을 반영하고 결과적인 결실은 효율을 감소시켰다. 비효율적 sgRNA에 대한 제어를 할 수 있습니다 독립적 인 심사 프라이머와 두 개의 서로 다른 sgRNA 쌍을 사용하여 PCR 프라이머를 선별하고 배체 삭제 클론을 얻을 기회를 극대화 할 수 있습니다. GFP + 세포 정렬 셀은 삭제 대립 유전자에 대한 풍부. 이 단계를 생략 할 수 있지만, 누락 가능성이 monoallelic 또는 배체 삭제 가진 사람을 식별하는 데 더 클론을 선별 필요로합니다. 형질 전환 효율이 최적화 될 수 있음도, 우리는 게놈 편집 효율을 향상시킬 것으로 기대된다. (그림 2B)의 사이트에서 삭제 - 주된 결과는 작은 ~ 1입니다. 종종 이러한 대립은 microhomology 기반 수리 34, 35의 결과로 나타납니다. 우리가 설명-PCR 기초 검출 전략 크게 또는 더 복잡한 삽입, 결실, 역위 또는 재 배열을 확인하지 않은 경우도있다. 이러한 이벤트는 덜 일반적이지만, 우리는 모두 삭제하거나 비 삭제 증폭 산물이 검출 될 수있는 클론을 관찰하고, 추가 조사에이 더 복잡한 결과를 반영했다. 우리는 광범위한 CRISPR가 / monoallelic 및 비 삭제 클론에서 비 삭제 대립 유전자의 &quot;상처&quot;를 Cas9이 매개 관찰 (그림 2B 참조). 이러한 &quot;상처&quot;구성의도없이 삭제 sgRNA 절단 부위에서 생산 작은 삽입이나 삭제 (즉, sgRNAs와 B 사이의 중간 세그먼트의 삭제). 이러한 흉터는 종종 sgRNA에 의해 대상 인식을 중단. 그러므로 우리는 이전에 같은 sgRNAs를 사용 sgRNAs에 노출 된 세포에서 대립 유전자 타겟 변경에주의를 촉구한다. 독특한 sgRNA을 활용 것보다 성공적인 리 타겟팅 전략은 이전에 &quot;상처&quot;인식 부위 구별 시퀀스. 경우 sgRNAs의 쌍 (도 1b, 바닥), 틀 이동 대립 유전자의 결실에도 부재하에 제조 될 수있다 엑손 서열을 인식 할 때. 따라서 monoallelic 결실 클론 의한 대립 유전자 (12)에서 삭제되지 않은 프레임 이동 돌연변이의 고주파로 기능 상실 용 풍부 할 수있다. 38 - CRISPR / Cas9 시스템과 하나의 관심사는 오프 - 타겟 효과, 즉, 의도하지 않은 사이트 (36)에서 유전자 변형이다. Recent 보고서 (17)와 짧은 가이드 RNA를 제안했다 - 19 뉴클레오티드가 CRISPR의 빈도를 줄일 수 / 오프 대상 효과 39 Cas9는 기반. 또한 nickase으로 목표 부위 당 두 개의 가이드를 사용하여 이중 칼자국내는 전략은 오프 - 타겟 효과 (7)을 최소화하면서 DSBs를 생성하는데 사용될 수있다. 대안 적으로, RNAi를 사용 전략과 유사한, 우리는 비 중첩 protospacer 서열과 sgRNAs 상이한 쌍 오프 - 타겟 잠재 대조적으로 관찰 표현형 온 타겟 CRISPR / Cas9 수정의 결과가 있음을 입증하는 데 사용될 수 있음을 시사 효과. 편리한 방법은 선별 프라이머 (공정 2 참조)의 하나의 세트는 다중 sgRNA 쌍 (도 1a)에 사용될 수 있도록 적어도 두 개의 인접하지만 비 중첩 sgRNA 쌍을 설계하는 것이다. 또한, 누락 된 순서 및 / 또는 파쇄를 재 도입 유전자 결실 세포주를 보완하면 사이의 인과 관계를 입증 할 수있는주어진 게놈 삭제 및 표현형. 셀룰러 모델 시스템 작업 생물 학자, RNAi의이 기능 유전체학을위한 강력한 도구를 대표했다. 42 - 그러나,이 방법의 제한 대상의 mRNA 전 사체 수준 불완전 환원, 동일한 유전자 타겟팅 독립적 시약의 효과의 이질성, 종자 계 및 비 시드 효과 (40)를 포함한 공지 된 오프 - 타겟 효과를 포함했다. 게놈 편집 전략은 이러한 문제의 대부분을 해결하기 위해 약속과 미래의 유전 적 교란 8,36,37에 대한 흥미로운 보완적인 접근 방식을 나타냅니다. 또한, 게놈 RNAi를 편집 가능하고, 종래의 표적으로하지 도전 방식으로 유전 적 요소를 비 - 코딩 (25)의 접근을 허용 연구. 우리는 생산 및 기능 상실 대립 유전자의 특성을 강력하고 구체적인 방법으로 CRISPR / Cas9에 의해 게놈 삭제의 생성을 권장합니다.

