건강 5T32AI7493-20과 5R01AI089337-03 부여의이 작품은 국립 연구소에 의해 부분적으로 지원되었다. 자금 제공자는 연구 설계, 자료 수집 및 분석, 게시하는 결정, 또는 원고의 준비를 전혀 역할을 없었다.

승인 된 프로토콜 번호 101109272에서 본원에 기재된 버밍엄 기관 동물 사용 및 관리위원회에서 알라바마 대학은 마우스의 사용을 승인했다. 1. 유전 건설 수정 된 플라스미드 pAd5 / H5-HVR1-KWAS-HVR5-그의 6 항원 캡시드-설립 전략 <ol><li> 셔틀 플라스미드의 건설 HVR1-KWAS-HVR5-그의 6 / pH5S <ol><li> hexon5 유전자의 AccI로 제한 효소 부위 사이 AgeI 합성 DNA 서열 HVR1-KWAS을 함유하는 플라스미드를 주문한다. </li><li> 37 ℃에서 3 시간 동안 효소 AgeI (6 단위)과 AccI (6 단위)으로 합성 된 조각 (HVR1-KWAS)의 6 μg의 다이제스트. 전기 영동에 의한 2 % 아가로 오스 겔에서 분해 단편을 해결 한 제조사의 프로토콜에 따라 DNA 겔 추출 키트 단편을 정제. </li><li> 삽입의 몰 비율을 바탕으로 3에서 벡터에 : 1, T4 DNA 리가 아제와 리가 B를 사용uffer는 이전에 구축 셔틀 플라스미드 100 NG로 조각 (HVR1-KWAS)의 12 NG를 결찰하는 HVR5-그의 6 / pH5S 2 시간 동안 실온에서 10 μL 볼륨 17, AgeI 및 AccI의 사이트를 통해. </li><li> (1800 V에서) electroporator에 electrocompetent DH5α 세포의 50 μL로 결찰 제품의 10 μL 중 1 μl를 변환. 형질 전환 된 DH5α 세포를 SOC 배지 950 μl를 넣고 300rpm으로하여, 37 ° C에서 1 시간 동안 혼합물을 배양한다. 카나마이신을 포함하는 루리아 - 베르 타니 (LB) 한천에 1 ml의 혼합물을 100 ~ 200 μl를 확산하고 37 ℃에서 O / N을 품어. <ol><li> ~ 조각 HVR1-KWAS를 대상으로 PCR 10 식민지를 화면으로, 앞으로 프라이머 (TATGTGTGTCATGTATGCGT)를 혼합 (제조사의 프로토콜에 따라) PCR 마스터 믹스 솔루션에 프라이머 (GGAGGCCCACTTGTCCAGCTC) 단일 DH5α 식민지 역. PCR 마스터 믹스 솔루션과 함께 제공되는 설명서를 참조하여 열 순환기에 샘플을 실행. </li><li> 섹션 1.1.4.1에서 상영 클론의 조각 HVR1-KWAS을 시퀀싱하는 정방향 프라이머 (TATGTGTGTCATGTATGCGT)를 사용합니다. </li></ol></li></ol></li><li> 플라스미드 pAd5 / 건설 H5-HVR1-KWAS-HVR5-그의 6 <ol><li> 다이제스트 6 μg의 HVR1-KWAS-HVR5-그의 6 / 37 ° C에서 3 시간 동안 효소를 EcoRI (6 단위)과 PmeI (6 대)와 pH5S 및 상동 재조합 무기와 이중 수정 hexon5 유전자를 포함하는 단편을 정제, 로 단계 1.1.2에 명시된. 백본 플라스미드 SwaI와 pAd5 / ΔH5 (GL) 16 선형화. </li><li> 셔틀 플라스미드에서 대상 단편 100 NG와 (1800 V에서) electroporator의 상동 재조합에 대한 electrocompetent BJ5183 세포의 50 μL에 선형화 pAd5 / ΔH5 (GL) 백본의 100 NG를 공동-변환. 형질 전환 된 세포에 SOC 매체의 950 μl를 추가하고 37 ℃, 300 rpm에서 1 시간 동안 혼합물을 품어. 1 ml의 혼합물의 200 μL - (100)를 확산37 ℃에서 O / N 항온 처리 용 카나마이신 (최종를 50㎍ / ㎖)을 함유하는 LB 한천. <ol><li> 선택 ~ 3 ㎖에 10 작은 식민지 진탕 (250 rpm으로, 37 ° C)에서 O / N 배양을위한 카나마이신 (최종 50 μg의 / ㎖)를 포함하는 액체 LB. 문화 플라스미드의 압축을 풉니 다. 단계 1.1.4.1에 도시 된 바와 같이, 단편 HVR1-KWAS을 대상으로 10 콜로니를 선별하기 위해 PCR 분석을 사용한다. </li><li> 백본 게놈의 PIX 단편을 대상으로 PCR 분석에 의해 같은 식민지를 화면으로, 앞으로 프라이머 (AGCTGTTGGATCTGCGCCAGCAGGTT)를 혼합, (제조사의 프로토콜에 따라) PCR 마스터 믹스 솔루션에 프라이머 (CCAAACAGAGTCTGGTTTTTTATTTAT) 단일 BJ5183 식민지 역. PCR 마스터 믹스 솔루션과 함께 제공되는 설명서를 참조하여 열 순환기에 샘플을 실행합니다. </li><li> pAd5 / H5-HVR1-KWAS-HVR5-그의 6으로 PCR을 두 번 긍정적 인 식민지를 지정합니다. </li></ol></li><li> 에 플라스미드 pAd5 / H5-HVR1-KWAS-HVR5-그의 6 100 NG를 변환단계 1.1.4에 도시 된 바와 같이 세포를 DH5α한다. <ol><li> 단계 1.1.4.1에 도시 된 바와 같이, 단편 HVR1-KWAS을 대상으로 10 ~ 콜로니를 선별하기 위해 PCR 분석을 사용한다. </li><li> 단계 1.2.2.2에 도시 한 바와 같이, 백본 PIX 게놈 단편을 표적으로 동일한 콜로니를 선별하기 위해 PCR 분석을 사용한다. </li><li> pAd5 / H5-HVR1-KWAS-HVR5-그의 6 조각 HVR1-KWAS을 시퀀싱하는 정방향 프라이머 (TATGTGTGTCATGTATGCGT)를 사용합니다. </li></ol></li></ol></li></ol> 수정의 Ad5 바이러스 성 벡터의 Ad5 / 2. 