We thank the Bloomington Stock Center (Bloomington, USA), Dirk Bohmann, Katja Br&#252;ckner and Istvan Ando for fly stocks, and antibodies. We thank Marek Jindra and Colin Donohoe for comments on the manuscript. This work was supported by the Sofja Kovalevskaja Award to M.U. from the Alexander von Humboldt Foundation and DFG project UH243/1-1 to M.U. from the German Research Foundation.

참고 :이 작업은 eyFLP1을 활용; 행동&gt; Y +&gt; GAL4, UAS-GFP; FRT82B, 욕조 - Gal80 MARCM 82B 그린 테스터 라인 (11). 같은 w 같은 계통의 남성에 MARCM 82B 그린 테스터 처녀를 넘어; UAS-A; UAS-B의 RNAi, FRT82B C의 MUT 유전자형은 유사 분열 재조합이 3 번째 상동 염색체의 오른쪽 팔 사이에 발생하는 자손을 얻을 것입니다. 이러한 방식으로, FRT82B 사이트 원위 위치 유전자 C의 클론 동형 접합 돌연변이는 EAD 뇌 neuroepithelium 내에서 발생한다. 이 클론 유전자 B (그림 1A)에 대한 GFP, 유전자 A와 dsRNA를 표현합니다. 는 X, 2L, 2R, 3L 및 3R에 재결합을위한 다양한 eyFLP-MARCM 테스터 라인을 설립하고, 비행 지역 사회 내에서 사용할 수있다. 1. 플라이 처리, 십자가, 및 준비 <ol><li> 여러 보을 채워 실온에서 해당 MARCM 테스터 재고를 확장동시에 ttles. 충분한 처녀가 후속 십자가 수집 할 수 있도록 2-3 일마다 신선한 병으로 성인 플립. 참고 : 처녀를 수집 할 때,이 여성의 생식력을 타협으로 2 CO하는 장기간 노출을 피하십시오. </li><li> 실험의 규모에 따라 최소 10 MARCM 테스터 처녀와 (예를 들어, 형광 기자와 면역 염색의 영상의 경우) 또는 최소 30 처녀과 10 명의 남성 (예를 들어, 용 병 4 명의 남성을 사용하여 유리 병에 비행 십자가를 설정 RNA 분리 및 침입의 정량). </li><li> 긴 하루를 16 시간 / 8 시간의 명암 사이클에서 25 ° C에서 자손을 올립니다. 유충의 재현 할 준비를 촉진하고 혼잡을 방지하기 위해 새로운 병 / 병에 매 24 시간을 부모 플립. 참고 : 달걀 누워 (AEL) 후 6 일에 시작, 후반 세번째 령 제어 애벌레 정지 공급은 방황 시작하고 pupariation를 입력합니다. 대조적으로, 유충 번데기 - 전이의 개시는 해제 될 수있다누워 또는 EAD가 증식 또는 악성 클론 종양 베어링과 애벌레의 존재. </li></ol> 2. 세 번째 탈피 애벌레를 수집 <ol><li> 면역 염색의 경우, 약 20 후반 세번째 령 유충 (벽에 방황하고 음식에서 비슷한 신체 사이즈들)를 수집합니다. 부드럽게 유리 병 또는 병에서 애벌레를 선택하고 인산염 완충 식염수 (PBS) 가득 배아 유리 접시에 그들을 전송하는 집게를 사용합니다. <ol><li> RNA 분리 및 침입의 정량화를 들어, 적어도 80 후반 세번째 령 유충 (벽에 방황하고 음식에서 비슷한 신체 사이즈들)를 수집합니다. 표면이 덮여 때까지 유충을 포함하는 비행 병에 PBS를 분출하기 위해 물총 병을 사용합니다. </li><li> 주걱 음식의 상단 층을 연화 페트리 접시에 유충을 포함하는 식품 매쉬 붓는다. 집게를 사용하여 부드럽게 애벌레를 선택하고 PBS로 가득 배아의 유리 접시로 전송합니다. </li></ol></li><li> PBS의 UNT와 유충을 씻으십시오위원장 모든 잔여 음식이 제거됩니다. 애벌레 몸 전체 랜덤 GFP 양성 반점 (그림 2A, 2B 및 참조 토론 섹션)을 수행하는 모든 &quot;표범 애벌레를&quot;폐기 16X 배율로 8 형광 실체 현미경 아래의 유충을 검사합니다. 참고 : RNA 분리를 들어 1 분 동안 70 %의 EtOH의 끝에서 두 번째 세척 단계를 포함한다. </li><li> 해부 때까지 얼음에 PBS에서 선택한 애벌레가 들어있는 접시를 놓습니다. 30 분 내에 처리 유충은 추위와 굶주림의 부작용을 방지 할 수 있습니다. </li></ol> 애벌레 3. 해부 <ol><li> 실체 현미경 하에서 EAD를 해부하기 위해 부드럽게 유리 접시 바닥에 대한 유충의 중간 부분을 눌러 포셉 한 쌍을 사용합니다. 두 번째 집게로, 애벌레 입 후크를 잡아 멀리 신체 (그림 2C)에서 그들을 잡아 당깁니다. 참고 : 당기는 힘은 EAD 파이를 연결하는 광섬유 줄기를 중단하는 것이 충분하다뇌 로브에 대한 연구. 뇌 또는 부품 EAD 부착 유지하고 그들의 존재는 상기 애플리케이션에 바람직하지 않은 경우, 겸자 두 쌍의 도움으로 광섬유 줄기 잘랐다. (예를 들어, RAS의 V12의 scrib 1) EAD 뇌 로브 사이의 연결이 점점 overgrowing와 클론 세포를 마이그레이션하여 시간에 가려된다 침습적 종양하십시오. <ol><li> 온전한 복부 신경 코드 (VNC) (그림 2D)과 EAD / 뇌의 복잡한을 준비하려면 몸의 중앙에 유충을 잘라 집게를 사용합니다. 후방 절반을 폐기하십시오. </li><li> 한 집게의 끝 사이의 애벌레 몸의 앞쪽 절반을 잡고, 두 번째 집게의 끝 입 후크에 눌러 첫 번째 집게 쌍과 그 위에 표피를 압연하여 애벌레 내부 아웃 플립. </li></ol></li><li> 조심스럽게 EAD 쌍을 남기면서 모든 외부 조직 (예를 들어, 침샘, 지방 본문 및 창자)을 제거하거나 집게를 사용하여입 후크에 연결된 EAD / 뇌 복잡한. 위에있는 표피에서 입 후크를 풀다. 몸의 근육과 표피 (도 1B, 2C, 2D)에 연장 축삭 돌기를 절단하여 VNC를 무료로 제공됩니다. 참고 : 입 고리가 집게로 조직의 안전 조작이 가능하고 세척하는 동안 조직을보다 효율적으로 침몰하고 쉽게 인식을 용이하게한다. PBS에 고정되지 않은 유지하면 상대적으로 빠른 EAD 변화 형태를 해부. 20 ~ 30 분에 해부 시간을 제한합니다. </li><li> 조직을 전송하려면, 코트 나머지 몸을 피펫 팅하여 P20의 마이크로 피펫 팁은 위아래로 여러 번 전기자. 큰 EAD / 두뇌 단지를 전송하려면, 가위로 P20의 마이크로 피펫 팁을 잘라. 주 : 코팅 절차는 전송 중에 점착 및 해부 조직의 손실을 방지하기 위해 중요하다. P20 마이크로 피펫을 사용하면 원치 않는 한계 희석, 정착액 PBS 용액으로의 전달을 최소화한다. <ol><li> 면역 염색의 경우, 전송400 ㎕를 4 % 파라 포름 알데히드 (PFA) 고정액으로 가득 0.5 ML 튜브로 EAD를 해부. 큰 EAD 1 ml의 PFA 1.5 ML 튜브를 사용하여 / 뇌 단지는 침입의 득점에 대한 의미. 주의 : PFA는 매우 독성이다. 보호 장갑과 복을 착용 할 것. 피부, 눈 또는 점막과의 접촉을 피하십시오. </li><li> RNA 분리를 들어 차가운 PBS로 가득 찬 새로운 유리 접시에 해부 EAD를 전송합니다. 샘플 오염을 최소화하기 위해, 링과 림프 땀샘에서 EAD를 청소 집게를 사용합니다. </li><li> 집게 (도 2E)을 사용하여 상기 안테나 디스크 입 후크 사이의 접속을 절단하여 후크 입에서 EAD를 분리. RNA 분해 및 유전자 발현 유물을 방지하기 위해, 30 분에 해부 시간을 제한 할 수 있습니다. 7 단계로 진행합니다. 참고 : 숙련 된 연구자가 애벌레 수집 및 세척에 필요한 30 분을 제외한 시간에 약 60 유충을 해부 할 수 있습니다. 총 RNA 수익률은 유전자형과 developmenta 사이에 다릅니다 EAD 크기에 따라 달라집니다리터 단계. 후반 세번째 령 유충 80-100 제어 EAD 쌍 해부 5-8 μg의 총 RNA를 생성한다. </li></ol></li></ol> 4. 고정, 면역 염색 및 장착 <ol><li> 실온에서 하향 경사하면서 25 분 동안 PFA의 정착액에 샘플을 수정합니다. 정착 시간은 조직 형태학 및 단백질의 항원 성 변화없이 60 분까지 연장 될 수있다. </li><li> nutator를 사용하여 10 분 동안 세 번 (0.1 % 트리톤 X-100과 PBS) PBST로 정착 및 세척 샘플을 제거합니다. 각 세척 단계 (400 μL / 0.5 ML 튜브)에 대한 PBST의 충분한 양을 사용합니다. 참고 : 고정 EAD / 뇌 복합체는 면역 염색을 필요로하지 않는 침입의 득점에 대한 의미. GFP 신호가 고정 된 후에도 계속 표시됩니다. 최종 해부를 위해 4.4 단계로 진행합니다. <ol><li> 면역 염색을 위해, 실온에서 교반과 함께 20 분 동안 (0.3 % BSA와 PBST) 블로킹 용액 200 μL의 블록 조직. <ol><li> 꼼꼼한으로 품어가볍게 흔들어 섞으면 진 항체를 4 ℃에서 밤새 블로킹 용액 100 ㎕로 희석 하였다. 권장 항체 희석 차 항체 데이터 시트 또는 게시 된 문헌을 참조하십시오. 