Recent advances in genome engineering technology have allowed for unprecedented opportunities for site-specific modification of the genome. This technology may be utilized to investigate the function of genes and regulatory elements via prospective genetic perturbation. Zinc finger nucleases (ZFNs), transcription-activator like (TAL) effector nucleases (TALENs), and CRISPR/Cas9 RNA-guided nucleases each leverage customizable DNA specificity to localize a nuclease for the introduction of DSBs1&#8211;3. The resulting DSBs can be repaired by indel-forming NHEJ or by homology-directed repair (HDR) using a donor template4.
The CRISPR/Cas9 nuclease pathway, an adaptive immune system in prokaryotic cells5, has been recently adapted for mammalian genome engineering2,3. This tool has been demonstrated to be an inexpensive, efficient, and reliable genome engineering technique6. Briefly, a complex of Streptococcus pyogenes-derived Cas9 nuclease and a sgRNA achieve target recognition via Watson-Crick base-pairing with cognate genomic DNA sequences. sgRNAs include 20-mer sequences complementary to genomic sequences adjacent to an obligate protospacer adjacent motif (PAM) NGG. Cas9 induces a DSB at a predictable position within the target site. Additionally, variants of Cas9 with single-strand cleavage capacity or catalytic inactivity may be used to facilitate &#8220;nicking&#8221; or transcriptional regulation respectively7&#8211;9. CRISPR/Cas9 has been used for a wide range of applications including both knock-in and knockout10,11, large-scale genomic deletions12&#8211;14, pooled library screening for gene discovery15,16, genetic engineering of numerous model organisms10,11,17&#8211;21, as well as gene therapy22,23.
Here we describe a protocol for efficient deletion of desired genomic regions. The protocol includes CRISPR design, cloning, and delivery, as well as deletion, identification, and characterization. Genomic deletions can be generated by the introduction of two CRISPR sgRNAs with Cas9 to induce repair of the resultant two DSBs by NHEJ with deletion of the intervening segment. This strategy has been used to create deletions ranging from one kilobase to over one megabase12. Deletions can be informative for the study of genes and other genetic elements, either in isolation or in combination. There are several potential advantages of genomic deletions as compared to HDR or single-site small indel production. First, this method capitalizes on the high efficiency of NHEJ in many cellular contexts7. The high frequency of deletion limits the number of clones needed to be screened to identify informative clones. Deletion frequency is inversely related to deletion size. Biallelic deletion clones may be retrieved at frequencies at least as great as of probabilistic expectation12. Second, both monoallelic and biallelic deletions may be easily identified and distinguished by conventional PCR, simplifying the screening process. Strategies relying on small indels or point mutations may require RFLP, allele-specific PCR, T7EN1 cleavage assay, Sanger sequencing, RT-qPCR, or immunoblotting, which may be more laborious. Third, by removing a substantial portion of a gene or element of interest, a reliable loss-of-function allele may be obtained. In contrast, frameshift mutations in protein-coding sequences may not always induce nonsense-mediated decay, may produce a hypomorphic or neomorphic allele, or target an exon excluded from an alternate isoform24. Finally, deletions may be particularly revealing for the study of non-coding DNA such as regulatory elements since frameshift mutations as produced by single-site indels would not be relevant25.

<table border="0" cellpadding="0" cellspacing="0" width="842">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:388px;">Name of Material/ Equipment</td>
			<td style="width:168px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">T4 Polynucleotide Kinase</td>
			<td>New England Biolabs</td>
			<td>M0201S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">T4 DNA Ligase (with associated ligation buffer)</td>
			<td>New England Biolabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Adenosine 5&#39;-Triphosphate (ATP)</td>
			<td>New England Biolabs</td>
			<td>P0756S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BSA, Molecular Biology Grade</td>
			<td>New England Biolabs</td>
			<td>B9000S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BbsI Restriction Enzyme (with associated NEB Buffer 2.1)</td>
			<td>New England Biolabs</td>
			<td>R0539S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pSpCas9(BB) (pX330)</td>
			<td>Addgene</td>
			<td>42230</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">S.O.C. Medium</td>
			<td>Life Technologies</td>
			<td>15544-034</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BTX ECM 830</td>
			<td>Harvard Apparatus</td>
			<td>45-0052</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BTX Solution and 2mm Cuvettes</td>
			<td>Harvard Apparatus</td>
			<td>45-0803</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pmaxGFP Plasmid</td>
			<td>Lonza</td>
			<td>VPA-1003</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuickExtract DNA Extraction Solution</td>
			<td>Epicentre</td>
			<td>QE09050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HotStarTaq PCR Master Mix Kit</td>
			<td>Qiagen</td>
			<td>203443</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Zero Blunt PCR Cloning Kit</td>
			<td>Life Technologies</td>
			<td>K2700-20</td>
			<td></td>
		</tr>
	</tbody>
</table>

generation of genomic deletions in mammalian cell lines via crispr/cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific eukaryotic genome engineering. CRISPR/Cas9 is an inexpensive, facile, and efficient genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple methodology for CRISPR design, cloning, and delivery for the production of genomic deletions. In addition, we describe techniques for deletion, identification, and characterization. This strategy relies on cellular delivery of a pair of chimeric single guide RNAs (sgRNAs) to create two double strand breaks (DSBs) at a locus in order to delete the intervening DNA segment by non-homologous end joining (NHEJ) repair. Deletions have potential advantages as compared to single-site small indels given the efficiency of biallelic modification, ease of rapid identification by PCR, predictability of loss-of-function, and utility for the study of non-coding elements. This approach can be used for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines.