준비 H5-HVR1-KWAS-HVR5-그의 6 <ol><li> 고 글루코스 DMEM로 FBS (최종 10 %), 100X 비 필수 아미노산 (최종 0.1 mM)을 200 mM의 L- 글루타민 (최종 2 mM)을하고 페니실린 / 스트렙토 마이신 용액 (최종 1 %)을 첨가하여 완전한 배지를 구성 . (85 % 습윤 조건하에 37 ℃ 및 5 % CO2) 배양기에서 완전 배지에서 인간 배아 신장 (HEK293) 세포를 유지한다. </li><li> 바이러스는했습니다의 구조ctor에의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6 <ol><li> 완전 배지 및 배양 O / N 5 mL를 함유 한 T-25 플라스크에 종자 HEK293 세포를 3.0 × 106 80 %와 합류 단층을 달성했다. </li><li> 15 μg의 선형화 pAd5 / H5-HVR1-KWAS-HVR5-그의 6 3 시간 동안 37 ° C에서 제한 효소 PACI (15 대)와 100 μL 볼륨에서. <ol><li> 추출 선형화 pAd5 / H5-HVR1-KWAS-HVR5-그의 6 페놀 동량 (1 분 동안 10,000 XG) 회 반응을 원심 분리하여 클로로포름 : 내의 흄 후드 이소 아밀 알코올 (: 24 일 25시 비율) 및 혼합 된 용액 (100 % 에탄올 300 μL 및 나트륨 아세테이트 10 μL) 및 70 % 에탄올 700 μL 순차 원심 분리 (10 분 동안 10,000 XG)에 의해. 각각의 원심 분리 단계에서 상층 액을 버린다. </li></ol></li><li> 정제 된 플라스미드 ~ 증류수 또는 트리스 - EDTA (TE) 버퍼의 40 μl를 재현 탁. 광학 드를 측정함으로써 플라스미드 DNA를 정량nsity 260 nm의 (OD). </li><li> 제조업체의 설명서에 따라, T-25 플라스크 상업 ​​리포좀 형질 전환 시약과 선형화 된 플라스미드의 3 μg의를 형질. 6 시간 배양 인큐베이터에서 후 형질 전환 이후의 배양에 완전한 매체와 형질 매체를 변경합니다. 각각의 바이러스 성 플라크 형성 할 때까지, 모든 2-3일 완전한 매체를 대체하여 형질 전환 된 세포를 유지한다. </li><li> 플라크는 전체 세포 병변 효과 (CPE)를 개발할 경우, 무균 후드 플라스크 오프 나머지 세포를 긁어, 4 ° C에서 10 분 동안 300 XG에 매체를 원심 분리하여 수확 된 세포 용 해물. 2 % FBS를 함유하는 배지 ~ 1 ㎖ 중의 세포 펠렛을 일시 중단하고, 동결 - 해동 네 배 세포 파괴. 4 ℃에서 10 분 동안 10,000 XG에 해물을 원심 분리 한 후 구출 바이러스를 포함하는 상층 액을 수집합니다. </li></ol></li><li> 바이러스 벡터의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6의 대규모 전파 <ol><li> 일을 전파T-25 플라스크에서 전체 용해질을 1/3로 감염시켜 무균 후드 HEK293 세포를 포함하는 T-75 플라스크에서 E 바이러스. 전체 CPE는 문화 인큐베이터에서 2~3일 내에서 개발을 허용합니다. 단계 2.2.5에 명시된 해물 상층 액을 수확. </li><li> 바이러스 전파 환경에 따라, T-75 플라스크에서 전체 용해질 1/2로 감염시켜 무균 후드 1-3 T-175 플라스크에서 바이러스를 전파. 전체 CPE는 문화 인큐베이터에서 2~3일 내에서 개발을 허용합니다. 단계 2.2.5에 명시된 해물 상층 액을 수확. </li><li> 이전 T-175 플라스크 (들)에서 전체 해물에 1/2 감염에 의해 멸균 후드에 한 12 이상의 T-175 플라스크에 바이러스를 전파. 바이러스 전파 조건 및 필요한 바이러스의 양에 기초하여 플라스크 사용량을 결정한다. 전체 CPE는 문화 인큐베이터에서 2~3일 내에서 발생하는 경우 단계 2.2.5에 명시된 해물 상층 액을 수확. </li></ol></li><li> 을 정제세슘 클로라이드의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6 가스화 <ol><li> 5 mM의 HEPES에서 협동 학습 솔루션의 두 가지 밀도 준비 : 1.33 ml의 G / 및 1.45 ㎍ / ㎖, CSCL과의 접촉을 피하고있다. </li><li> CSCL의로드 4 ml의 멸균 초 원심 분리기 튜브 (1.33 ㎍ / ㎖), 부드럽게 튜브의 바닥에 대한 CSCL의 4 ㎖ (㎍ / ㎖ 1.45)를로드합니다. 로드 천천히 멸균 후드에 그라디언트의 상단에 해물 상층 액 4 mL를. </li><li> 결함 / 높은 바이러스 밴드에서 성숙 / 낮은 바이러스 밴드를 분리하기 위해 4 ℃에서 3 시간 동안 110,000 XG에서 튜브를 원심 분리기. 33 G 바늘로 무장 한 3 ML의 주사기를 사용하여 낮은 밴드를 수집하고 멸균 후드에 4 ml의 볼륨에 5 mM의 HEPES와 함께 밴드를 희석. </li><li> 단계 2.4.2에 기술 된 바와 같이 두 개의 협동 학습 솔루션의 밀도와 바이러스의 희석 밴드와 다른 튜브를 넣습니다. 4 ℃에서 11 만 XG의 O / N에서 튜브를 원심 분리기. 단계 2.4.3에 설명 된대로 바이러스 밴드를 수집합니다. </li><li> dialys에서 수집 된 바이러스 용액을 주사멸균 후드에 33 G 바늘로 무장 한 3 ML의 주사기에 의해 카세트입니다. </li><li> 1X 투석 완충액 700 ㎖ 중의 카세트를 배치 (1 L의 레시피 10 배 PBS 100 ㎖, 100 % 글리세롤 100 ㎖ 및 증류수 800 ㎖; 0.22 μm의 필터를 통해 버퍼를 필터링) 및 투석 버퍼를 교체 매 3 4 시간에 대한 시간. 니들 주사기를 사용하여 투석 된 바이러스 용액을 대기음. </li></ol></li></ol> 구출 바이러스 성 벡터의 3. 