참고 : 차 항체 희석 최적화해야 할 수 있습니다. </li><li> 부드럽게 어두운 4 ℃에서 하룻밤 동안 실온에서 2 시간 동안 진탕하면서 또는 PBST에서 5 ~ 10 분간 세척 이후, 형광 이차 항체로 염색 된 조직을 차단 용액으로 희석 하였다. </li><li> 워시 샘플을 세 번 PBST에서 10 분. </li></ol></li></ol></li><li> DAPI 염색 용액 500 μL와 PBST를 교체합니다. F - 굴지 레이블을 지정하려면, DAPI 염색 용액에 형광 염료를 결합 팔로이 딘을 추가합니다. 어둠 속에서 15 분 장동 후, PBST 10 분 동안 한 번 조직을 씻으십시오. 주 : F 액틴 라벨링 DAPI 염색과 독립적으로 수행 될 수있다. </li><li> 최종 해부 단계를 들면, 1 ml의 파이를 사용하여 PBS 채워진 유리 접시에 다시 조직을 전송pette. 입 후크를 클립 집게의 두 쌍을 사용. <ol><li> 분석을 방해 할 수 있습니다 자란 EAD로 광학 줄기를 절단하여 EAD에서 침입의 정량에 사용되는 뇌를 분리합니다. </li></ol></li><li> 객관적인 슬라이드에 장착 매체의 드롭 (A 22mm X 22mm의 coverslip에 15 μl를) 놓습니다. 집게 팁의 도움으로, 얇은 층으로 매체를 배포 할 수 있습니다. P20의 마이크로 피펫으로 장착 매체에 EAD, 뇌 또는 EAD / 두뇌 단지를 전송합니다. </li><li> 조직을 배포하고 슬라이드에 VNC를 곧게 포셉의 조언, 텅스텐 막대를 사용합니다. </li><li> 설치하는 동안 거품, 첫 번째 터치 한 설치 매체에 커버 슬립의 가장자리와 집게의 도움으로 장착 매체에 천천히 이하의 형성을 방지 할 수 있습니다. 커버 슬립의 가장자리 주위 초과 장착 매체를 흡수 닦아 필터 종이 또는 조직의 작은 조각을 사용합니다. 참고 : DABCO / 폴리 (비닐 알코올) 4-88 설치 매체 굳어시간 내에서 4 ° C에서. 슬라이드는 4 ℃에서 달 동안 저장 될 수있다. </li></ol> 5. 공 촛점 이미징 <ol><li> 20X, 40X 및 60X 오일 목표에 장착 된 공 초점 현미경을 사용하여 단일 공 촛점 섹션과 스택을 획득. </li><li> 픽셀 포화를 방지합니다. 오프셋 화상 해상도, 레이저 입력 전력, 이득 프레임 평균화하는 Z 시리즈의 스텝 크기를 포함하여 동일한 이미지 포착 파라미터를 사용하여 상이한 유전자형 (21, 22) 사이의 픽셀 세기들의 비교를 허용하는 모든 유전자형에 대한 위치 설정을 유지한다. 참고 : EAD / 두뇌 단지의 시각화를 들어, 최대 돌기를 생성하고 각각의 이웃 이미지 만들기. 최종 이미지 준비, 패널 조립 후 이미지 처리 소프트웨어를 사용하여 밝기와 대비를 조정합니다. </li></ol> 종양 침윤 6. 정량 <ol><li> 종양 invasivenes의 다른 수준을 특성화하는 채점 시스템을 정의침윤의 공간적 패턴과 뇌 VNC에 확산 GFP 양성 세포의 양을 고려이야. 문서 (그림 3A)에 대한 평가 시트를 준비합니다. </li><li> 마운트는 적어도 80 24mm X 50mm의 coverslip에 따라 장착 매체의 40 μl를 사용하여 하나의 슬라이드에 각각의 유전자형에 대한 손상 머리를 고정. <ol><li> 편견 득점을 허용하려면, 채점 절차는 편견되도록, 슬라이드를 익명화하는 중립적 인 파티를 부탁드립니다. 독립적으로 두 실험실 구성원 익명 처리 슬라이드를 평가합니다. 계산이 완료된 후에 만 ​​유전자형이 개시되어있다. </li></ol></li><li> GFP 필터 세트가 장착 된 형광 실체 현미경 아래에 장착 뇌의 블라인드 점수에 의해 악성 종양의 정도를 평가합니다. 이미 이중 계산 (그림 3B)를 방지하기 위해 본 한 두뇌에 라벨 마커를 사용합니다. </li><li> 유전자형에 따라 정의 된 침습성 각 범주에 떨어지는 두뇌의 비율을 계산합니다. 통계들 결정ignificance 카이 제곱 테스트 (그림 3C)를 사용하여. </li></ol> 7. RNA 분리, DNase의 치료 및 품질 검사 참고 : 다음 단계에 사용 된 모든 시약 (솔루션, plasticware은)의 RNase 활동이 없어야합니다. 항상 장갑을 착용 및 유기 용제 작업 화학 후드를 사용합니다. <ol><li> 1.5 ml의 튜브에 코팅 된 P20의 마이크로 피펫 팁과 깨끗한 EAD를 전송합니다. </li><li> 튜브의 바닥 조직 싱크하자, 조심스럽게 PBS를 제거하고 100 μl의 RNA 용해 시약 (최대 140 EAD에 대한 충분한)로 교체합니다. </li><li> 텍싱에 의해를 Lyse 조직. 이 시점에서, 샘플을 액체 질소에 냉동 깊은 -80 ℃에서 보관하거나 직접 표준 RNA 분리 프로토콜을 사용하여 처리 될 수있다. 참고 : 여러 해부 라운드에서 유사한 유전자형의 샘플 RNA 용해 시약에 한 번 풀 수 있습니다. </li><li> RNA 용해 시약 0.9 ml의에 샘플 볼륨을 입력합니다. 클로로포름의 0.2 ML을 추가하고 vigoro 샘플을 혼합15 ~ 20 초 동안 usly. </li><li> 실온에서 2 내지 3 분 인큐베이션 후, 4 ℃에서 15 분 동안 10,000 XG에서 원심 분리. </li><li> 상간을 방해하지 않고 새로운 튜브로 무색 위 수성 상을 포함하는 RNA를 전송합니다. 이 단백질과 게놈 DNA가 들어 있으므로 멀리 계면에서 그대로. 주 : 회수 볼륨 균질화 사용 RNA 용해 시약의 부피의 약 60 %이어야한다. </li><li> 이소 프로필 알코올 0.5ml를 첨가하여 RNA를 침전. 볼텍스하고 실온에서 10 분 동안 샘플을 배양한다. </li><li> 4 ℃에서 15 분 동안 10,000 XG에서 샘플을 원심 분리기. </li><li> 뜨는을 취소하고 75 % 에탄올 600 μL로 한 번 RNA 펠렛을 씻는다. 짧은 소용돌이와 원심 분리 (4 ℃에서 7 분간 10,000 XG) 후 모두 에탄올을 취소하고 5 ~ 10 분 깨끗한 조직 닦아에게에 오픈 튜브를 배치하기위한 RNA 펠릿 공기가 건조 할 수 있습니다. 참고 : RNA 펠렛은 작은 불투명 / 화이트 성으로 볼 수 있습니다튜브 또는 눈에 보이지 않는 하단의 잘 익은. 나머지 에탄올 방울 신중 P10의 마이크로 피펫 팁으로 제거 할 수 있습니다. </li><li> 피펫 팁을 몇 번 텍싱 또는 솔루션을 전달하여 DEPC 처리 된 물 50 μL의 RNA를 녹여. </li><li> 게놈 DNA의 오염을 최소화하기 위해, DNase의 1 μL (2 U / μL) 및 DEPC 처리 된 물에 10 배의 DNase 완충액 10 μl를 함유하는 혼합물 50 μl를 첨가하여 전체 RNA의 DNase로 치료. 소용돌이와 스핀 다운. </li><li> 수조 또는 30 내지 40 분 동안 가열 블럭에서 37 ℃에서 샘플을 인큐베이션. 배양 후, 각 샘플에 DEPC 처리 된 물 100 μl를 추가합니다. </li><li> , DNase의에서 효소 활동하고 깨끗한 RNA를 비활성화 페놀의 200 μl를 추가하려면 : 4 ° C에서 7 분 동안 10,000 XG에서 1 분 원심 분리기에 대한 샘플 솔루션, 소용돌이 클로로포름 : 이소 아밀 알코올 (1 ~ 25 : 24). </li><li> 조심스럽게 새로운 튜브에 RNA를 함유하는 상부 수 성상을 전송. 동일한 볼륨을 추가 (200 μL)클로로포름, 혼합 위에서 원심 분리 단계를 반복합니다. </li><li> 신중 상부 상 모아서 3 M 아세트산 나트륨 1/10 부피를 첨가하여 RNA를 침전, pH가 5.2 100 % 에탄올 DEPC H 2 O 2.5 권으로 제조. 텍싱에 의해 철저하게 섞는다. 참고 : 침전 믹스 0.5 μL 글리코겐 (20 μg의 / μl를) 추가는 RNA 펠렛을 시각화하는 데 도움이됩니다. 실리콘이 낮은 바인딩 1.5 ml의 마이크로 원심 튜브를 사용하여, RNA의 손실을 최소화한다. </li><li> 적어도 1 시간 동안 -20 ℃에서 RNA를 침전. 참고 : 배양 밤새 수행 할 수 있습니다. 샘플뿐만 아니라 -80 ° C에 배치 될 수있다. </li><li> 4 ℃에서 30 분 동안 10,000 XG에 원심 분리하여 펠렛 RNA. 세척하고 7.9의 기술에 다음과 같은 건조 펠렛. </li><li> DEPC 처리 된 물 10 ~ 15 μL에서 RNA를 녹인다. -80 ° C에서 보관 RNA. </li><li> 230 nm의, 260 nm의 분광 광도계를 사용하여 280 nm에서 OD를 측정하여 RNA의 양과 순도를 결정합니다. RNA 공동 계산협약을 적용하여 ncentration 40 μg의 / ㎖ RNA와 동일한 nm의 260에서 1 OD 그. 참고 :하는 A 230분의 260 비율은 2.0-2.2의 범위에 있어야하는 동안 &quot;순수한&quot;RNA의 280 분의 260 비율은 2.0 같습니다. 1.7와 2.0 사이는 A 260/280 비율 RNA 샘플은 cDNA 합성 등의 하류 어플리케이션에 적합하다. mRNA의 서열 - 라이브러리의 제조를위한 RNA의 질과 양을 자동 전기 시스템을 이용하여 확인한다. 28S / 18S 비율은 1.8 이상이어야합니다. </li></ol>