이 실험의 목적은 세포에서 MEL Pim1의 결실이었다. 여러 개의 비 중첩 sgRNA 쌍 (즉, 독립 protospacer 시퀀스)의 사용은 오프 대상 효과 (그림 1A)를 통제하는 데 도움이 될 수 있습니다. 일관된 표현형 다중 독립 protospacer 서열에 의해 공유되는 공통 표적 이탈 효과 반대로 온 - 타겟 효과에 기인 할 가능성이있을 것이다. 각 쌍은 고유 삭제 중단 점의 생산으로 이어질 것입니다. (즉, N ~ 150 염기쌍 미만) 서로 가까이 있다면, 동일한 선별 프라이머 sgRNAs들의 각 세트에 의해 생성 된 결실을 검출하는데 사용될 수있다. 게놈 유전자가 결실 (도 1b)에 대해 다양한 위치에서 sgRNA 쌍을 사용하여 유전자를 방해 할 수있다. 예를 들어, sgRNA 쌍은 전체 유전자의 결실을위한 바디 유전자의 측면에 위치 할 수있다; 한 쌍의 틀 이동 삽입이나 삭제를 만들 수있는 잠재력을 가진 두 개의 엑손 내에 위치 할 수있는 경우에도 하나 또는 둘 모두하기 병렬ES는 삭제되지 않은; 또는 쌍 특정 이성체의 중단을 허용하도록 특정 엑손의 측면에 위치 할 수있다. Pim1에 사용 된 삭제 전략은 전체 유전자 본체, 8킬로바이트 삭제 (그림 2) 삭제 sgRNAs의 측면에 설계하는 것이 었습니다. 이 전략은 인해 Pim1 유전자의 상대적으로 작은 크기에 부분적으로 선택되었다. 이 예는 아래 (크릭) 가닥에 최고 (왓슨) 가닥 한 PAM에 한 PAM (녹색)를 보여줍니다; 그러나, DSB는 상단 또는 하단 가닥 PAM 시퀀스 현지화 독립적이다. sgRNA 쌍 가닥 바닥에서 상부 가닥 둘 모두 PAM 서열을 가지고, 또는 각각의 일 수있다. 전술 한 프로토콜을 사용하여, 두 sgRNA 설계, pX330 발현 벡터 내로 클로닝하고, GFP 리포터 (도 2a)와 함께 일렉트로 MEL 세포로 전달 하였다. GFP + 세포의 상위 3 %가 이일을 후 전기를 정렬 희석을 제한에서 클론 적 도금했다. 화면도 2에 나타낸 바와 같이 프라이머를 보내고 단계 2에서 설명 된 바와 같이 설계 하였다. PCR 조건은 부모 세포로부터 MEL 및 &quot;벌크&quot;정렬 세포로부터 단리 된 gDNA를 사용하여 최적화되었다. 십일 도금 후, gDNA를 모든 클론에서 분리 된 비 삭제 (ND) 및 삭제 (D) 증폭 산물의 패턴에 따라 비 삭제, monoallelic과 배체 삭제 클론을 확인 PCR을 통해 삭제에 대한 검사 (그림 3) . 비 결실 클론 비 삭제 앰플 리콘의 존재 및 삭제 앰플 리콘의 부재를 갖는 것으로 확인되었다. Monoallelic 클론 비 삭제 삭제 및 증폭 산물의 존재 양자 모두를 갖는 것으로 확인되었다. 배체 클론 비 삭제 앰플 리콘의 부재 및 삭제 앰플 리콘의 존재를 갖는 것으로 확인되었다. 이 삭제를 들어, 400 클론 선별 된 126 monoallelic 삭제 클론 32 일 배체 delet을 확인하는<html> 이온 클론 (이것은 삭제 삭제 주파수가 12 크기에 따라 변화하는 것이 중요하다). 배체 삭제 클론을 선택하고 미디어의 8 ml의 플라스크로 이동했다. 확장을위한 오일을 허용 한 후, 각각의 클론 배체 삭제 및 삭제 증폭 산물이 정확한 삭제 (그림 2B)를 식별하기 위해 생거 시퀀싱을 실시 하였다 확인 된 gDNA의 PCR 다시 테스트했다. 삭제 증폭 산물 내의 이질성은 불완전한 INDEL 형성 NHEJ 수리를 반영합니다. 대부분의 경우에 삽입과 삭제를 발견 monoallelelic 결실 클론의 비 삭제 대립 유전자의 염기 서열, monoallelic 및 배체 결실 클론 모두가 요구되는 경우 애플리케이션에 중요 할 수있는, 심지어 비 삭제 된 대립 유전자 빈도 CRISPR / Cas9 의해 편집되는 것을 보여주는 . RNA는 배체 결실 클론으로부터 분리하고 (도 4) Pim1 발현의 상실 확인을 위해 RT-qPCR에 의해 분석 하였다. 방법 &quot;&gt; <img alt="그림 1" src="/files/ftp_upload/52118/52118fig1highres.jpg" /> 가능한 삭제 전략의 그림 1. 도식. (A) 게놈 삭제에 대해 두 가지 예를 sgRNA 쌍 (각각 블랙과 오렌지 참조). 파란색 화살표는 비 삭제 증폭 물을 검출하는 프라이머를 표시하고 빨간색 화살표는 삭제 증폭 물을 검출하는 프라이머를 나타냅니다. sgRNA 17 위치 및 18에서 빨간색과 파란색으로 표시됩니다 sgRNA-사이트-A 1 / A 2 위치 (17) 사이의 예측 Cas9 절단을 나타내는 레드 라인 sgRNA-사이트-B 1 / B 2에서 보라색, 주황색으로 표시됩니다 , 18 (B) CRISPR 지시 분열 수직 검은 선으로 표시됩니다. 파란색 화살표는 비 삭제 증폭 물을 검출하는 프라이머를 표시하고 빨간색 화살표는 삭제 증폭 물을 검출하는 프라이머를 나타냅니다. <a href="https://www.jove.com/files/ftp_upload/52118/52118fig1large.jpg" target="_blank">보려면 여기를 클릭하십시오</a>이 그림의 더 큰 버전. <img alt="그림 2" src="/files/ftp_upload/52118/52118fig2highres.jpg" /> 그림 생산 및 시퀀싱 삭제 및 비 삭제 대립 유전자를 포함 Pim1의 삭제를 감지 2. 전략. PCR 기반의 선별 전략 (A) 도식은 Pim1 삭제 클론을 식별합니다. 하나의 프라이머 쌍은 삭제 (파란색 화살표)와 하나의 프라이머 쌍의 내부에 위치하여 삭제 (빨간색 화살표) 외부 지역화됩니다. sgRNA 시퀀스 (protospacer 시퀀스) 보라색에 표시됩니다. 