검증 <ol><li> 바이러스 성 벡터 적정의 <ol><li> (10)와 1 : 바이러스 물리적 역가를 들어, 바이러스 및 하나의 투석 완충액 (배경 제어) 모두 희석 바이러스 용해 완충액에서 20 (10 % SDS에서 트리스 EDTA) 작은 튜브, 및 56 ℃에서 모든 튜브 부화 10 분. </li><li> biophotometer 켜고 OD 260 nm에서 흡광도의 모드를 설정합니다. &quot;빈&quot;아래를 클릭하여 배경 신호를 균형 : 희석 투석 버퍼 (10 일)를 사용합니다. biophotometer의 SCR의 유형 &quot;10 + 90&quot;EEN 및 희석 바이러스의 신호 (10 1) 판독. </li><li> 단계 3.1.2의 방법에 따라, 대신 biophotometer 화면에서 &quot;5 + 95&quot;을 입력 : 희석 된 바이러스의 신호 (20 일)을 참조하십시오. 1.1 × 12 개의 바이러스 판독 숫자를 곱하면 두 희석에서 두 개의 개별 역가에 근거 부사장 / ㎖로 단위로 평균 역가를 계산한다. </li><li> 감염성 바이러스 역가 (IP / ㎖)을 위해 10 일 후 감염에 HEK293 세포에 감염 깊이를 결정하기 위해 통계적 KARBER TCID (50)을 사용하여 방법 14 (dpi)로 </li></ol></li><li> 바이러스 벡터에 항원 노출 디스플레이의 평가 <ol><li> 코트 ELISA 플레이트에 바이러스 벡터 및 표준 ELISA 법 (14)의 나머지 단계를 진행합니다. 통합 항원 (14)에 대응의 검출에 대한 인간의 안티 gp41 (2F5) 단일 클론 항체 (단클론 항체) 및 마우스 항 - 그의 태그 단클론 항체를 사용합니다. </li><li> denatu에 바이러스 벡터를 해결붉은 단백질 겔 전기 영동 (SDS-PAGE) 및 웨스턴 블롯 표준 방법 (14)의 나머지 단계를 진행. 통합 항원 (14)에 대응의 검출에 대한 인간의 안티 gp41 (2F5) 단일 클론 항체 (단클론 항체) 및 마우스 항 - 그의 태그 단클론 항체를 사용합니다. </li></ol></li><li> 의 Ad5-positve 혈청을 우회 할 수있는 능력에 벡터의 생체 외 평가 <ol><li> 문화 인큐베이터 (37 ° C, 5 % CO 2 85 % 미만 가습 조건)에 완전 배지에서 헬라 세포를 유지한다. FBS (최종 10 %), 200 mM의 L- 글루타민 (2 mM의 최종) 및 최소 필수 중간 이글 (MEME)로 페니실린 / 스트렙토 마이신 용액 (최종 1 %)을 첨가하여 완전한 배지를 구성한다. </li><li> 1 × 6 전지에서 6 웰 플레이트에서 씨앗 헬라 세포 / 웰, 2 시간 동안 문화 인큐베이터 (37 ° C, 5 % CO 2 85 % 미만 가습 조건)에서 번호판을 품어. (바이러스 벡터의 5 IP / 셀과의 Ad5 양성 혈청 (0.1 μL 0 μL)을 품어AD5 또는의 Ad5 / H5-HVR1-KWAS-HVR5-그의 1 시간 동안 배양 인큐베이터 6) 세포를 포함하는 6 웰 플레이트에 혼합물을 추가하기 전에. </li><li> 24 시간이 (HPI)를 감염 게시물, 용해 완충액 0.5 ㎖에 한 번 PBS와를 Lyse 세포와 세포를 씻어. 5 분 15,000 XG에 원심 분리기와 뜨는를 수집합니다. 바이러스는 루시페라아제 유전자가 포함되어 있기 때문에, 루시페라아제 신호 판독 용 루시페라아제 기질 100 ㎕와 20 ㎕의 상등액을 섞는다. </li></ol></li></ol> 구출 바이러스 성 벡터의 4. 면역 학적 평가 <ol><li> 의 Ad5과의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6 : 두 예방 접종 그룹을 준비합니다. <ol><li> 이주의 간격으로, 상동 &quot;프라임 - 부스트&quot;면역 요법에, 1 × 10 VP / 마우스에서 바이러스 근육 (N = 8 / 그룹) 마우스를 주입한다. </li><li> 2 주마다 주사를 게시에서, 동물 란셋 (5mm 팁 길이)에 출혈 뺨에 의해 마취없이 마우스를 피1.5 ml의 튜브에 혈액을 수집합니다. </li></ol></li><li> 상하 반전에 의해 튜브에 혈액을 혼합하고, 실온에서 30 분 동안 배양 한 피. 5 4 ° C에서 분, 새로운 1.5 ml의 튜브로 전송 혈청 (상단 층) 10,000 XG에서 튜브를 스핀. <ol><li> 5 4 ° C에서 최소 및 전송 혈청 10,000 XG에서 새로운 튜브를 스핀 새로 -80 ℃에서 저장을위한 1.5 ml의 튜브를 표시합니다. </li></ol></li><li> 혈청 기반 ELISA에 의한 항원 특이 체액 성 면역의 평가 <ol><li> 그의 펩타이드 (1 mM의에서 주) 및 HIV-1 펩타이드 (1 mM의에서 주) 별도로 100에 희석. </li><li> mM의 탄산 완충액 (pH 9.5)의 10 μM에서 펩티드 코팅 농도를 달성한다. 코트 별도로 4 ℃에서 판 O / N을 잘 당 100 μL를 추가하고 배양에 의해 희석 된 펩티드와 ELISA 플레이트. </li><li> PBST 5 % BSA에서 1 시간 동안 200 / μL 잘 블록에서 네 번 PBST로 접시를 씻으십시오. 1 판에 마우스 혈청을 적용 : 100 희석을 차단 버피에FER, 100 μL / 웰. 실온에서 2 시간 배양을 위해 품어. </li><li> 사 회 PBST로 접시를 씻으십시오. / 웰 100 μL의 블로킹 완충액에서 실온에서 30 분 동안 배양함으로써 플레이트를 차단. </li><li> 100 μL에서 / 잘 개별적으로 그의 펩타이드 및 HIV-1 펩티드로 코팅 된 플레이트에 모두 : (차단 버퍼에 5000 1) 염소 항 - 마우스 IgG-HRP를 적용합니다. 실온에서 2 시간 동안 품어. PBST로 접시를 씻으십시오. </li><li> 30 분 동안 HRP 기판에 배양 한 후 OD450의 nm에서 번호판을 읽어보십시오. </li></ol></li></ol>