<ol>
	<li>Miles, W. O., Dyson, N. J., Walker, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+tumor+invasion+and+metastasis+in+Drosophila.">Modeling tumor invasion and metastasis in Drosophila.</a> Dis Model Mech. 4 (6), 753-761 (2011).</li><li>Stefanatos, R. K. A., Vidal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+invasion+and+metastasis+in+Drosophila:+a+bold+past,+a+bright+future.">Tumor invasion and metastasis in Drosophila: a bold past, a bright future.</a> J Genet Genomics. 38 (10), 431-438 (2011).</li><li>Patel, P. H., Edgar, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+design:+How+Drosophila+tumors+remodel+their+neighborhood.">Tissue design: How Drosophila tumors remodel their neighborhood.</a> Semin Cell Dev Biol. 28, 86-95 (2014).</li><li>Gonzalez, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+melanogaster:+a+model+and+a+tool+to+investigate+malignancy+and+identify+new+therapeutics.">Drosophila melanogaster: a model and a tool to investigate malignancy and identify new therapeutics.</a> Nat Rev Cancer. 13 (3), 172-183 (2013).</li><li>Lee, T., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosaic+analysis+with+a+repressible+cell+marker+(MARCM)+for+Drosophila+neural+development.">Mosaic analysis with a repressible cell marker (MARCM) for Drosophila neural development.</a> Trends Neurosci. 24 (5), 251-254 (2001).</li><li>Xu, T., Rubin, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+genetic+mosaics+in+developing+and+adult+Drosophila+tissues.">Analysis of genetic mosaics in developing and adult Drosophila tissues.</a> Development. 117 (4), 1223-1237 (1993).</li><li>Struhl, G., Basler, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organizing+activity+of+wingless+protein+in+Drosophila.">Organizing activity of wingless protein in Drosophila.</a> Cell. 72 (4), 527-540 (1993).</li><li>Brand, A. H., Perrimon, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+gene+expression+as+a+means+of+altering+cell+fates+and+generating+dominant+phenotypes.">Targeted gene expression as a means of altering cell fates and generating dominant phenotypes.</a> Development. 118 (2), 401-415 (1993).</li><li>Wu, J. S., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+protocol+for+mosaic+analysis+with+a+repressible+cell+marker+(MARCM)+in+Drosophila.">A protocol for mosaic analysis with a repressible cell marker (MARCM) in Drosophila.</a> Nat Protoc. 1 (6), 2583-2589 (2006).</li><li>Brumby, A. M., Richardson, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=scribble+mutants+cooperate+with+oncogenic+Ras+or+Notch+to+cause+neoplastic+overgrowth+in+Drosophila.">scribble mutants cooperate with oncogenic Ras or Notch to cause neoplastic overgrowth in Drosophila.</a> EMBO J. 22 (21), 5769-5779 (2003).</li><li>Pagliarini, R. A., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+screen+in+Drosophila+for+metastatic+behavior.">A genetic screen in Drosophila for metastatic behavior.</a> Science (New York, NY). 302 (5648), 1227-1231 (2003).</li><li>Uhlirova, M., Bohmann, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JNK-+and+Fos-regulated+Mmp1+expression+cooperates+with+Ras+to+induce+invasive+tumors+in+Drosophila.">JNK- and Fos-regulated Mmp1 expression cooperates with Ras to induce invasive tumors in Drosophila.</a> EMBO J. 25 (22), 5294-5304 (2006).</li><li>Turkel, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BTB-zinc+finger+transcription+factor+abrupt+acts+as+an+epithelial+oncogene+in+Drosophila+melanogaster+through+maintaining+a+progenitor-like+cell+state.">The BTB-zinc finger transcription factor abrupt acts as an epithelial oncogene in Drosophila melanogaster through maintaining a progenitor-like cell state.</a> PLoS Genet. 9 (7), e1003627 (2013).</li><li>Cordero, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oncogenic+Ras+Diverts+a+Host+TNF+Tumor+Suppressor+Activity+into+Tumor+Promoter.">Oncogenic Ras Diverts a Host TNF Tumor Suppressor Activity into Tumor Promoter.</a> Dev Cell. 18 (6), 999-1011 (2010).</li><li>Khoo, P., Allan, K., Willoughby, L., Brumby, A. M., Richardson, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Drosophila,+RhoGEF2+cooperates+with+activated+Ras+in+tumorigenesis+through+a+pathway+involving+Rho1-Rok-Myosin-II+and+JNK+signalling.">In Drosophila, RhoGEF2 cooperates with activated Ras in tumorigenesis through a pathway involving Rho1-Rok-Myosin-II and JNK signalling.</a> Dis Model Mech. 6, 661-678 (2013).</li><li>Jiang, Y., Scott, K. L., Kwak, S. J., Chen, R., Mardon, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sds22/PP1+links+epithelial+integrity+and+tumor+suppression+via+regulation+of+myosin+II+and+JNK+signaling.">Sds22/PP1 links epithelial integrity and tumor suppression via regulation of myosin II and JNK signaling.</a> Oncogene. 30 (29), 3248-3260 (2011).</li><li>Figueroa-Clarevega, A., Bilder, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malignant+Drosophila+Tumors+Interrupt+Insulin+Signaling+to+Induce+Cachexia-like+Wasting.">Malignant Drosophila Tumors Interrupt Insulin Signaling to Induce Cachexia-like Wasting.</a> Dev Cell. 33 (1), 47-55 (2015).</li><li>Newsome, T. P., Asling, B., Dickson, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Drosophila+photoreceptor+axon+guidance+in+eye-specific+mosaics.">Analysis of Drosophila photoreceptor axon guidance in eye-specific mosaics.</a> Development. 127 (4), 851-860 (2000).</li><li>Quiring, R., Walldorf, U., Kloter, U., Gehring, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Homology+of+the+eyeless+gene+of+Drosophila+to+the+Small+eye+gene+in+mice+and+Aniridia+in+humans.">Homology of the eyeless gene of Drosophila to the Small eye gene in mice and Aniridia in humans.</a> Science. 265 (5173), 785-789 (1994).</li><li>K&#252;lshammer, E., Uhlirova, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+actin+cross-linker+Filamin/Cheerio+mediates+tumor+malignancy+downstream+of+JNK+signaling.">The actin cross-linker Filamin/Cheerio mediates tumor malignancy downstream of JNK signaling.</a> J Cell Sci. 126 (Pt 4), 927-938 (2013).</li><li>North, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seeing+is+believing?+A+beginners'+guide+to+practical+pitfalls+in+image+acquisition.">Seeing is believing? A beginners' guide to practical pitfalls in image acquisition.</a> J Cell Biol. 172 (1), 9-18 (2006).</li><li>Waters, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accuracy+and+precision+in+quantitative+fluorescence+microscopy.">Accuracy and precision in quantitative fluorescence microscopy.</a> J Cell Biol. 185 (7), 1135-1148 (2009).