적색 선은 수직 위치 (17)와 sgRNA 서열 18 간의 예측 Cas9 절단을 나타낸다. (B) 생거 시퀀싱 sgRNA 인식 부위에 INDEL 형성을 보여준다. sgRNA 시퀀스는 녹색 보라색과 PAM 순서로 표시됩니다. 삭제 이벤트는 쉬 아르대시 마크와 삽입의 동등한 수에 의하여 자신의 파란색으로 표시됩니다. 세로 레드 라인은 위치 (17)과 sgRNA 18 사이에., 분열 사이트를 예측 나타냅니다 <a href="https://www.jove.com/files/ftp_upload/52118/52118fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/52118/52118fig3highres.jpg" /> 그림 3. 비 삭제, monoallelic 및 배체 클론을 식별 대표 젤. 각 복제의 경우, 왼쪽 차선이 비 삭제의 증폭 (파란색 &quot;ND&quot;)와 오른쪽 차선을 나타내는 빨간색에서 삭제 앰플 리콘 ( &quot;D&quot;를 나타냅니다 ). 개별 클론 점선으로 구분됩니다. 세 monoallelic 결실 클론 클론 5, 6이고, 시퀀싱 데이터에서 알 수있는 바와 같이, 2 배체 세 결실 클론, C의 결실 클론 밴드 15, 17, 13 및 아르<html> 외로운 13 결실 접합부 큰 결실로 인해 더 작은 크기를 갖는다. <img alt="그림 4" src="/files/ftp_upload/52118/52118fig4highres.jpg" /> 배체 삭제 클론의 Pim1 표현의 그림 4. 손실. Pim1 발현은 RT-qPCR에 의한 두 배체 삭제 클론을 계산 하였다. ΔCT 방법 - 데이터는 2를 사용 GAPDH에 정상화되었다. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td></td><td> Protospacer 순서 </td></tr><tr><td> sgRNA-A </td><td> 5&#39;-TAGGAAAATGACTCGTCACT-3 &#39; </td></tr><tr><td> sgRNA-B </td><td> 5&#39;-GTCTATCCTATCTCGATAAA-3 &#39; </td></tr></tbody></table> 표 Pim1의 삭제에 대한 두 sgRNA 1. 20 머 protospacer 시퀀스. (543) &quot;&gt; <tbody><tr height="23"><td height="23" style="height:23px;width:101px;"></td><td style="width:443px;"> Protospacer 순서의 역방향 보완 </td></tr><tr height="23"><td height="23" style="height:23px;"> sgRNA-A-RC </td><td> 5&#39;-AGTGACGAGTCATTTTCCTA-3 &#39; </td></tr><tr height="23"><td height="23" style="height:23px;"> sgRNA-B-RC </td><td> 5&#39;-TTTATCGAGATAGGATAGAC-3 &#39; </td></tr></tbody></table> 표 1에서 두 sgRNA에 대한 protospacer 서열 표 2 역 보완. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td></td><td> 시퀀스 </td></tr><tr><td> sgRNA-A </td><td> 5&#39;-CACCTAGGAAAATGACTCGTCACT-3 &#39; </td></tr><tr><td> sgRNA-A-RC </td><td> 5&#39;-AAACAGTGACGAGTCATTTTCCTA-3 &#39; </td></tr><tr><td> sgRNA-B </td><td> 5&#39;-CACCGTCTATCCTATCTCGATAAA-3 &#39; </td></tr><tr><td> sgRNA-B-RC </td><td> 5&#39;-AAACTTTATCGAGATAGGATAGAC-3 &#39; </td></tr></tbody></table> 표 3. Protospacer 서열 및 역방향 &quot;CACC&quot;및 &quot;AAAC&quot;로 보완은 BbsI 제한 효소를 사용 pX330 벡터 내로 클로닝 첨가. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td></td><td> 시퀀스 </td></tr><tr><td> sgRNA-A </td><td> CACCGTAGGAAAATGACTCGTCACT 5&#39;-3 &#39; </td></tr><tr><td> sgRNA-A-RC </td><td> AAACAGTGACGAGTCATTTTCCTAC 5&#39;-3 &#39; </td></tr><tr><td> sgRNA-B </td><td> CACCGTCTATCCTATCTCGATAAA 5&#39;-3 &#39; </td></tr><tr><td> sgRNA-B-RC </td><td> AAACTTTATCGAGATAGGATAGAC 5&#39;-3 &#39; </td></tr></tbody></table> pX330 벡터의 U6 프로모터 표 4. sgRNA 식 CACC 서열 후 및 전의 G 염기의 첨가에 의해 향상된다20 량체. 엑스트라 G 염기의 첨가는 역방향 올리고 보체의 3 &#39;말단 (예 sgRNA-A)에서의 C 염기의 첨가를 필요로한다. 20 량체 (protospacer 시퀀스)의 제 1 위치에 이미 G 뉴클레오타이드 인 경우에는, 다른 G를 추가 할 필요가 없다 (예, sgRNA-B) 및 역방향 상보의 최종 위치에 C를 추가 할 필요 올리고.