<ol>
	<li>Cheng, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coexpression+of+the+simian+immunodeficiency+virus+Env+and+Rev+proteins+by+a+recombinant+human+adenovirus+host+range+mutant.">Coexpression of the simian immunodeficiency virus Env and Rev proteins by a recombinant human adenovirus host range mutant.</a> Journal of virology. 66, 6721-6727 (1992).</li><li>Matthews, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+antigen+incorporation+within+adenovirus+hexon+hypervariable+2+for+a+novel+HIV+vaccine+approach.">HIV antigen incorporation within adenovirus hexon hypervariable 2 for a novel HIV vaccine approach.</a> PloS one. 5, e11815 (2010).</li><li>DeMatteo, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-lasting+adenovirus+transgene+expression+in+mice+through+neonatal+intrathymic+tolerance+induction+without+the+use+of+immunosuppression.">Long-lasting adenovirus transgene expression in mice through neonatal intrathymic tolerance induction without the use of immunosuppression.</a> Journal of virology. 71, 5330-5335 (1997).</li><li>Gu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+recombinant+adenovirus-based+vector+elicits+a+specific+humoral+immune+response+against+the+V3+loop+of+HIV-1+gp120+in+mice+through+the+'Antigen+Capsid-Incorporation'+strategy.">A recombinant adenovirus-based vector elicits a specific humoral immune response against the V3 loop of HIV-1 gp120 in mice through the 'Antigen Capsid-Incorporation' strategy.</a> Virology journal. 11, 112 (2014).</li><li>Matthews, Q. L., Krendelchtchikov, A. L. G., Li, Z. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+Vectors+for+Vaccine+Development.">Viral Vectors for Vaccine Development.</a> INTECH. , (2013).</li><li>Tang, D. C., Zhang, J., Toro, H., Shi, Z., Van Kampen, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+as+a+carrier+for+the+development+of+influenza+virus-free+avian+influenza+vaccines.">Adenovirus as a carrier for the development of influenza virus-free avian influenza vaccines.</a> Expert review of vaccines. 8, 469-481 (2009).</li><li>Flatt, J. W., Kim, R., Smith, J. G., Nemerow, G. R., Stewart, P. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+intrinsically+disordered+region+of+the+adenovirus+capsid+is+implicated+in+neutralization+by+human+alpha+defensin+5.">An intrinsically disordered region of the adenovirus capsid is implicated in neutralization by human alpha defensin 5.</a> PloS one. 8, e61571 (2013).</li><li>Bradley, R. R., Lynch, D. M., Iampietro, M. J., Borducchi, E. N., Barouch, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+serotype+5+neutralizing+antibodies+target+both+hexon+and+fiber+following+vaccination+and+natural+infection.">Adenovirus serotype 5 neutralizing antibodies target both hexon and fiber following vaccination and natural infection.</a> Journal of virology. 86, 625-629 (2012).</li><li>Zaiss, A. K., Machado, H. B., Herschman, H. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+influence+of+innate+and+pre-existing+immunity+on+adenovirus+therapy.">The influence of innate and pre-existing immunity on adenovirus therapy.</a> Journal of cellular biochemistry. 108, 778-790 (2009).</li><li>Sumida, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neutralizing+antibodies+and+CD8++T+lymphocytes+both+contribute+to+immunity+to+adenovirus+serotype+5+vaccine+vectors.">Neutralizing antibodies and CD8+ T lymphocytes both contribute to immunity to adenovirus serotype 5 vaccine vectors.</a> Journal of virology. 78, 2666-2673 (2004).</li><li>Sumida, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neutralizing+antibodies+to+adenovirus+serotype+5+vaccine+vectors+are+directed+primarily+against+the+adenovirus+hexon+protein.">Neutralizing antibodies to adenovirus serotype 5 vaccine vectors are directed primarily against the adenovirus hexon protein.</a> Journal of immunology. 174, 7179-7185 (2005).</li><li>Bradley, R. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+serotype+5-specific+neutralizing+antibodies+target+multiple+hexon+hypervariable+regions.">Adenovirus serotype 5-specific neutralizing antibodies target multiple hexon hypervariable regions.</a> Journal of virology. 86, 1267-1272 (2012).</li><li>Gahery-Segard, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+response+to+recombinant+capsid+proteins+of+adenovirus+in+humans:+antifiber+and+anti-penton+base+antibodies+have+a+synergistic+effect+on+neutralizing+activity.">Immune response to recombinant capsid proteins of adenovirus in humans: antifiber and anti-penton base antibodies have a synergistic effect on neutralizing activity.</a> Journal of virology. 72, 2388-2397 (1998).</li><li>Gu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+multivalent+adenoviral+vectors+for+HIV+vaccination.">Using multivalent adenoviral vectors for HIV vaccination.</a> PloS one. 8, e60347 (2013).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protection+against+enterovirus+71+with+neutralizing+epitope+incorporation+within+adenovirus+type+3+hexon.">Protection against enterovirus 71 with neutralizing epitope incorporation within adenovirus type 3 hexon.</a> PloS one. 7, e41381 (2012).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+adenovirus+serotype+5+packaged+by+serotype+3+hexon.">Construction and characterization of adenovirus serotype 5 packaged by serotype 3 hexon.</a> Journal of virology. 76, 12775-12782 (2002).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+sites+in+adenovirus+hexon+for+foreign+peptide+incorporation.">Identification of sites in adenovirus hexon for foreign peptide incorporation.</a> Journal of virology. 79, 3382-3390 (2005).</li><li>Qiu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype-specific+neutralizing+antibody+epitopes+of+human+adenovirus+type+3+(HAdV-3)+and+HAdV-7+reside+in+multiple+hexon+hypervariable+regions.">Serotype-specific neutralizing antibody epitopes of human adenovirus type 3 (HAdV-3) and HAdV-7 reside in multiple hexon hypervariable regions.</a> Journal of. 86, 7964-7975 (2012).</li><li>Parker, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fine+definition+of+the+epitope+on+the+gp41+glycoprotein+of+human+immunodeficiency+virus+type+1+for+the+neutralizing+monoclonal+antibody+2F5.">Fine definition of the epitope on the gp41 glycoprotein of human immunodeficiency virus type 1 for the neutralizing monoclonal antibody 2F5.</a> Journal of virology. 75, 10906-10911 (2001).</li><li>Farrow, A. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunization+with+Hexon+Modified+Adenoviral+Vectors+Integrated+with+gp83+Epitope+Provides+Protection+against+Trypanosoma+cruzi+Infection.">Immunization with Hexon Modified Adenoviral Vectors Integrated with gp83 Epitope Provides Protection against Trypanosoma cruzi Infection.</a> PLoS neglected tropical diseases. 8, e3089 (2014).</li><li>Krause, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitopes+expressed+in+different+adenovirus+capsid+proteins+induce+different+levels+of+epitope-specific+immunity.">Epitopes expressed in different adenovirus capsid proteins induce different levels of epitope-specific immunity.</a> Journal of virology. 80, 5523-5530 (2006).</li><li>Omori, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+a+fiber+protein+in+an+adenovirus+vector+improves+in+vitro+gene+transfer+efficiency+to+the+mouse+microglial+cell+line.">Modification of a fiber protein in an adenovirus vector improves in vitro gene transfer efficiency to the mouse microglial cell line.</a> Neuroscience letters. 324, 145-148 (2002).</li><li>Dmitriev, I. P., Kashentseva, E. A., Curiel, D. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+adenovirus+vectors+containing+heterologous+peptide+sequences+in+the+C+terminus+of+capsid+protein+IX.">Engineering of adenovirus vectors containing heterologous peptide sequences in the C terminus of capsid protein IX.</a> Journal of virology. 76, 6893-6899 (2002).</li><li>Xue, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+a+recombinant+human+adenovirus+type+3+vector+containing+two+foreign+neutralizing+epitopes+in+hexon.">Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon.</a> Virus research. 183, 67-74 (2014).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+human+adenovirus+serotype+3+packaged+by+serotype+7+hexon.">Construction and characterization of human adenovirus serotype 3 packaged by serotype 7 hexon.</a> Virus research. 160, 214-220 (2011).</li><li>Kim, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+adenovirus+vector+incorporating+carbohydrate+binding+domains+utilizes+glycans+for+gene+transfer.">An adenovirus vector incorporating carbohydrate binding domains utilizes glycans for gene transfer.</a> PloS one. 8, e55533 (2013).</li><li>Vasconcelos, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen-induced+proapoptotic+phenotype+and+high+CD95+(Fas)+expression+accompany+a+suboptimal+CD8++T-cell+response:+reversal+by+adenoviral+vaccine.">Pathogen-induced proapoptotic phenotype and high CD95 (Fas) expression accompany a suboptimal CD8+ T-cell response: reversal by adenoviral vaccine.</a> PLoS pathogens. 8, e1002699 (2012).</li><li>Matthews, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+incorporation+of+a+herpes+simplex+virus+type+1+thymidine+kinase+and+firefly+luciferase+fusion+into+the+adenovirus+protein+IX+for+functional+display+on+the+virion.">Genetic incorporation of a herpes simplex virus type 1 thymidine kinase and firefly luciferase fusion into the adenovirus protein IX for functional display on the virion.</a> Molecular imaging. 5, 510-519 (2006).</li></ol>