</li><li>Igaki, T., Pagliarini, R. A., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+cell+polarity+drives+tumor+growth+and+invasion+through+JNK+activation+in+Drosophila.">Loss of cell polarity drives tumor growth and invasion through JNK activation in Drosophila.</a> Curr Biol. 16 (11), 1139-1146 (2006).</li><li>K&#252;lshammer, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interplay+among+Drosophila+transcription+factors+Ets21c,+Fos+and+Ftz-F1+drives+JNK-mediated+tumor+malignancy.">Interplay among Drosophila transcription factors Ets21c, Fos and Ftz-F1 drives JNK-mediated tumor malignancy.</a> Dis Model Mech. 8 (10), 1279-1293 (2015).</li><li>Pastor-Pareja, J. C., Wu, M., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+innate+immune+response+of+blood+cells+to+tumors+and+tissue+damage+in+Drosophila.">An innate immune response of blood cells to tumors and tissue damage in Drosophila.</a> Dis Model Mech. 1 (2-3), 144-154 (2008).</li><li>Chatterjee, N., Bohmann, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+&#934;C31+based+reporter+system+for+measuring+AP-1+and+Nrf2+signaling+in+Drosophila+and+in+tissue+culture.">A versatile &#934;C31 based reporter system for measuring AP-1 and Nrf2 signaling in Drosophila and in tissue culture.</a> PloS One. 7 (4), e34063 (2012).</li><li>Petraki, S., Alexander, B., Br&#252;ckner, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assaying+Blood+Cell+Populations+of+the+Drosophila+melanogaster+Larva.">Assaying Blood Cell Populations of the Drosophila melanogaster Larva.</a> J Vis Exp. (105), (2015).</li><li>Makhijani, K., Alexander, B., Tanaka, T., Rulifson, E., Bruckner, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+peripheral+nervous+system+supports+blood+cell+homing+and+survival+in+the+Drosophila+larva.">The peripheral nervous system supports blood cell homing and survival in the Drosophila larva.</a> Development. 138 (24), 5379-5391 (2011).</li><li>Kurucz, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemese,+a+hemocyte-specific+transmembrane+protein,+affects+the+cellular+immune+response+in+Drosophila.">Hemese, a hemocyte-specific transmembrane protein, affects the cellular immune response in Drosophila.</a> Proc Natl Acad Sci USA. 100 (5), 2622-2627 (2003).</li><li>Andersen, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Drosophila+TNF+receptor+Grindelwald+couples+loss+of+cell+polarity+and+neoplastic+growth.">The Drosophila TNF receptor Grindelwald couples loss of cell polarity and neoplastic growth.</a> Nature. 522 (7557), 482-486 (2015).</li><li>Srivastava, A., Pastor-Pareja, J. C., Igaki, T., Pagliarini, R., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basement+membrane+remodeling+is+essential+for+Drosophila+disc+eversion+and+tumor+invasion.">Basement membrane remodeling is essential for Drosophila disc eversion and tumor invasion.</a> Proc Natl Acad Sci USA. 104 (8), 2721-2726 (2007).</li><li>Larionov, A., Krause, A., Miller, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+standard+curve+based+method+for+relative+real+time+PCR+data+processing.">A standard curve based method for relative real time PCR data processing.</a> BMC Bioinformatics. 6 (1), (2005).</li><li>Blair, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+mosaic+techniques+for+studying+Drosophila+development.">Genetic mosaic techniques for studying Drosophila development.</a> Development. 130 (21), 5065-5072 (2003).</li><li>Mirth, C. K., Shingleton, A. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrating+body+and+organ+size+in+Drosophila:+recent+advances+and+outstanding+problems.">Integrating body and organ size in Drosophila: recent advances and outstanding problems.</a> Front Endocrinol. 3 (49), (2012).</li><li>French, V., Feast, M., Partridge, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Body+size+and+cell+size+in+Drosophila:+the+developmental+response+to+temperature.">Body size and cell size in Drosophila: the developmental response to temperature.</a> J Insect Physiol. 44 (11), 1081-1089 (1998).</li><li>Ashburner, M., Bonner, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+induction+of+gene+activity+in+drosophila+by+heat+shock.">The induction of gene activity in drosophila by heat shock.</a> Cell. 17 (2), 241-254 (1979).</li><li>Frazier, M. R., Woods, H. A., Harrison, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactive+effects+of+rearing+temperature+and+oxygen+on+the+development+of+Drosophila+melanogaster.">Interactive effects of rearing temperature and oxygen on the development of Drosophila melanogaster.</a> Physiol Biochem Zool. 74 (5), 641-650 (2001).</li><li>Lai, S. L., Lee, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+mosaic+with+dual+binary+transcriptional+systems+in+Drosophila.">Genetic mosaic with dual binary transcriptional systems in Drosophila.</a> Nat Neurosci. 9 (5), 703-709 (2006).</li><li>Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Q+system:+a+repressible+binary+system+for+transgene+expression,+lineage+tracing,+and+mosaic+analysis.">The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis.</a> Cell. 141 (3), 536-548 (2010).</li><li>del Valle Rodr&#236;guez, A., Didiano, D., Desplan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Power+tools+for+gene+expression+and+clonal+analysis+in+Drosophila.">Power tools for gene expression and clonal analysis in Drosophila.</a> Nature Methods. 9 (1), 47-55 (2011).</li><li>Rynes, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activating+Transcription+Factor+3+Regulates+Immune+and+Metabolic+Homeostasis.">Activating Transcription Factor 3 Regulates Immune and Metabolic Homeostasis.</a> Mol Cell Biol. 32 (19), 3949-3962 (2012).</li><li>Claudius, A. K., Romani, P., Lamkemeyer, T., Jindra, M., Uhlirova, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unexpected+role+of+the+steroid-deficiency+protein+ecdysoneless+in+pre-mRNA+splicing.">Unexpected role of the steroid-deficiency protein ecdysoneless in pre-mRNA splicing.</a> PLoS Genet. 10 (4), e1004287 (2014).</li><li>Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+Specific+Cell+Population+by+Fluorescence+Activated+Cell+Sorting+(FACS).">Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS).</a> J Vis Exp. (41), (2010).</li><li>Tauc, H. M., Tasdogan, A., Pandur, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolating+intestinal+stem+cells+from+adult+Drosophila+midguts+by+FACS+to+study+stem+cell+behavior+during+aging.">Isolating intestinal stem cells from adult Drosophila midguts by FACS to study stem cell behavior during aging.</a> J Vis Exp. (94), (2014).</li></ol>