Watch this Scientific Journal Video about Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9 at JoVE.com

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

CRISPR/Cas9 is a robust system to produce disruption of genes and genetic elements. Here we describe a protocol for the efficient creation of genomic deletions in mammalian cell lines using CRISPR/Cas9.

CRISPR / Cas9를 통해 포유 동물 세포주의 게놈에 삭제 세대

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific ...

generation-of-genomic-deletions-in-mammalian-cell-lines-via-crisprcas9

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Unit 2

Analyzing Gene Expression and Function

SCIENTISTS IN ACTION

94.9K 조회수.  Harvard Medical School. CRISPR/Cas9 is a robust system to produce disruption of genes and genetic elements. Here we describe a protocol for the efficient creation of genomic deletions in mammalian cell lines using CRISPR/Cas9.

비디오: Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

MISSION esiRNA for RNAi Screening in Mammalian Cells

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as small interfering RNAs (siRNAs). The short double-stranded RNAs originate from longer double stranded precursors by the activity of Dicer, a protein of the RNase III family of endonucleases. The resulting fragments are components of the RNA-induced silencing complex (RISC), directing it to the cognate target mRNA. RISC cleaves the target mRNA thereby reducing the expression of the encoded protein1,2,3. RNAi has become a powerful and widely used experimental method for loss of gene function studies in mammalian cells utilizing small interfering RNAs.
Currently two main methods are available for the production of small interfering RNAs. One method involves chemical synthesis, whereas an alternative method employs endonucleolytic cleavage of target specific long double-stranded RNAs by RNase III in vitro. Thereby, a diverse pool of siRNA-like oligonucleotides is produced which is also known as endoribonuclease-prepared siRNA or esiRNA. A comparison of efficacy of chemically derived siRNAs and esiRNAs shows that both triggers are potent in target-gene silencing. Differences can, however, be seen when comparing specificity. Many single chemically synthesized siRNAs produce prominent off-target effects, whereas the complex mixture inherent in esiRNAs leads to a more specific knockdown10.
In this study, we present the design of genome-scale MISSION esiRNA libraries and its utilization for RNAi screening exemplified by a DNA-content screen for the identification of genes involved in cell cycle progression. We show how to optimize the transfection protocol and the assay for screening in high throughput. We also demonstrate how large data-sets can be evaluated statistically and present methods to validate primary hits. Finally, we give potential starting points for further functional characterizations of validated hits.

Here we use a human esiRNA library in a high-throughput screen for genes involved in cell division. We demonstrate how to set up and conduct an esiRNA screens, as well as how to analyze and validate the results.

포유 동물 세포에서 RNAi 심사를위한 선교 esiRNA

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as ...