저자가 공개하는 게 없다.

백신의 개발을위한 변형 된 Ad5에 전통적인 유전자 전략의 애플리케이션은 주로 기인 된 Ad5 PEI 4,6-와 연관된 병목 감소되었다. 이 병목 현상은 부분적으로이 전략의 Ad5 NABS에 의해 중화을 회피 할 수 있기 때문에 항원 - 중 - 관심의 Ad5의 중화 에피토프를 대체하여, 다른 항원 캡시드-설립 전략 (그림 1A)의 응용 프로그램에 의해 감소하고, 강력한 면역의 생성을 촉진 할 수있다 ?...

인간 아데노 바이러스 (AD)는 이중 가닥 DNA 게놈을 포함하는 뉴 클레오 캡시드 면체와 중형, 비 - 외피 바이러스이다. 광고는 일곱 그룹으로 분류 (G 통해)와, 아데노 바이러스 제품군에 속한다. 각 그룹은 다른 혈청 형의 바이러스가 포함되어 있습니다. 그룹 C에서, 아데노 바이러스, 이는 혈청 형 5의 (의 Ad5)의 가장 광범위하게 연구되어 왔으며 가장 널리 유전자 치료 백신과 같은 벡터화에 대한 적용 방법. 전통적인 유전자 전략 개발 및 유전자의 관심을 가진 바이러스 초기 유전자의 변위 특징으로 된 Ad5 변형, 적용, 및 유전자의 관심 숙주에서의 발현 집중되었다. 예를 들면 유인원 면역 결핍 바이러스 1 회전 유전자 초기 유전자 3 (E3)을 대체하여 pENV9 / Ad5hrΔE3의 건설이다, 인간 면역 결핍의 개그 유전자 초기 유전자 1 (E1)을 대체하여 AdCMVGag의 건설바이러스 (HIV) 2, 락 Z 유전자 3 (E1)를 교체하여 광고 락 Z의 건설. 의 Ad5에 전통적인 유전자 전략의 광범위한 애플리케이션은 다음의 장점에 의존의 Ad5, 바이러스 및 바이러스 증식에 가능한 유전자 공학, 외래 유전자 삽입의 대형 숙박 시설과의 Ad5 4,5의 안전을 위해 호스트 다양한. 그러나,이 전략을 이용하여 벡터화 된 Ad5-임상 치료의 감소는 효능의 Ad5 어린이와 어른의 4,6- 중 대다수 만연해 때문에, 주로의 Ad5 PEI과 연관 매핑 된 주요 병목왔다. 의 Ad5의 주요 병목 현상을 극복하기 위해, 주요 목적은 PEI의 Ad5를 우회 대체 전략을 개발하는 것이다. 이러한 중화 항체 (NABS) 8-10 및 CD8 + T 세포 반응 등의 선천성 면역 7, 적응 면역이의 Ad5에 대하여 (10)는 공동 것으로 나타났다의 Ad5 NABS가의 Ad5 PEI 10, 11에 기여에서 지배적 인 역할을 할 것으로 나타나는으로의 Ad5 PEI에 ntribute. 또한,의 Ad5의 주요 단백질 hexon, 섬유 및 펜톤 기본 포함 캡시드 단백질에있는 대상 에피토프를, NABS. 그중 hexon는의 Ad5 NABS 8,11-13의 주요 대상입니다. 이러한 발견에 기초하여, 혁신적인 캡시드 항원 혼입 전략이 도입되었다. 이 새로운 전략은 NABS하고 효율적인의 Ad5 벡터 행정에 의해 감소​​ 된 인식으로 이어지는, 단백질-의 관심의 Ad5 중화 에피토프를 이동 또는 마스크의 Ad5 캡시드 단백질에의 교체 또는 통합을 강조한다. 그것은 또한 호스트가 직접 면역 시스템 4,14,15 항원에 관심 - 제시하여 강력한 체액 성 면역 및 세포 면역 효능을 유도 할 수 있기 때문에 도움이 전략이 경쟁력 있음을 주목할 만하다. 이러한 전략에 기초하여, 분자 클로닝 및 재조합 바이러스 벡터 광고 구조는 구조적으로 분할 될 수있다네 가지 주요 단계로, (a) 중 중합 효소 연쇄 반응 (PCR) 또는 합성에 의해 유전자의 관심 단편의 제조; (b) 아데노 백본 유전자 단편의 관심과 상 동성 암을 포함하는 셔틀 플라스미드 내로 유전자 단편의 라이 게이션; (c)에 의한 상동 재조합 공동 바뀌는 선형화 된 플라스미드 백본 pAd5 / ΔH5 (GL) 16 유전자의 관심 단편을 포함하는 셔틀 플라스미드; (D) 선형화 재조합 아데노 바이러스 플라스미드의 형질은 항원 - 중 - 관심 통합 재조합 광고 벡터를 구출한다. 우리 그룹과 일부 다른 사람은 다른 감염성 병원균에 대한 광고 벡터화 백신 개발이 대안 광고의 통합 전략을 드리고 있습니다. 우리는 재조합 광고 벡터의 생성을보고 광고 - HVR1-LGS-자신의 Ad5의 hexon (hexon5)의 HVR1 로케일로 그의 태그가 HIV-1 항원 (V3)을 통합하여 6 -V3. 이 생성 된 벡터는 STR 트리거V3 에피토프 4 특정 옹 체액 성 면역 반응. 우리는 또한 hexon5 2의 HVR2 로케일로 HIV-1 막 인접 ectodomain 영역 (MPER)를 통합하여의 Ad5 / HVR2-MPER-L15ΔE1의 개발을보고했다. 또한, 닥터 서주의 그룹 애드 혈청 형 3 (AD3) 벡터화 백신, 즉. 개발이 광고 혼입 전략의 장점을 사용한, AD3의 HVR1으로 엔테로 바이러스 71의 중화 에피토프 SP70을 통합하여 바이러스 벡터 R1SP70A3의 세대 hexon (hexon3). R1SP70A3은 엔테로 바이러스 (71) 도전 (15)에 대한 보호의 높은 비율로 이어질 에피토프 SP70에 특정 강한 NABS 및 IFN-γ 생산을 생성. 기술 참조의 목적을 위해, 우리의 연구는 HVR1에 HIV-1 항원을 통합하여 가의의 Ad5 벡터의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6의 생성에 초점을 질적 항원 캡시드-설립 전략을 이용했다다 hexon5의 HVR5에 자신의 태그입니다. 생성 된 바이러스 벡터는 또한 면역 학적으로 평가 하였다. 항원 캡시드-설립 전략은 다른 감염성 질병에 대한의 Ad5-벡터화 예방 접종 방법의 발전으로 활용 될 수있다.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>1x DPBS</td>
			<td>Thermo Scientific</td>
			<td>SH30256.01</td>
			<td>for cell spliting&#160;</td>
		</tr>
		<tr>
			<td>10x DPBS</td>
			<td>Thermo Scientific</td>
			<td>SH30378.02</td>
			<td>for dialysis buffer preparation</td>
		</tr>
		<tr>
			<td>glycerol</td>
			<td>SIGMA</td>
			<td>G5516-1L</td>
			<td>for dialysis buffer preparation</td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>BIO-RAD</td>
			<td>161-0301</td>
			<td>for virus lysis buffer preparation</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Thermo Scientific</td>
			<td>SH30910.03</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>100X Non-Essential Amino Acids&#160;</td>
			<td>Thermo Scientific</td>
			<td>SH30238.01</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>200mM/L L-glutamine</td>
			<td>Cellgro</td>
			<td>25-005-CI</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>penicillin/streptomycin solution&#160;</td>
			<td>Cellgro</td>
			<td>30-002-CI</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>DMEM with high glucose</td>
			<td>Thermo Scientific</td>
			<td>SH30081.01</td>
			<td>for HEK293 cell culture</td>
		</tr>
		<tr>
			<td>Minimum Essential Medium Eagle</td>
			<td>SIGMA</td>
			<td>M5650</td>
			<td>for HeLa cell culture</td>
		</tr>
		<tr>
			<td>phenol:chloroform:isoamyl alcohol&#160;</td>
			<td>SIGMA</td>
			<td>P3803-100ML</td>
			<td>for large size of DNA purification</td>
		</tr>
		<tr>
			<td>cesium chloride&#160;</td>
			<td>Research Products International Corp.</td>
			<td>C68050</td>
			<td>for virus purificiation</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Cellgro</td>
			<td>25-060-CI</td>
			<td>for CsCl solution preparation</td>
		</tr>
		<tr>
			<td>HEK293</td>
			<td>ATCC</td>
			<td>51-0036</td>
			<td>for virus rescue and upscale</td>
		</tr>
		<tr>
			<td>HeLa</td>
			<td>ATCC</td>
			<td>CCL-2</td>
			<td>for neutralization assay</td>
		</tr>
		<tr>
			<td>T-25 flask</td>
			<td>Thermo Scientific</td>
			<td>156367</td>
			<td>for cell culture&#160;</td>
		</tr>
		<tr>
			<td>T-75 flask</td>
			<td>CORNING</td>
			<td>430641</td>
			<td>for cell culture&#160;</td>
		</tr>
		<tr>
			<td>T-175 flask</td>
			<td>Thermo Scientific</td>
			<td>159910</td>
			<td>for cell culture&#160;</td>
		</tr>
		<tr>
			<td>Ultracentrifuge</td>
			<td>BECKMAN</td>
			<td>NA</td>
			<td>for virus purification</td>
		</tr>
		<tr>
			<td>Ultracentrifuge tube</td>
			<td>BECKMAN</td>
			<td>344059</td>
			<td>for virus purification</td>
		</tr>
		<tr>
			<td>dialysis cassette&#160;</td>
			<td>Thermo Scientific</td>
			<td>66380</td>
			<td>for virus dialysis</td>
		</tr>
		<tr>
			<td>ELISA plate</td>
			<td>Thermo Scientific</td>
			<td>442404</td>
			<td>for ELISA</td>
		</tr>
		<tr>
			<td>human anti-gp41 (2F5) mAb</td>
			<td>NIH AIDS Reagent Program</td>
			<td>1475</td>
			<td>for immunological assays</td>
		</tr>
		<tr>
			<td>mouse anti-His tag mAb</td>
			<td>GenScript</td>
			<td>A00186</td>
			<td>for immunological assays</td>
		</tr>
		<tr>
			<td>SOC medium</td>
			<td>CORNING</td>
			<td>46-003-CR</td>
			<td>for transformation</td>
		</tr>
		<tr>
			<td>PCR master mix solution</td>
			<td>QIAGEN</td>
			<td>201445</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Animal lancet (point length at 5mm)</td>
			<td>MEDIpoint</td>
			<td></td>
			<td>for mice bleeding&#160;</td>
		</tr>
		<tr>
			<td>Biophotometer</td>
			<td>Eppendorf</td>
			<td></td>
			<td>for virus physical titer titration</td>
		</tr>
	</tbody>
</table>

utilizing the antigen capsid-incorporation strategy for the development of adenovirus serotype 5-vectored vaccine approaches