The authors declare that they have no conflict of interest.

기술은 초파리의 유전 모자이크 분석 및 유전자 기능 (33)를 조작하기위한 가장 정교한 도구들이다 생성합니다. 그것은 눈이없는 증강 활성 9,18 인 조직에서, 즉, 공간적으로 제한된 방식으로 시각적으로 표시, 유 전적으로 정의 된 클론의 유도를 할 수 있습니다대로 eyFLP - MARCM 시스템은 강력하고 강력한 입증되었습니다. 여러 유전 적 병변이 동일한 셀에 결합 ...

암 발생률과 사망률을 극적으로 전 세계적으로, 특히 노인들 사이에서 증가하고 질병의 가장 유 전적으로 이질적인 그룹 중 하나를 나타냅니다. 암은 고유의 종양 억제 메커니즘을 탈출하고 통제 분할하는 종양 시작 세포에서 클론 적 기인한다. 죽음과 분화를 억제하면서 협력 적 성장, 증식과 운동성을 촉진 유전자 병변의 점진적 축적은 매우 악성 전이성 치명적인 종양으로 초기 양성과 성장을 변환합니다. 이것은 유전 적 변형에 더하여, 종양 진행이 미세 환경에서 복수 종양 세포 유형 (예를 들어, 섬유 아세포, 내피 세포 및 면역) 사이의 주변의 스트로마 및 크로스 토크의 변화를 필요로한다는 증거가되고있다. 종양 기질 상호 작용을 포함하여 악성 변환을 기본 분자 원리를 이해하는 것은 예방하기 개발에 매우 ​​중요하다기 및 조기 검진 전략뿐만 아니라 새롭고 효과적인 치료법은 암 전이 및 약물 내성을 방지한다. 과일 초파리 비행은 빠른 생성 시간 때문에 암 연구 1-4위한 매력적인 시스템이되었다, 파리와 인간의 거의 모든 유전자의 조작을 용이하게 고급 유전자 도구의 제한으로 유전자 중복과 부 사이의 노드 신호의 놀라운 보존 일시적으로 공간적으로 제한 방법. 다양한 악성 종양 유전자 정의 재현성 MARCM 기술 5를 사용 달리 야생형 조직에서 전구 세포의 서브 세트에 이득 - 및 기능 상실 돌연변이를 도입함으로써 초파리 설계 될 수있다. MARCM 도구는 FLP / FRT는 (FLP 재조합 효소 / FLP 인식 대상이) FLP 아웃 7 GAL4 / UAS (업스트림 활성화 시퀀스) 8 표적 유전자와 유사 분열 재조합 (6) - 중재 결합발현 시스템 구. dsRNA를 유도 유전자 침묵에 대한 종양 유전자 또는 형광 단백질 cDNA를 또는 반전 DNA의 반복을 포함한 모든 UAS 기반 유전자의이 방법의 표현으로, 특정 유전자 궤적과 재결합으로 인해 GAL4 리프레을 잃은 세포의 복제에 제한됩니다 (도 1A). 클론 패치가 녹색 형광 (GFP) 또는 적색 형광 단백질로 표시 (예를 들어, RFP,을 DsRed, mCherry)는 쉽게 개발, 격리 및 분석을 통해 추적 할 수 있습니다. 중요한 것은, 이들 동작은 직접 인접하는 야생형 조직과 비교 될 수있다. 따라서, 질문은 유전 적 병변의 자율이 아닌 자율적 인 효과를 편리하게 공부하실 수 있습니다 세포 관련의. 포유 동물과 마찬가지로, 만 클론은 여러 종양 병변은 초파리에서 악성되고 포유 동물의 암의 주요 특징을 요점을 되풀이 결합된다. 그들은 세포 사멸을 회피 염증을 유발, 불멸과 INVA되고, overproliferate시브는 궁극적으로 호스트 10-17를 죽이는. 여기, 우리는 프로토콜이 MARCM 기술을 사용하여 초파리 유충의 눈 / 더듬이와 뇌 조직에서 유전자 정의 클론 종양을 생성하기 위해 설명합니다. 이 방법은 눈이없는 인핸서 (eyFLP) (18, 19)의 제어하에 효모 FLP 재조합 효소를 발현하는 MARCM 테스터 재고에 의존한다. 이러한 방식으로, GFP 표지 클론 peripodial 및 주상 EAD의 상피 세포 및 배아와 애벌레 단계 (그림 1A, B 및 기준 20)을 통해 뇌의 neuroepithelium 모두에서 생성됩니다. neuroepithelium는 차별화 된 광학 로브 뉴런을 생성 neuroblasts에 상승을 제공하면서 EAD가 성인 눈, 안테나와 머리 캡슐로 개발로 클론 쉽게 성인이 될 때까지 올 수 있습니다. 우리 드 모자이크 조직의 광범위한 분자 기능 및 표현형 특성을 용이하게하기 위해,서기관 세 번째 령 유충에서 EAD과 뇌의 해부에 대한 프로토콜은 세 가지 다른 응용 프로그램을 처리하는 방법을 간략하게 설명합니다 : (ⅰ) 형질 전환 형광 기자와 면역 검출, 종양 침입 및 (ⅲ) 분석 (II) 정량 유전자 발현은 정량적 실시간 PCR (QRT-PCR) 또는 높은 처리량의 mRNA 서열 (mRNA의 서열 -) (도 1C)을 이용하여 변경한다. 면역 염색 프로토콜은 특정 항체와 관심있는 단백질을 가시화하기 위해 사용될 수있다. 형질 전환 형광 전사 기자는 특정 신호 전달 경로의 활동에 편리하고 정확한 시공간 정보를 제공합니다. 세포 계보 특정 기자 한편, 모세 조직 내의 별개의 유전자형 간의 종양 세포 집단에 정량적 변화를 반영한다. 침략 행동의 정량은 유전자형 사이의 종양 악성 종양의 비교를 용이하게에스. 마지막으로, RNA 분리에 대한 모자이크 EAD의 수집 및 처리를 설명하는 프로토콜은 각각 QRT-PCR 및 게놈 전체의 mRNA-SEQ, 다음 역전사 등 모두 크고 작은 규모의 다운 스트림 애플리케이션에 적합하다. 이 분석에서 얻어진 정성 및 정량 데이터는 클론 종양의 사회적 행동에 대한 새로운 통찰력을 제공합니다. 또한, 그들은 개인의 유전자, 유전자 네트워크와 다른 단계의 종양 미세 환경과 종양의 측면의 역할에 대한 기능 연구를위한 견고한 기초를 생산하고 있습니다.