연구

생물학

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.
In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.
Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.
The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci&#x2014;either Green Monster GMToolkit-a or GMToolkit-&alpha; at the can1&Delta; locus (Figure 3). Using strains from the yeast deletion collection12, GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or &alpha;-mating-type-specific haploid selection marker1 and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.
The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

여러 유전자 삭제를 운반 효모 종자의 생성에 대한 초록 괴물 프로세스

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Generation of Stable Human Cell Lines with Tetracycline-inducible (Tet-on) shRNA or cDNA Expression

A major approach in the field of mammalian cell biology is the manipulation of the expression of genes of interest in selected cell lines, with the aim to reveal one or several of the gene's function(s) using transient/stable overexpression or knockdown of the gene of interest. Unfortunately, for various cell biological investigations this approach is unsuitable when manipulations of gene expression result in cell growth/proliferation defects or unwanted cell differentiation. Therefore, researchers have adapted the Tetracycline repressor protein (TetR), taken from the E. coli tetracycline resistance operon1, to generate very efficient and tight regulatory systems to express cDNAs in mammalian cells2,3. In short, TetR has been modified to either (1) block initiation of transcription by binding to the Tet-operator (TO) in the promoter region upon addition of tetracycline (termed Tet-off system) or (2) bind to the TO in the absence of tetracycline (termed Tet-on system) (Figure 1). Given the inconvenience that the Tet-off system requires the continuous presence of tetracycline (which has a half-life of about 24 hr in tissue cell culture medium) the Tet-on system has been more extensively optimized, resulting in the development of very tight and efficient vector systems for cDNA expression as used here.
Shortly after establishment of RNA interference (RNAi) for gene knockdown in mammalian cells4, vectors expressing short-hairpin RNAs (shRNAs) were described that function very similar to siRNAs5-11. However, these shRNA-mediated knockdown approaches have the same limitation as conventional knockout strategies, since stable depletion is not feasible when gene targets are essential for cellular survival. To overcome this limitation, van de Wetering et al.12 modified the shRNA expression vector pSUPER5 by inserting a TO in the promoter region, which enabled them to generate stable cell lines with tetracycline-inducible depletion of their target genes of interest.
Here, we describe a method to efficiently generate stable human Tet-on cell lines that reliably drive either inducible overexpression or depletion of the gene of interest. Using this method, we have successfully generated Tet-on cell lines which significantly facilitated the analysis of the MST/hMOB/NDR cascade in centrosome13,14 and apoptosis signaling15,16. In this report, we describe our vectors of choice, in addition to describing the two consecutive manipulation steps that are necessary to efficiently generate human Tet-on cell lines (Figure 2). Moreover, besides outlining a protocol for the generation of human Tet-on cell lines, we will discuss critical aspects regarding the technical procedures and the characterization of Tet-on cells.

Generation of Stable Human Cell Lines with Tetracycline-inducible Tet-on shRNA or cDNA Expression

A rapid and simple way to generate human cell lines with inducible and reversible cDNA overexpression or shRNA-mediated knock-down of the gene of interest. This method enables researchers to reliably and highly reproducibly manipulate cell lines that are difficult to alter by transient transfection methods or conventional knockdown/knockout strategies.

테트라싸이클린-inducible (Tet-에서) shRNA 또는 cDNA 표현과 안정적인 인간 세포 라인의 생성

A major approach in  the field of mammalian cell biology is the manipulation of the expression of  genes of interest in selected cell lines, with the aim ...

Anaerobic Growth and Maintenance of Mammalian Cell Lines

Most mucosal surfaces along with the midpoints in tumors and stem cell niches are geographic areas of the body that are anoxic. Previous studies show that the incubation in normoxic (5% CO2 in air) or hypoxic (low oxygen levels) conditions followed by an anoxic incubation (an absence of free oxygen) results in limited viability (2&#8211;3 days). A novel methodology was developed that enables an anoxic cell cultivation (for at least 17 days; the maximum time tested). The most critical aspect of this methodology is to ensure that no oxygen is introduced into the system. This is obtained by the degassing of media, and by flushing tubes, dishes, flasks, and pipettes with an anaerobic gas mixture (H2, CO2, N2) followed by permitting the materials to equilibrate to the anoxic (non-oxygen) environment prior to usage.&#160;Additional care must be exercised when acquiring photomicrographs to ensure that the micrographs obtained do not contain artifacts. In the absence of oxygen, cell morphology is significantly altered. Two distinct morphotypes are noted for all anaerobically-grown cells. The ability to grow and maintain mammalian cells in the absence of oxygen can be applied to the analysis of cell physiology, polymicrobial interactions, and the characterization of biosynthetic pathways for novel cancer drug development.

Here, we describe a new method that enables the anaerobic long-term cultivation of established cell lines. The maximum survival time that was tested is 17 days. This method is suitable for the testing of cytotoxic agents and exploring the physiology of anoxically replicating cells.

혐 기성 성장 및 포유류 세포의 유지 보수

Most mucosal surfaces along with the midpoints in tumors and stem cell niches are geographic areas of the body that are anoxic. Previous studies show that ...