아데노 바이러스 혈청 형 5 (의 Ad5)를 광범위하게 백신 개발을위한 기존의 형질 전환 방법으로 수정되었습니다. 임상 시험 전통적으로 이러한 변형 된 Ad5 벡터의 감소 효능은 주로 인구 중 대다수의 Ad5 기존 면역성 (PEI)과 상관 될 수있다. 의 Ad5 PEI의 우려를 해결하여의 Ad5-벡터화 백신 개발을 촉진하기 위해, 혁신적인 항원 캡시드-설립 전략은 사용되어왔다. 이 전략의 장점으로, 우리가 처음 hexon 셔틀 건설의 Ad5가-벡터화 플라스미드 HVR1-KWAS-HVR5 - 그 이전에 건설 셔틀 플라스미드 HVR5-그의 6 / pH5S에 가변 영역 (HVR) hexon의 1 서브 클로닝하여 6 / pH5S, 그의 6 태그 HVR5에 통합했다있다. HIV 에피토프를 함유 ELDKWAS HVR1이 DNA 단편을 합성 하였다. HVR1-KWAS-HVR5-그의 6 / pH5S 후 선형 및 선형 백본 플라스미드 pAd5 / ΔH5 (GL)와 공동으로 형질 전환상동 재조합합니다. pAd5가 / H5는-HVR1이-KWAS-HVR5이-그의 6 세포로 형질 전환 된이 재조합 플라스미드는 바이러스 벡터의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6을 생성합니다. 이 벡터는 실제 바이러스 역가 (VP / ㎖)로 표시 질적 니스 전염성 역가 (IP / ㎖) 및 대응 VP / IP 비율을 갖도록 검증 하였다. 모두 HIV 에피토프와 그의 6 태그는 표면에 노출 된 Ad5 캡시드에 있었고, 자신의 에피토프 특정 항원을 유지했다. 중화 분석은 시험 관내에서의 Ad5 양성 혈청에 의해 중화를 우회하기 위해이 가의 벡터의 능력을 나타내었다. 마우스 예방 접종은 HIV 에피토프 6 그분에 강력한 체액 성 면역 특정의 생성을 보여 주었다. 이 원리 증명 연구 캡시드 항원 혼입 전략과 연관된 프로토콜을 실행 가능하게 상이한 캡시드 단백질을 수정의 Ad5-벡터화 백신의 생성을 위해 이용 될 수 있다고 제안했다. 이 프로토콜은 심지어 수 f를urther 희토류 혈청 형 아데노 - 벡터화 백신의 생성을위한 개질.

캡시드 항원 혼입 전략 (도 1a)은 이가의 Ad5 바이러스 벡터의 Ad5 / H5-HVR1-KWAS-HVR5 그의-6를 생성하는데 이용되었다. 첫째, 셔틀 플라스미드 HVR1-KWAS-HVR5-그의 6 / pH5S가 이전 건설 셔틀 플라스미드 HVR5-그의 6 / pH5S 17에 HVR1-KWAS 단편을 서브 클로닝에 의해 건설되었다. 둘째, 플라스미드 pAd5 / H5-HVR1-KWAS-HVR5-그의 6 (14) &quot;를 EcoRI-HVR1-KWAS-HVR5-을 Hi...

Watch this Scientific Journal Video about Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches at JoVE.com

Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

여기서는 원리 증명 가의 아데노 바이러스 타입 5 (의 Ad5) 벡터를 생성하는 프로토콜을 제시의 Ad5 / H5-HVR1-KWAS HVR5-6-그의 항원 캡시드 혼입 전략을 이용하여. 이 벡터는 성적 체력을 나타내는 것으로 입증되었다, 기능은 통합 항원의 Ad5 양성 시험관 내에서 혈청 및 항원뿐만 아니라 면역 원성을 탈출.

아데노 바이러스 혈청 형 5 된 벡터 백신 접근 방법의 개발을위한 항원 캡시드-설립 전략을 활용

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these ...

utilizing-antigen-capsid-incorporation-strategy-for-development

Research

JoVE Journal

Immunology and Infection

10.3K 조회수.  University of Alabama at Birmingham.  여기서는 원리 증명 가의 아데노 바이러스 타입 5 (의 Ad5) 벡터를 생성하는 프로토콜을 제시의 Ad5 / H5-HVR1-KWAS HVR5-6-그의 항원 캡시드 혼입 전략을 이용하여. 이 벡터는 성적 체력을 나타내는 것으로 입증되었다, 기능은 통합 항원의 Ad5 양성 시험관 내에서 혈청 및 항원뿐만 아니라 면역 원성을 탈출. 

비디오: Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Efficient Recombinant Parvovirus Production with the Help of Adenovirus-derived Systems

Rodent parvoviruses (PV) such as rat H-1PV and MVM, are small icosahedral, single stranded, DNA viruses. Their genome includes two promoters P4 and P38 which regulate the expression of non-structural (NS1 and NS2) and capsid proteins (VP1 and VP2) respectively1. They attract high interest as anticancer agents for their oncolytic and oncosuppressive abilities while being non-pathogenic for humans2. NS1 is the major effector of viral cytotoxicity3. In order to further enhance their natural antineoplastic activities, derivatives from these vectors have been generated by replacing the gene encoding for the capsid proteins with a therapeutic transgene (e.g. a cytotoxic polypeptide, cytokine, chemokine, tumour suppressor gene etc.)4. The recombinant parvoviruses (recPVs) vector retains the NS1/2 coding sequences and the PV genome telomeres which are necessary for viral DNA amplification and packaging. Production of recPVs occurs only in the producer cells (generally HEK293T), by co-transfecting the cells with a second vector (pCMV-VP) expressing the gene encoding for the VP proteins (Fig. 1)4. The recPV vectors generated in this way are replication defective. Although recPVs proved to possess enhanced oncotoxic activities with respect to the parental viruses from which they have been generated, their production remains a major challenge and strongly hampers the use of these agents in anti-cancer clinical applications.
We found that introduction of an Ad-5 derived vector containing the E2a, E4(orf6) and the VA RNA genes (e.g. pXX6 plasmid) into HEK293T improved the production of recPVs by more than 10 fold in comparison to other protocols in use. Based on this finding, we have constructed a novel Ad-VP-helper that contains the genomic adenoviral elements necessary to enhance recPVs production as well as the parvovirus VP gene unit5. The use of Ad-VP-helper, allows production of rec-PVs using a protocol that relies entirely on viral infection steps (as opposed to plasmid transfection), making possible the use of cell lines that are difficult to transfect (e.g. NB324K) (Fig. 2). We present a method that greatly improves the amount of recombinant virus produced, reducing both the production time and costs, without affecting the quality of the final product5. In addition, large scale production of recPV (in suspension cells and bioreactors) is now conceivable.

Here we describe a protocol based only on cell infection, which improves the efficiency of recombinant parvovirus production by more than 100 fold in comparison to other protocols in use. This protocol relies on the use of a novel adenovirus 5-based helper containing the parvovirus VP transcription unit (Ad-VP).

아데노 바이러스 파생 시스템의 도움으로 효율적인 재조합 파르 보 바이러스 생산

Rodent parvoviruses (PV) such as rat H-1PV and MVM, are small icosahedral, single stranded, DNA viruses. Their genome includes two promoters P4 and P38 ...