<table border="0" cellpadding="0" cellspacing="0" width="1019">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Agar</td>
			<td style="width:177px;">Gew&#252;rzm&#252;hle Brecht, Eggenstein, Germany</td>
			<td style="width:151px;">00262-0500</td>
			<td style="width:476px;">Fly food recipe: Prepare 20 L fly food with 160 g agar, 360 g yeast, 200 g soy flour, 1.6 kg yellow cornmeal, 1.2 L malt extract, 300 ml light corn syrup, 130 ml propionic acid and 200 ml 15% nipagin. Fly food should be cooked for 1 hour at 85&#176;C.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Corn syrup</td>
			<td style="width:177px;">Grafschafter Krautfabrik Josef Schmitz KG, Meckenheim, Germany</td>
			<td style="width:151px;">01939</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Propionic acid</td>
			<td style="width:177px;">Carl Roth GmbH, Karlsruhe, Germany</td>
			<td style="width:151px;">6026.1</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Cornmeal</td>
			<td style="width:177px;">ReformKontor GmbH, Zarrentin, Germany</td>
			<td style="width:151px;">4010155063948</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Malt extract</td>
			<td style="width:177px;">CSM Deutschland GmbH, Bremen, Germany</td>
			<td style="width:151px;">728985</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Soy flour</td>
			<td style="width:177px;">Stockmeier Food GmbH, Herford, Germany</td>
			<td style="width:151px;">1000246441010</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Yeast</td>
			<td style="width:177px;">Werner Ramspeck GmbH, Schwabach, Germany</td>
			<td style="width:151px;">210099K</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Methyl-4-benzoate/ Nipagin</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">H5501</td>
			<td style="width:476px;">Prepare a 15% stock solution with 70% EtOH</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Drosophila fly food vials</td>
			<td style="width:177px;">Kisker Biotech, Steinfurt, Germany</td>
			<td style="width:151px;">789008</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Vial plugs</td>
			<td style="width:177px;">K-TK e.K., Retzstadt, Germany</td>
			<td style="width:151px;">1002</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Drosophila fly food bottles</td>
			<td style="width:177px;">Greiner Bio-One, Frickenhausen, Germany</td>
			<td style="width:151px;">960177</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bottle plugs</td>
			<td style="width:177px;">K-TK e.K., Retzstadt, Germany</td>
			<td style="width:151px;">1002 S</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:216px;">Poly(vinyl alcohol) 4-88/[-CH2CHOH-]n</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">81381</td>
			<td style="width:476px;">Mounting medium recipe: Dissolve 6 g Poly(vinyl alcohol) 4-88 in 39 ml Millipore H2O, 6 ml 1 M Tris (pH 8.5) and 12.5 ml glycerol. Stir overnight at 50&#176;C and centrifuge 20 min at 5000 rpm. Add DABCO to the supernatant to get a final concentration of 2.5%. Store aliquots at -20&#176;C.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">1,4-Diazabicyclo[2.2.2]octane/ DABCO&#160;</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">D2522</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Triton X-100</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">9002-93-1</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Phosphate-buffered saline/ PBS</td>
			<td style="width:177px;"></td>
			<td style="width:151px;"></td>
			<td style="width:476px;">137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, pH 7.4 in Millipore H2O</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBST</td>
			<td style="width:177px;"></td>
			<td style="width:151px;"></td>
			<td style="width:476px;">0.1% Triton X-100 in PBS</td>
		</tr>
		<tr height="168">
			<td height="168" style="height:168px;width:216px;">Paraformaldehyde/ PFA</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">158127</td>
			<td style="width:476px;">4% PFA fixative recipe: Dissolve 4 g PFA in 80 ml Millipore H2O on a magnetic stirrer plate heated to 55 &#176;C. Add 1M NaOH dropwise until all PFA particles are dissolved. Add 10 ml 10X PBS and adjust the pH to 7.4 with 1M HCl. Mix in 100 &#181;l Triton X-100 and fill up with Millipore H2O to 100 ml. Store aliquots at -20&#176;C. Avoid repeated thawing. (CAUTION: PFA is highly toxic. Prepare the PFA fixative in a fume hood. Wear a self-contained breathing apparatus, gloves and clothing. Avoid contact with skin, eyes or mucous membranes)</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bovine Serum Albumin/ BSA</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">A3059</td>
			<td style="width:476px;">Blocking solution recipe: Dissolve 0.3% BSA in PBST</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">4&#8217;,6-Diamidino-2-phenylindol Dihydrochlorid/ DAPI</td>
			<td style="width:177px;">Carl Roth GmbH, Karlsruhe, Germany</td>
			<td style="width:151px;">6335</td>
			<td style="width:476px;">DAPI staining solution: Prepare a stock solution of 5 mg/ml in Millipore H2O and store aliquots at 4&#176;C. Used in dilution 1:1000 in PBST.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Alexa Flour 546 Phalloidin</td>
			<td style="width:177px;">Invitrogen, Karlsruhe, Germany</td>
			<td style="width:151px;">A22283</td>
			<td style="width:476px;">Used in dilution 1:500 in PBST.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Mouse anti-H2 antibody</td>
			<td style="width:177px;">Kurucz et al., 2003</td>
			<td style="width:151px;"></td>
			<td style="width:476px;">Used in dilution 1:500 in blocking solution</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Cy5 AffiniPure Donkey Anti-Mouse IgG (H+L)</td>
			<td style="width:177px;">Jackson ImmunoResearch, Suffolk, UK</td>
			<td style="width:151px;">715-175-151</td>
			<td style="width:476px;">Used in dilution 1:500 in blocking solution</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dumont #5 forceps</td>
			<td style="width:177px;">Fine Science Tools, Heidelberg, Germany</td>
			<td style="width:151px;">11295-10</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Glass embryo dish (30 mm)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">E90</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Tungsten needles</td>
			<td style="width:177px;">Fine Science Tools, Heidelberg, Germany</td>
			<td style="width:151px;">10130-20</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Nickel Plated Pin Holder</td>
			<td style="width:177px;">Fine Science Tools, Heidelberg, Germany</td>
			<td style="width:151px;">26018-17</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Microscope slides</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">631-1553</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Coverslips 22 x 22 mm (#1 Menzel-Gl&#228;ser)</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">631-1336</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Coverslips 24 x 50 mm (0.13-0.16 mm)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">1076371</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Kimtech Science Precision Wipes</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">06-677-70</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dissecting stereomicroscope</td>
			<td style="width:177px;">Olympus, Hamburg, Germany</td>
			<td style="width:151px;">SZX7 (DF PLAPO 1X-4 Japan)</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">Fluorescent stereomicroscope</td>
			<td style="width:177px;">Olympus, Hamburg, Germany</td>
			<td style="width:151px;">SZX16 (SDF PLAPO 0.8X Japan) with DP72 CCD camera</td>
			<td style="width:476px;">Equipped with the narrow blue bandpass filter set for excitation of GFP other blue excitable fluorochromes (excitation filter BP460-480 nm, barrier filter BA495-540 nm) and narrow green excitation and longpass barrier filter for RFP and other green excitable fluorochromes (excitation filter BP530-550, barrier filter BA575IF). Software: Olympus cellSens Standard 1.11.</td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">Confocal microscope</td>
			<td style="width:177px;">Olympus, Hamburg, Germany</td>
			<td style="width:151px;">FV1000</td>
			<td style="width:476px;">Equipped with inverted IX81 microscope. Objectives: 20&#215; UPlan S-Apo (NA 0.85), 40&#215; UPlanFL (NA 1.30) and 60&#215; UPlanApo (NA 1.35). Lasers: UV laser Diode LD405 (50mW), Argon laser, multi-line 457/(476)/ 488/515 (40mW), Yellow/Green laser diode LD560 (15mW) and Red Laser diode 635 (20mW). Software: Fluoview 2.1c Software</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Drosophila cooled incubator</td>
			<td style="width:177px;">Ewald Innovationstechnik GmbH, Bad Nenndorf, Germany</td>
			<td style="width:151px;">&#160;Sanyo MIR553</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Squirt bottle</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">215-8105</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">BD Clay Adams Nutator Mixer</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">15172-203</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">ELMI Digital Rocking Shaker</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">DRS-12</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">5 PRIME Isol-RNA Lysis Reagent</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">2302700</td>
			<td style="width:476px;">The protocol is compatible with other TRIzol-based reagents e.g. TRIreagent from Sigma (Cat. Nr.T9424), TRIzol reagent from Thermofisher (Cat. Nr. 15596).</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Diethyl pyrocarbonate/ DEPC</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">D5758</td>
			<td style="width:476px;">Dilute DEPC 1:1000 in Millipore H2O, stir overnight and autoclave.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1)</td>
			<td style="width:177px;">ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany</td>
			<td style="width:151px;">15593-031</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Chloroform</td>
			<td style="width:177px;">Merck, Darmstadt, Germany</td>
			<td style="width:151px;">102445</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">TURBO DNase (2 U/&#181;l)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">AM2238</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Invitrogen UltraPure Glycogen</td>
			<td style="width:177px;">ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany</td>
			<td>10-814-010</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Sodium acetate trihydrate</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">27652.232</td>
			<td style="width:476px;">Prepare a 3M Sodium acetate solution with DEPC-H2O and adjust the pH to 5.2</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">2-Propanol</td>
			<td style="width:177px;">Merck, Darmstadt, Germany</td>
			<td style="width:151px;">109634</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Ethanol</td>
			<td style="width:177px;">Merck, Darmstadt, Germany</td>
			<td style="width:151px;">100983</td>
			<td style="width:476px;">Prepare a 75% EtOH dilution with DEPC-H2O.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">UV/Vis-Spectrophotometre NanoDrop ND-8000</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">ND-8000</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Eppendorf Microcentrifuge (Refrigerated)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">5417R</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Experion RNA StdSens Analysis Kit</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">7007103</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Experion Automated Electrophoresis Station</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">7007010</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">SuperScript III Reverse Transcriptase</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">18080044</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Oligo d(T) Primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td style="width:476px;">Prepare 100 &#181;M stock solutions in DEPC-H20 and store at -20&#176;C</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">dNTP Mixture</td>
			<td style="width:177px;">Takara Bio Europe/Clonetech, Saint-Germain-en-Laye, France</td>
			<td style="width:151px;">4030</td>
			<td style="width:476px;">Store aliquots of 25 &#181;l at -20&#176;C</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">CFX96 Touch Real-Time PCR Detection System</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">1855195</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">iQ SYBR Green Supermix</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">170-8882</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Hard-Shell PCR Plates 96-well, thin wall</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">HSP9601</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Microseal &#39;B&#39; Film</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">MSB1001</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">rp49 Forward primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; TCCTACCAGCTTCAAGATGAC 3&#39;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">rp49 Reverse primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; CACGTTGTGCACCAGGAACT 3&#39;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">mmp1 Forward primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; AGGGCGACAAGTACTACAAGCTGA 3&#39;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">mmp1 Reverse primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; ACGTCTTGCCGTTCTTGTAGGTGA 3&#39;</td>
		</tr>
	</tbody>
</table>

the drosophila imaginal disc tumor model: visualization and quantification of gene expression and tumor invasiveness using genetic mosaics

Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the context of a whole organism. Sophisticated techniques to generate genetic mosaics facilitate induction of visually marked, genetically defined clones surrounded by normal tissue. The clones can be analyzed through diverse molecular, cellular and omics approaches. This study describes how to generate fluorescently labeled clonal tumors of varying malignancy in the eye/antennal imaginal discs (EAD) of Drosophila larvae using the Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. It describes procedures how to recover the mosaic EAD and brain from the larvae and how to process them for simultaneous imaging of fluorescent transgenic reporters and antibody staining. To facilitate molecular characterization of the mosaic tissue, we describe a protocol for isolation of total RNA from the EAD. The dissection procedure is suitable to recover EAD and brains from any larval stage. The fixation and staining protocol for imaginal discs works with a number of transgenic reporters and antibodies that recognize Drosophila proteins. The protocol for RNA isolation can be applied to various larval organs, whole larvae, and adult flies. Total RNA can be used for profiling of gene expression changes using candidate or genome-wide approaches. Finally, we detail a method for quantifying invasiveness of the clonal tumors. Although this method has limited use, its underlying concept is broadly applicable to other quantitative studies where cognitive bias must be avoided.

초파리 EAD에 정의 된 유전자형 GFP 마크 패치를 생성하는 eyFLP-MARCM 기술의 가능성을 증명하기 위해, 클론의 세 가지 유형이 유도되었다 : 경우 1 제어 발현 GFP (2) 악성 종양이 작고의 종양 형태를 나타내는 종양 억제 유전자 낙서의 동형 접합 손실 (scrib 1)의 배경에서 G 단백질 라스 (라스 V12), (3) overgrowing하지만 비 침습적 라스 V12</s...