Silencing the Spark: CRISPR/Cas9 Genome Editing in Weakly Electric Fish

Electroreception and electrogenesis have changed in the evolutionary history of vertebrates. There is a striking degree of convergence in these independently derived phenotypes, which share a common genetic architecture. This is perhaps best exemplified by the numerous convergent features of gymnotiforms and mormyrids, two species-rich teleost clades that produce and detect weak electric fields and are called weakly electric fish. In the 50 years since the discovery that weakly electric fish use electricity to sense their surroundings and communicate, a growing community of scientists has gained tremendous insights into evolution of development, systems and circuits neuroscience, cellular physiology, ecology, evolutionary biology, and behavior. More recently, there has been a proliferation of genomic resources for electric fish. Use of these resources has already facilitated important insights with regards to the connection between genotype and phenotype in these species. A major obstacle to integrating genomics data with phenotypic data of weakly electric fish is a present lack of functional genomics tools. We report here a full protocol for performing CRISPR/Cas9 mutagenesis that utilizes endogenous DNA repair mechanisms in weakly electric fish. We demonstrate that this protocol is equally effective in both the mormyrid species Brienomyrus brachyistius and the gymnotiform Brachyhypopomus gauderio by using CRISPR/Cas9 to target indels and point mutations in the first exon of the sodium channel gene scn4aa. Using this protocol, embryos from both species were obtained and genotyped to confirm that the predicted mutations in the first exon of the sodium channel scn4aa were present. The knock-out success phenotype was confirmed with recordings showing reduced electric organ discharge amplitudes when compared to uninjected size-matched controls.

Here, a protocol is presented to produce and rear CRISPR/Cas9 genome knockout electric fish. Outlined in detail are the required molecular biology, breeding, and husbandry requirements for both a gymnotiform and a mormyrid, and injection techniques to produce Cas9-induced indel F0 larvae.

불꽃을 침묵 : 약한 전기 물고기에서 CRISPR / Cas9 게놈 편집

Electroreception and electrogenesis have changed in the evolutionary history of vertebrates. There is a striking degree of convergence in these ...

Genome Engineering of Primary Human B Cells Using CRISPR/Cas9

B cells are lymphocytes derived from hematopoietic stem cells and are a key component of the humoral arm of the adaptive immune system. They make attractive candidates for cell-based therapies because of their ease of isolation from peripheral blood, their ability to expand in vitro, and their longevity in vivo. Additionally, their normal biological function&#8212;to produce large amounts of antibodies&#8212;can be utilized to express very large amounts of a therapeutic protein, such as a recombinant antibody to fight infection, or an enzyme for the treatment of enzymopathies. Here, we provide detailed methods for isolating primary human B cells from peripheral blood mononuclear cells (PBMCs) and activating/expanding isolated B cells in vitro. We then demonstrate the steps involved in using the CRISPR/Cas9 system for site-specific KO of endogenous genes in B cells. This method allows for efficient KO of various genes, which can be used to study the biological functions of genes of interest. We then demonstrate the steps for using the CRISPR/Cas9 system together with a recombinant, adeno-associated, viral (rAAV) vector for efficient site-specific integration of a transgene expression cassette in B cells. Together, this protocol provides a step-by-step engineering platform that can be used in primary human B cells to study biological functions of genes as well as for the development of B-cell therapeutics.

Here we provide a detailed, step-by-step protocol for CRISPR/Cas9-based genome engineering of primary human B cells for gene knockout (KO) and knock-in (KI) to study biological functions of genes in B cells and the development of B-cell therapeutics.

CRISPR/Cas9를 사용하여 1차 인간 B 세포의 게놈 공학

B cells are lymphocytes derived from hematopoietic stem cells and are a key component of the humoral arm of the adaptive immune system. They make ...

TGF-&#946;-mediated Endothelial to Mesenchymal Transition (EndMT) and the Functional Assessment of EndMT Effectors using CRISPR/Cas9 Gene Editing

In response to specific external cues and the activation of certain transcription factors, endothelial cells can differentiate into a mesenchymal-like phenotype, a process that is termed endothelial to mesenchymal transition (EndMT). Emerging results have suggested that EndMT is causally linked to multiple human diseases, such as fibrosis and cancer. In addition, endothelial-derived mesenchymal cells may be applied in tissue regeneration procedures, as they can be further differentiated into various cell types (e.g., osteoblasts and chondrocytes). Thus, the selective manipulation of EndMT may have clinical potential. Like epithelial-mesenchymal transition (EMT), EndMT can be strongly induced by the secreted cytokine transforming growth factor-beta (TGF-&#946;), which stimulates the expression of so-called EndMT transcription factors (EndMT-TFs), including Snail and Slug. These EndMT-TFs then up- and downregulate the levels of mesenchymal and endothelial proteins, respectively. Here, we describe methods to investigate TGF-&#946;-induced EndMT in vitro, including a protocol to study the role of particular TFs in TGF-&#946;-induced EndMT. Using these techniques, we provide evidence that TGF-&#946;2 stimulates EndMT in murine pancreatic microvascular endothelial cells (MS-1 cells), and that the genetic depletion of Snail using clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9)-mediated gene editing, abrogates this phenomenon. This approach may serve as a model to interrogate potential modulators of endothelial biology, and can be used to perform genetic or pharmacological screens in order to identify novel regulators of EndMT, with potential application in human disease.

TGF-&amp;#946;-mediated Endothelial to Mesenchymal Transition EndMT and the Functional Assessment of EndMT Effectors using CRISPR/Cas9 Gene Editing

We describe methods to investigate TGF-&#946;2-induced EndMT in endothelial cells by observing cell morphology changes and examining the expression EndMT-related marker changes using immunofluorescence staining. CRISPR/Cas9 gene editing was described and used to deplete the gene encoding Snail to investigate its role in TGF-&#946;2-induced EndMT.