연구

면역학 및 감염병학

Generation of Recombinant Arenavirus for Vaccine Development in FDA-Approved Vero Cells

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field 4. The use of cell-based arenavirus minigenome systems together with the ability to generate recombinant infectious arenaviruses with predetermined mutations in their genomes has facilitated the investigation of the contribution of viral determinants to the different steps of the arenavirus life cycle, as well as virus-host interactions and mechanisms of arenavirus pathogenesis 1, 3, 11 . In addition, the development of trisegmented arenaviruses has permitted the use of the arenavirus genome to express additional foreign genes of interest, thus opening the possibility of arenavirus-based vaccine vector applications 5 . Likewise, the development of single-cycle infectious arenaviruses capable of expressing reporter genes provides a new experimental tool to improve the safety of research involving highly pathogenic human arenaviruses 16 . The generation of recombinant arenaviruses using plasmid-based reverse genetics techniques has so far relied on the use of rodent cell lines 7,19 , which poses some barriers for the development of Food and Drug Administration (FDA)-licensed vaccine or vaccine vectors. To overcome this obstacle, we describe here the efficient generation of recombinant arenaviruses in FDA-approved Vero cells.

Rescue of recombinant arenaviruses from cloned cDNAs, an approach referred to as reverse genetics, allows researchers to investigate the role of specific viral gene products, as well as the contribution of their different specific domains and residues, to many different aspects of the biology of arenavirus. Likewise, reverse genetics techniques in FDA-approved cell lines (Vero) for vaccine development provides novel possibilities for the generation of effective and safe vaccines to combat human pathogenic arenaviruses.

FDA 승인 베로 세포 백신 개발을위한 재조합 Arenavirus의 생성

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field  4. The use of cell-based ...

Using Click Chemistry to Measure the Effect of Viral Infection on Host-Cell RNA Synthesis

Many RNA viruses have evolved the ability to inhibit host cell transcription as a means to circumvent cellular defenses. For the study of these viruses, it is therefore important to have a quick and reliable way of measuring transcriptional activity in infected cells. Traditionally, transcription has been measured either by incorporation of radioactive nucleosides such as 3H-uridine followed by detection via autoradiography or scintillation counting, or incorporation of halogenated uridine analogs such as 5-bromouridine (BrU) followed by detection via immunostaining. The use of radioactive isotopes, however, requires specialized equipment and is not feasible in a number of laboratory settings, while the detection of BrU can be cumbersome and may suffer from low sensitivity.
The recently developed click chemistry, which involves a copper-catalyzed triazole formation from an azide and an alkyne, now provides a rapid and highly sensitive alternative to these two methods. Click chemistry is a two step process in which nascent RNA is first labeled by incorporation of the uridine analog 5-ethynyluridine (EU), followed by detection of the label with a fluorescent azide. These azides are available as several different fluorophores, allowing for a wide range of options for visualization.
This protocol describes a method to measure transcriptional suppression in cells infected with the Rift Valley fever virus (RVFV) strain MP-12 using click chemistry. Concurrently, expression of viral proteins in these cells is determined by classical intracellular immunostaining. Steps 1 through 4 detail a method to visualize transcriptional suppression via fluorescence microscopy, while steps 5 through 8 detail a method to quantify transcriptional suppression via flow cytometry. This protocol is easily adaptable for use with other viruses.

This method describes the use of click chemistry to measure changes in host cell transcription after infection with the Rift Valley fever virus (RVFV) strain MP-12. Results can be visualized qualitatively via fluorescence microscopy or obtained quantitatively through flow cytometry. This method is adaptable for use with other viruses.

호스트 세포 RN​​A의 합성에 바이러스 감염의 효과를 측정하는 클릭 화학을 사용하여

Many RNA viruses have evolved the ability to inhibit host cell transcription as a means to circumvent cellular defenses. For the study of these viruses, ...

In Vitro Analysis of Myd88-mediated Cellular Immune Response to West Nile Virus Mutant Strain Infection

An attenuated West Nile virus (WNV), a nonstructural (NS) 4B-P38G mutant, induced higher innate cytokine and T cell responses than the wild-type WNV in mice. Recently, myeloid differentiation factor 88 (MyD88) signaling was shown to be important for initial T cell priming and memory T cell development during WNV NS4B-P38G mutant infection. In this study, two flow cytometry-based methods &#8211; an in vitro T cell priming assay and an intracellular cytokine staining (ICS) &#8211; were utilized to assess dendritic cells (DCs) and T cell functions. In the T cell priming assay, cell proliferation was analyzed by flow cytometry following co-culture of DCs from both groups of mice with carboxyfluorescein succinimidyl ester (CFSE) - labeled CD4+ T cells of OTII transgenic mice. This approach provided an accurate determination of the percentage of proliferating CD4+ T cells with significantly improved overall sensitivity than the traditional assays with radioactive reagents. A microcentrifuge tube system was used in both cell culture and cytokine staining procedures of the ICS protocol. Compared to the traditional tissue culture plate-based system, this modified procedure was easier to perform at biosafety level (BL) 3 facilities. Moreover, WNV- infected cells were treated with paraformaldehyde in both assays, which enabled further analysis outside BL3 facilities. Overall, these in vitro immunological assays can be used to efficiently assess cell-mediated immune responses during WNV infection.

In Vitro Analysis of Myd88-mediated Cellular Immune Response to West Nile Virus Mutant Strain Infection

Two flow cytometry-based methods &#8211; an in vitro T cell priming assay and intracellular cytokine staining were utilized to measure antigen presenting capacity of dendritic cells and antigen-specific T cell responses to a West Nile virus mutant infection in mice.

웨스트 나일 바이러스 돌연변이 균주의 감염에에서 MyD88 매개 세포 면역 반응의 생체 외 분석

An attenuated West Nile virus (WNV), a nonstructural (NS) 4B-P38G mutant, induced higher innate cytokine and T cell responses than the wild-type WNV in ...

Detection of Human Leukocyte Antigen Biomarkers in Breast Cancer Utilizing Label-free Biosensor Technology

According to the American Cancer Society, more than 200,000 women will be diagnosed with invasive breast cancer each year and approximately 40,000 will die from the disease. The human leukocyte antigen (HLA) class I samples peptides derived from proteasomal degradation of cellular proteins and presents these fragments on the cell surface for interrogation by circulating cytotoxic T lymphocytes (CTL). Generation of T-cell receptor mimic (TCRm) monoclonal antibodies (mAbs) which recognize breast cancer specific peptide/HLA-A*02:01 complexes such as those derived from macrophage migration inhibitory factor (MIF19-27) and NY-ESO-1157-165 enable detection and destruction of breast cancer cells in the absence of an effective anti-tumor CTL response. Intact class I HLA/peptide complexes are shed by breast cancer cells and represent potentially relevant cancer biomarkers. In this work, a breakthrough biomarker screening system for cancer diagnostics incorporating T-cell receptor mimic monoclonal antibodies combined with a novel, label-free biosensor utilizing guided-mode resonance (GMR) sensor technology is presented. Detection of shed MIF/HLA-A*02:01 complexes in MDA-MB-231 cell supernatants, spiked human serum, and patient plasma is demonstrated. The impact of this work could revolutionize personalized medicine through development of companion disease diagnostics for targeted immunotherapies.

Intact class I HLA/peptide complexes are shed by cancer cells, representing a potential relevant cancer biomarker. Utilizing label-free sensor technology and T-cell receptor mimicking monoclonal antibodies, detection of shed MIF/HLA-A*02:01 complexes in MDA-MB-231 cell supernatants, spiked human serum, and patient plasma is demonstrated, enabling development of a novel cancer diagnostic platform.

라벨이없는 바이오 센서 기술을 활용 유방암 인간 백혈구 항원 바이오 마커의 검출

According to the American Cancer Society, more than 200,000 women will be diagnosed with invasive breast cancer each year and approximately 40,000 will ...