Watch this Scientific Journal Video about The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics at JoVE.com

The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

이 프로토콜은 초파리의 눈 / 더듬이 가상적인 디스크 (EAD에게)에서 형광 표시, 유 전적으로 정의 클론 종양을 생성하는 방법을 보여줍니다. 그것은 세 번째 령 유충과 방법을 시각화하고 유전자 발현 변화와 종양 침입을 정량화를 처리하는 방법에서 EAD 뇌를 해부하는 방법에 대해 설명합니다.

그만큼<em&gt; 초파리</em&gt; 가상적인 디스크 종양 모델 : 유전 모자이크를 사용하여 유전자 발현 및 종양 침윤의 시각화 및 정량화

Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the ...

the-drosophila-imaginal-disc-tumor-model-visualization-quantification

Research

JoVE Journal

Cancer Research

The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

11.0K 조회수.  University of Cologne.  이 프로토콜은 초파리의 눈 / 더듬이 가상적인 디스크 (EAD에게)에서 형광 표시, 유 전적으로 정의 클론 종양을 생성하는 방법을 보여줍니다. 그것은 세 번째 령 유충과 방법을 시각화하고 유전자 발현 변화와 종양 침입을 정량화를 처리하는 방법에서 EAD 뇌를 해부하는 방법에 대해 설명합니다. 

비디오: The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

A Murine Orthotopic Bladder Tumor Model and Tumor Detection System

This protocol describes the generation of bladder tumors in female C57BL/6J mice using the murine bladder cancer cell line MB49, which has been modified to secrete human Prostate Specific Antigen (PSA), and the procedure for the confirmation of tumor implantation. In brief, mice are anesthetized using injectable drugs and are made to lay in the dorsal position. Urine is vacated from the bladder and 50 &#181;L of poly-L-lysine (PLL) is slowly instilled at a rate of 10 &#181;L/20 s using a 24 G IV catheter. It is left in the bladder for 20 min by stoppering the catheter. The catheter is removed and PLL is vacated by gentle pressure on the bladder. This is followed by instillation of the murine bladder cancer cell line (1 x 105 cells/50 &#181;L) at a rate of 10 &#181;L/20 s. The catheter is stoppered to prevent premature evacuation. After 1 h, the mice are revived with a reversal drug, and the bladder is vacated. The slow instillation rate is important, as it reduces vesico-ureteral reflux, which can cause tumors to occur in the upper urinary tract and in the kidneys. The cell line should be well re-suspended to reduce clumping of cells, as this can lead to uneven tumor sizes after implantation.
This technique induces tumors with high efficiency. Tumor growth is monitored by urinary PSA secretion. PSA marker monitoring is more reliable than ultrasound or fluorescence imaging for the detection of the presence of tumors in the bladder. Tumors in mice generally reach a maximum size that negatively impacts health by about 3 - 4 weeks if left untreated. By monitoring tumor growth, it is possible to differentiate mice that were cured from those that were not successfully implanted with tumors. With only end-point analysis, the latter may be mistakenly assumed to have been cured by therapy.

This protocol describes the generation of murine orthotopic bladder tumors in female C57BL/6J mice and the monitoring of tumor growth.

쥐 동소 이식 방광 종양 모델 및 종양 탐지 시스템

This protocol describes the generation of bladder tumors in female C57BL/6J mice using the murine bladder cancer cell line MB49, which has been modified ...

연구

암 연구학

Induction and Diagnosis of Tumors in Drosophila Imaginal Disc Epithelia

In the early stages of cancer, transformed mutant cells show cytological abnormalities, begin uncontrolled overgrowth, and progressively disrupt tissue organization. Drosophila melanogaster has emerged as a popular experimental model system in cancer biology to study the genetic and cellular mechanisms of tumorigenesis. In particular, genetic tools for Drosophila imaginal discs (developing epithelia in larvae) enable the creation of transformed pro-tumor cells within a normal epithelial tissue, a situation similar to the initial stages of human cancer. A recent study of tumorigenesis in Drosophila wing imaginal discs, however, showed that tumor initiation depends on the tissue-intrinsic cytoarchitecture and the local microenvironment, suggesting that it is important to consider the region-specific susceptibility to tumorigenic stimuli in evaluating tumor phenotypes in imaginal discs. To facilitate phenotypic analysis of tumor progression in imaginal discs, here we describe a protocol for genetic experiments using the GAL4-UAS system to induce neoplastic tumors in wing imaginal discs. We further introduce a diagnosis method to classify the phenotypes of clonal lesions induced in imaginal epithelia, as a clear classification method to discriminate various stages of tumor progression (such as hyperplasia, dysplasia, or neoplasia) had not been described before. These methods might be broadly applicable to the clonal analysis of tumor phenotypes in various organs in Drosophila.

Induction and Diagnosis of Tumors in Drosophila Imaginal Disc Epithelia

Mosaic clone analysis in Drosophila imaginal disc epithelia is a powerful model system to study the genetic and cellular mechanisms of tumorigenesis. Here we describe a protocol to induce tumors in Drosophila wing imaginal discs using the GAL4-UAS system, and introduce a diagnosis method to classify the tumor phenotypes.

종양의 유도 및 진단<em&gt; Drosophila</em&gt; 상피 디스크 상피 세포

In the early stages of cancer, transformed mutant cells show cytological abnormalities, begin uncontrolled overgrowth, and progressively disrupt tissue ...

Conditional Knockdown of Gene Expression in Cancer Cell Lines to Study the Recruitment of Monocytes/Macrophages to the Tumor Microenvironment

siRNA and shRNA-mediated knock down (KD) methods of regulating gene expression are invaluable tools for understanding gene and protein function. However, in the case that the KD of the protein of interest has a lethal effect on cells or the anticipated effect of the KD is time-dependent, unconditional KD methods are not appropriate. Conditional systems are more suitable in these cases and have been the subject of much interest. These include Ecdysone-inducible overexpression systems, Cytochrome P-450 induction system1, and the tetracycline regulated gene expression systems. 
The tetracycline regulated gene expression system enables reversible control over protein expression by induction of shRNA expression in the presence of tetracycline. In this protocol, we present an experimental design using functional Tet-ON system in human cancer cell lines for conditional regulation of gene expression. We then demonstrate the use of this system in the study of tumor cell-monocyte interaction.

This protocol serves as a scheme for setting up a functional Tet-ON system in cancer cell lines and its subsequent use, in particular for studying the role of tumor cell-derived proteins in recruitment of monocytes/macrophages to the tumor microenvironment.

암 세포 선 종양 Microenvironment에 Monocytes/대 식 세포의 모집 연구에서 유전자 발현의 조건부 최저

siRNA and shRNA-mediated knock down (KD) methods of regulating gene expression are invaluable tools for understanding gene and protein function. However, ...

The Establishment of a Lung Colonization Assay for Circulating Tumor Cell Visualization in Lung Tissues

Metastasis is the major cause of cancer death. The role of circulating tumor cells (CTCs) in promoting cancer metastasis, in which lung colonization by CTCs critically contributes to early lung metastatic processes, has been vigorously investigated. As such, animal models are the only approach that captures the full systemic process of metastasis. Given that problems occur in previous experimental designs for examining the contributions of CTCs to blood vessel extravasation, we established an in vivo lung colonization assay in which a long-term-fluorescence cell-tracer, carboxyfluorescein succinimidyl ester (CFSE), was used to label suspended tumor cells and lung perfusion was performed to clear non-specifically trapped CTCs prior to lung removal, confocal imaging, and quantification. Polymeric fibronectin (polyFN) assembled on CTC surfaces has been found to mediate lung colonization in the final establishment of metastatic tumor tissues. Here, to specifically test the requirement of polyFN assembly on CTCs for lung colonization and extravasation, we performed short term lung colonization assays in which suspended Lewis lung carcinoma cells (LLCs) stably expressing FN-shRNA (shFN) or scramble-shRNA (shScr) and pre-labeled with 20 &#956;M of CFSE were intravenously inoculated into C57BL/6 mice. We successfully demonstrated that the abilities of shFN LLC cells to colonize the mouse lungs were significantly diminished in comparison to shScr LLC cells. Therefore, this short-term methodology may be widely applied to specifically demonstrate the ability of CTCs within the circulation to colonize the lungs.

An animal model is needed to decipher the role of circulating tumor cells (CTCs) in promoting lung colonization during cancer metastasis. Here, we established and successfully performed an in vivo assay to specifically test the requirement of polymeric fibronectin (polyFN) assembly on CTCs for lung colonization.

순환 종양 세포 시각화 폐 조직에 대 한 폐 식민 분석 결과의 설립

Metastasis is the major cause of cancer death. The role of circulating tumor cells (CTCs) in promoting cancer metastasis, in which lung colonization by ...