TGF-β 매개 내피- 중간엽 전환(EndMT)과 CRISPR/Cas9 유전자 편집을 사용하여 EndMT 이펙터의 기능평가

In response to specific external cues and the activation of certain transcription factors, endothelial cells can differentiate into a mesenchymal-like ...

Construction of Homozygous Mutants of Migratory Locust Using CRISPR/Cas9 Technology

The migratory locust, Locusta migratoria, is not only one of the worldwide plague locusts that caused huge economic losses to human beings but also an important research model for insect metamorphosis. The CRISPR/Cas9 system can accurately locate at a specific DNA locus and cleave within the target site, efficiently introducing double-strand breaks to induce target gene knockout or integrate new gene fragments into the specific locus. CRISPR/Cas9-mediated genome editing is a powerful tool for addressing questions encountered in locust research as well as a promising technology for locust control. This study provides a systematic protocol for CRISPR/Cas9-mediated gene knockout with the complex of Cas9 protein and single guide RNAs (sgRNAs) in migratory locusts. The selection of target sites and design of sgRNA are described in detail, followed by in vitro synthesis and verification of the sgRNAs. Subsequent procedures include egg raft collection and tanned-egg separation to achieve successful microinjection with low mortality rate, egg culture,&#160;preliminary estimation of the mutation rate, locust breeding as well as detection, preservation, and passage of the mutants to ensure population stability of the edited locusts. This method can be used as a reference for CRISPR/Cas9 based gene editing applications in migratory locusts as well as in other insects.

This study provides a systematically optimized procedure of CRISPR/Cas9 ribonuclease-based construction of homozygous locust mutants as well as a detailed method for cryopreservation and resuscitation of the locust eggs.

CRISPR/Cas9 기술을 이용한 철새 메뚜기의 동형접합 돌연변이 구축

The migratory locust, Locusta migratoria, is not only one of the worldwide plague locusts that caused huge economic losses to human beings but also an ...

CRISPR/Cas9 Gene Editing of Hematopoietic Stem and Progenitor Cells for Gene Therapy Applications

CRISPR/Cas9 is a highly versatile and efficient gene-editing tool adopted widely to correct various genetic mutations. The feasibility of gene manipulation of hematopoietic stem and progenitor cells (HSPCs) in vitro makes HSPCs an ideal target cell for gene therapy. However, HSPCs moderately lose their engraftment and multilineage repopulation potential in ex vivo culture. In the present study, ideal culture conditions are described that improves HSPC engraftment and generate an increased number of gene-modified cells in vivo. The current report displays optimized in vitro culture conditions, including the type of culture media, unique small molecule cocktail supplementation, cytokine concentration, cell culture plates, and culture density. In addition to that, an optimized HSPC gene-editing procedure, along with the validation of the gene-editing events, are provided. For in vivo validation, the gene-edited HSPCs infusion and post-engraftment analysis in mouse recipients are displayed. The results demonstrated that the culture system increased the frequency of functional HSCs in vitro, resulting in robust engraftment of gene-edited cells in vivo.

The present protocol describes an optimized hematopoietic stem and progenitor cell (HSPC) culture procedure for the robust engraftment of gene-edited cells in vivo.

유전자 치료 애플리케이션을 위한 조혈 줄기 및 전구 세포의 CRISPR/Cas9 유전자 편집

CRISPR/Cas9 is a highly versatile and efficient gene-editing tool adopted widely to correct various genetic mutations. The feasibility of gene ...

CRISPR-Cas9-Mediated Precise Knock-In Edits in Zebrafish Hearts

Clustered regularly interspaced short palindromic repeats (CRISPR) in animal models enable precise genetic manipulation for the study of physiological phenomena. Zebrafish have been used as an effective genetic model to study numerous questions related to heritable disease, development, and toxicology at the whole-organ and -organism level. Due to the well-annotated and mapped zebrafish genome, numerous tools for gene editing have been developed. However, the efficacy of generating and ease of detecting precise knock-in edits using CRISPR is a limiting factor. Described here is a CRISPR-Cas9-based knock-in approach with the simple detection of precise edits in a gene responsible for cardiac repolarization and associated with the electrical disorder, Long QT Syndrome (LQTS). This two-single-guide RNA (sgRNA) approach excises and replaces the target sequence and links a genetically encoded reporter gene. The utility of this approach is demonstrated by describing non-invasive phenotypic measurements of cardiac electrical function in wild-type and gene-edited zebrafish larvae. This approach enables the efficient study of disease-associated variants in a whole organism. Furthermore, this strategy offers possibilities for the insertion of exogenous sequences of choice, such as reporter genes, orthologs, or gene editors.

This protocol describes an approach to facilitate precise knock-in edits in zebrafish embryos using CRISPR-Cas9 technology. A phenotyping pipeline is presented to demonstrate the applicability of these techniques to model a Long QT Syndrome-associated gene variant.

CRISPR-Cas9 매개 제브라피쉬 하트의 정확한 녹인 편집

Clustered regularly interspaced short palindromic repeats (CRISPR) in animal models enable precise genetic manipulation for the study of physiological ...