Development of an in vitro model system for studying the interaction of Equus caballus IgE with its high-affinity receptor Fc&#949;RI

The interaction of IgE with its high-affinity Fc receptor (Fc&#949;RI) followed by an antigenic challenge is the principal pathway in IgE mediated allergic reactions. As a consequence of the high affinity binding between IgE and Fc&#949;RI, along with the continuous production of IgE by B cells, allergies usually persist throughout life, with currently no permanent cure available. Horses, especially race horses, which are commonly inbred, are a species of mammals that are very prone to the development of hypersensitivity responses, which can seriously affect their performance. Physiological responses to allergic sensitization in horses mirror that observed in humans and dogs. In this paper we describe the development of an in situ assay system for the quantitative assessment of the release of mediators of the allergic response pertaining to the equine system. To this end, the gene encoding equine Fc&#949;RI&#945; was transfected into and expressed onto the surface of parental Rat Basophil Leukemia (RBL-2H3.1) cells. The gene product of the transfected equine &#945;-chain formed a functional receptor complex with the endogenous rat &#946;- and &#947;-chains 1. The resultant assay system facilitated an assessment of the quantity of mediator secreted from equine Fc&#949;RI&#945; transfected RBL-2H3.1 cells following sensitization with equine IgE and antigenic challenge using &#946;-hexosaminidase release as a readout 2, 3. Mediator release peaked at 36.68% &#177; 4.88% at 100 ng ml-1 of antigen. This assay was modified from previous assays used to study human and canine allergic responses 4, 5. We have also shown that this type of assay system has multiple applications for the development of diagnostic tools and the safety assessment of potential therapeutic intervention strategies in allergic disease 6, 2, 3.

Development of an &lt;em&gt;in vitro&lt;/em&gt; model system for studying the interaction of &lt;em&gt;Equus&lt;/em&gt; &lt;em&gt;caballus&lt;/em&gt; IgE with its high-affinity receptor Fc&amp;#949;RI

The current study describes the development and applications of a genetically engineered assay system based on the transfection of rat basophilic leukemia cells with the equine Fc&#949;RI&#945; gene. Transfected cells express a functional receptor where the release of mediators of the allergic response can be activated by IgE and antigen.

개발<em&gt; 체외</em의 상호 작용을 연구&gt; 모델 시스템<em&gt; 에쿠스</em&gt;<em&gt; caballus</em높은 친 화성 수용체 FcεRI에&gt;의 IgE

The interaction of IgE with its high-affinity Fc receptor (Fc&#949;RI) followed by an antigenic challenge is the principal pathway in IgE mediated ...

Imaging CD4 T Cell Interstitial Migration in the Inflamed Dermis

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral tissues through an as-yet undefined mechanism. The application of multiphoton microscopy to the study of the immune system provides a tool to measure the dynamics of immune responses within intact tissues. Here we present a protocol for non-invasive intravital multiphoton imaging of CD4 T cells in the inflamed mouse ear dermis. Use of a custom imaging platform and a venous catheter allows for the visualization of CD4 T cell dynamics in the dermal interstitium, with the ability to interrogate these cells in real-time via the addition of blocking antibodies to key molecular components involved in motility. This system provides advantages over both in vitro models and surgically invasive imaging procedures. Understanding the pathways used by CD4 T cells for motility may ultimately provide insight into the basic function of CD4 T cells as well as the pathogenesis of both autoimmune diseases and pathology from chronic infections.

The mechanisms that govern the interstitial motility of CD4 effector T cells at sites of inflammation are relatively unknown. We present a non-invasive approach to visualize and manipulate in vitro-primed CD4 T cells in the inflamed ear dermis, allowing for study of the dynamic behavior of these cells in situ.

염증이 진피의 이미징 CD4 T 세포 간질 마이그레이션

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral ...

Development of Stem Cell-derived Antigen-specific Regulatory T Cells Against Autoimmunity

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic self-tolerance. Tregs represent about 5 - 10% of the mature CD4+ T cell subpopulation in mice and humans, with about 1 - 2% of those Tregs circulating in the peripheral blood. Induced pluripotent stem cells (iPSCs) can be differentiated into functional Tregs, which have a potential to be used for cell-based therapies of autoimmune diseases. Here, we present a method to develop antigen (Ag)-specific Tregs from iPSCs (i.e., iPSC-Tregs). The method is based on incorporating the transcription factor FoxP3 and an Ag-specific T cell receptor (TCR) into iPSCs and then differentiating on OP9 stromal cells expressing Notch ligands delta-like (DL) 1 and DL4. Following in vitro differentiation, the iPSC-Tregs express CD4, CD8, CD3, CD25, FoxP3, and Ag-specific TCR and are able to respond to Ag stimulation. This method has been successfully applied to cell-based therapy of autoimmune arthritis in a murine model. Adoptive transfer of these Ag-specific iPSC-Tregs into Ag-induced arthritis (AIA)-bearing mice has the ability to reduce joint inflammation and swelling and to prevent bone loss.

We present here a method to develop functional antigen (Ag)-specific regulatory T cells (Tregs) from induced pluripotent stem cells (iPSCs) for immunotherapy of autoimmune arthritis in a murine model.

자가 면역 대해 줄기 세포 유래의 항원 특이 적 조절 T 세포의 발달

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic ...

Evaluation of Host-Pathogen Responses and Vaccine Efficacy in Mice

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a striking increase in life expectancy around the globe. Nonetheless, determining vaccine efficacy remains a challenge. Emerging evidence suggests that the current acellular vaccine (aPV) for Bordetella pertussis (B. pertussis) induces suboptimal immunity. Therefore, a major challenge is designing a next-generation vaccine that induces protective immunity without the adverse side effects of a whole-cell vaccine (wPV). Here we describe a protocol that we used to test the efficacy of a promising, novel adjuvant that skews immune responses to a protective Th1/Th17 phenotype and promotes a better clearance of a B. pertussis challenge from the murine respiratory tract. This article describes the protocol for mouse immunization, bacterial inoculation, tissue harvesting, and analysis of immune responses. Using this method, within our model, we have successfully elucidated crucial mechanisms elicited by a promising, next-generation acellular pertussis vaccine. This method can be applied to any infectious disease model in order to determine vaccine efficacy.

Here we present an elegant protocol for in vivo evaluation of vaccine effectiveness and host immune responses. This protocol can be adapted for vaccine models that study viral, bacterial, or parasitic pathogens.

호스트 병원 체 응답 및 쥐에 백신의 효능 평가

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a ...

Use of an Influenza Antigen Microarray to Measure the Breadth of Serum Antibodies Across Virus Subtypes

The influenza virus remains a significant cause of mortality worldwide due to the limited effectiveness of currently available vaccines. A key challenge to the development of universal influenza vaccines is high antigenic diversity resulting from antigenic drift. Overcoming this challenge requires novel research tools to measure the breadth of serum antibodies directed against many virus strains across different antigenic subtypes. Here, we present a protocol for analyzing the breadth of serum antibodies against diverse influenza virus strains using a protein microarray of influenza antigens.
This influenza antigen microarray is constructed by printing purified hemagglutinin and neuraminidase antigens onto a nitrocellulose-coated membrane using a microarray printer. Human sera are incubated on the microarray to bind antibodies against the influenza antigens. Quantum-dot-conjugated secondary antibodies are used to simultaneously detect IgG and IgA antibodies binding to each antigen on the microarray. Quantitative antibody binding is measured as fluorescence intensity using a portable imager. Representative results are shown to demonstrate assay reproducibility in measuring subtype-specific and cross-reactive influenza antibodies in human sera.
Compared to traditional methods such as ELISA, the influenza antigen microarray provides a high throughput multiplexed approach capable of testing hundreds of sera for multiple antibody isotypes against hundreds of antigens in a short time frame, and thus has applications in sero-surveillance and vaccine development. A limitation is the inability to distinguish binding antibodies from neutralizing antibodies.

We present a protocol for using a protein microarray constructed by printing influenza antigens onto nitrocellulose-coated slides to simultaneously probe serum for multiple antibody isotypes against over 250 antigens from different virus strains, thus allowing measurement of the breadth of serum antibodies across virus subtypes.

바이러스 특수형에 걸쳐 혈청 항체의 폭을 측정하기 위해 인플루엔자 항원 마이크로어레이의 사용

The influenza virus remains a significant cause of mortality worldwide due to the limited effectiveness of currently available vaccines. A key challenge ...