Radionuclide-fluorescence Reporter Gene Imaging to Track Tumor Progression in Rodent Tumor Models

Metastasis is responsible for most cancer deaths. Despite extensive research, the mechanistic understanding of the complex processes governing metastasis remains incomplete. In vivo models are paramount for metastasis research, but require refinement. Tracking spontaneous metastasis by non-invasive in vivo imaging is now possible, but remains challenging as it requires long-time observation and high sensitivity. We describe a longitudinal combined radionuclide and fluorescence whole-body in vivo imaging approach for tracking tumor progression and spontaneous metastasis. This reporter gene methodology employs the sodium iodide symporter (NIS) fused to a fluorescent protein (FP). Cancer cells are engineered to stably express NIS-FP followed by selection based on fluorescence-activated cell sorting. Corresponding tumor models are established in mice. NIS-FP expressing cancer cells are tracked non-invasively in vivo at the whole-body level by positron emission tomography (PET) using the NIS radiotracer [18F]BF4-. PET is currently the most sensitive in vivo imaging technology available at this scale and enables reliable and absolute quantification. Current methods either rely on large cohorts of animals that are euthanized for metastasis assessment at varying time points, or rely on barely quantifiable 2D imaging. The advantages of the described method are: (i) highly sensitive non-invasive in vivo 3D PET imaging and quantification, (ii) automated PET tracer production, (iii) a significant reduction in required animal numbers due to repeat imaging options, (iv) the acquisition of paired data from subsequent imaging sessions providing better statistical data, and (v) the intrinsic option for ex vivo confirmation of cancer cells in tissues by fluorescence microscopy or cytometry. In this protocol, we describe all steps required for routine NIS-FP-afforded non-invasive in vivo cancer cell tracking using PET/CT and ex vivo confirmation of in vivo results. This protocol has applications beyond cancer research whenever in vivo localization, expansion and long-time monitoring of a cell population is of interest.

We describe a protocol for preclinical in vivo tracking of cancer metastasis. It is based on a radionuclide-fluorescence reporter combining the sodium iodide symporter, detected by non-invasive [18F]tetrafluoroborate-PET, and a fluorescent protein for streamlined ex vivo confirmation. The method is applicable for preclinical in vivo cell tracking beyond tumor biology.

방사성 핵 종 형광 취재 원 유전자 설치류 종양 모델에서 종양의 진행을 추적 하기 위해 이미징

Metastasis is responsible for most cancer deaths. Despite extensive research, the mechanistic understanding of the complex processes governing metastasis ...

Acellular and Cellular Lung Model to Study Tumor Metastasis

It is difficult to isolate tumor cells at different points of tumor progression. We created an ex vivo lung model that can show the interaction of tumor cells with a natural matrix and continual flow of nutrients, as well as a model that shows the interaction of tumor cells with normal cellular components and a natural matrix. The acellular ex vivo lung model is created by isolating a rat heart-lung block and removing all the cells using the decellularization process. The right main bronchus is tied off and tumor cells are placed in the trachea by a syringe. The cells move and populate the left lung. The lung is then placed in a bioreactor where the pulmonary artery receives a continual flow of media in a closed circuit. The tumor grown on the left lung is the primary tumor. The tumor cells that are isolated in the circulating media are circulating tumor cells and the tumor cells in the right lung are metastatic lesions. The cellular ex vivo lung model is created by skipping the decellularization process. Each model can be used to answer different research questions.

Here, we present a protocol for an ex vivo lung cancer model that mimics the steps of tumor progression and helps to isolate a primary tumor, circulating tumor cells, and metastatic lesions.

Acellular과 세포 폐 종양 전이 연구 모델

It is difficult to isolate tumor cells at different points of tumor progression. We created an ex vivo lung model that can show the interaction of tumor ...

Digital Polymerase Chain Reaction Assay for the Genetic Variation in a Sporadic Familial Adenomatous Polyposis Patient Using the Chip-in-a-tube Format

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as tumors. Because digital polymerase chain reactions (PCR) enable the precise quantification of DNA copy number variants, they are becoming an essential tool for detecting rare genetic variations, such as drug-resistant mutations. It is expected that molecular diagnoses using digital PCR (dPCR) will be available in clinical practice in the near future; thus, how to efficiently conduct dPCR with human genetic material is a hot topic. Here, we introduce a method to detect Adenomatous polyposis coli (APC) somatic mosaicism using dPCR with the chip-in-a-tube format, which allows eight dPCR reactions to be simultaneously conducted. Care should be taken when filling and sealing the reaction mixture on the chips. This article demonstrates how to avoid the over- and underestimation of positive partitions. Furthermore, we present a simple procedure for collecting the dPCR product from the partitions on the chips, which can then be used to confirm the specific amplification. We hope that this methods report will help promote the dPCR with the chip-in-a-tube method in genetic research.

Digital polymerase chain reaction (PCR) is a useful tool for the high-sensitivity detection of single nucleotide variants and DNA copy number variants. Here, we demonstrate key considerations for measuring rare variants in the human genome using digital PCR with the chip-in-a-tube format.

튜브에 칩 형식을 사용 하 여 산발적 인 가족 용 대 환자에 있는 유전 변이 대 한 디지털 중 합 효소 연쇄 반응 분석 결과

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as ...

Investigation of Genetic Dependencies Using CRISPR-Cas9-based Competition Assays

Gene perturbation studies have been extensively used to investigate the role of individual genes in AML pathogenesis. For achieving complete gene disruption, many of these studies have made use of complex gene knockout models. While these studies with knockout mice offer an elegant and time-tested system for investigating genotype-to-phenotype relationships, a rapid and scalable method for assessing candidate genes that play a role in AML cell proliferation or survival in AML models will help accelerate the parallel interrogation of multiple candidate genes. Recent advances in genome-editing technologies have dramatically enhanced our ability to perform genetic perturbations at an unprecedented scale. One such system of genome editing is the CRISPR-Cas9-based method that can be used to make rapid and efficacious alterations in the target cell genome. The ease and scalability of CRISPR/Cas9-mediated gene-deletion makes it one of the most attractive techniques for the interrogation of a large number of genes in phenotypic assays. Here, we present a simple assay using CRISPR/Cas9 mediated gene-disruption combined with high-throughput flow-cytometry-based competition assays to investigate the role of genes that may play an important role in the proliferation or survival of human and murine AML cell lines.

This manuscript describes a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) CRISPR-Cas9-based method for simple and expeditious investigation of the role of multiple candidate genes in Acute Myeloid Leukemia (AML) cell proliferation in parallel. This technique is scalable and can be applied in other cancer cell lines as well.

CRISPR-Cas9-기반 경쟁 분석 실험을 사용 하 여 유전 종속성의 조사

Gene perturbation studies have been extensively used to investigate the role of individual genes in AML pathogenesis. For achieving complete gene ...

The Clinical Application of Tumor Treating Fields Therapy in Glioblastoma

Glioblastoma is the most common and lethal form of brain cancer, with a median survival of 15 months after diagnosis and a 5 year survival rate of only 5% with current standard of care. Tumors often recur within 9 months following initial surgery, radiation and chemotherapy, at which point treatment options become limited. This highlights the pressing need for the development of better therapeutics to prolong survival and increase the quality of life for these patients.
Tumor Treating Fields (TTFields) therapy was developed to take advantage of the effect of low frequency alternating electrical fields on cells for cancer therapy. TTFields have been demonstrated to disrupt cells during mitosis and slow tumor growth. There is also growing evidence that they act through stimulating immune responses within exposed tumors. The advantages of TTFields therapy include its noninvasive approach and increased quality of life compared to other treatment modalities such as cytotoxic chemotherapies. The Food and Drug Administration approved TTFields therapy for the treatment of recurrent glioblastoma in 2011 and for newly diagnosed glioblastoma in 2015. We report on the effects of TTFields during mitosis, the results of electric fields modeling, and proper transducer array placement. Our protocol outlines the clinical application of TTFields on a patient post-surgery, using the second-generation device.

Glioblastoma is the most common and aggressive primary brain malignancy in adults, with most tumors recurring after initial treatment. Tumor Treating Fields (TTFields) therapy is the newest treatment modality for glioblastoma. Here, we describe the proper application of TTFields-transducer arrays on patients and discuss theory and aspects of treatment.

종양 세포종 필드 치료 치료의 임상 적용

Glioblastoma is the most common and lethal form of brain cancer, with a median survival of 15 months after diagnosis and a 5 year survival rate of only 5% ...

Detection and Monitoring of Tumor Associated Circulating DNA in Patient Biofluids

Complications associated with upfront and repeat surgical tissue sampling present the need for minimally invasive platforms capable of molecular sub-classification and temporal monitoring of tumor response to therapy. Here, we describe our dPCR-based method for the detection of tumor somatic mutations in cell free DNA (cfDNA), readily available in&#160;patient biofluids. Although limited in the number of mutations that can be tested for in each assay, this method provides a high level of sensitivity and specificity. Monitoring of mutation abundance, as calculated by MAF, allows for the evaluation of tumor response to therapy, thereby providing a much-needed supplement to radiographic imaging.

Here, we present a protocol to detect tumor somatic mutations in circulating DNA present in patient biological fluids (biofluids). Our droplet digital polymerase chain reaction (dPCR)-based method enables quantification of the tumor mutation allelic frequency (MAF), facilitating a minimally invasive complement to diagnosis and temporal monitoring of tumor response.