Name: use of a recombinant mosquito densovirus as a gene delivery vector for the functional analysis of genes in mosquito larvae
Uploaded: 2017-10-06T13:00:00.000+00:00
Duration: 12 min 30 s
Description: Watch this Scientific Journal Video about Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae at JoVE.com

저자는 국가 주요 연구 및 개발 프로그램의 중국에서 재정 지원을 인정 (샤 오 Guang 첸에 2016YFC1200500), 국립 자연 과학 재단의 중국 (81672054 및 81371846), 자연의 연구 팀 프로그램 광 (2014A030312016)의 과학 재단 하 고 광주 (201508020263)의 과학 및 기술 프로그램. 친절 하 게 촬영 및 p7NS1 GFP 플라스 미드를 제공 하 고 비판적으로이 원고를 읽고 우리는 기꺼이 교수 조나단 칼 슨 (콜로라도 주립 대학)을 인정 합니다.

모든 프로토콜 윤리 위원회의 남부 의료 대학에 의해 승인 했다.
 1. 인공 Intron 설계 참고:이 작업에 사용 되는 인공 intron는 65 길이, 및 순서에 혈압이 5 &#39;-GTAAGAGTCGATCGACGCGTTACTAACTGGTACCTCTTCTTTTTTTTTTGATATCCTGCAG-3 &#39;.
<ol><li>Hpa 배치 나 제한 사이트 인공 intron의 양쪽 끝에 그래서 그 Hpa 나 소화 플라스 미드 ( 그림 1 참조)에서 intron을 해제할 수 있습니다.</li>
	<li>장소 두 Xba 나 제한 사이트는 intron에서 그래서 그 Xba 나 소화 작은 RNA 식 시퀀스를 삽입 하는 데 사용할 수 있습니다.</li>
	<li>는 DNA 제조 업체에서 인공 intron의 전장 DNA 시퀀스의 화학 합성을 주문. 합성 DNA 생성은 표준 pUC19 플라스 미드에 클로닝에서. 
	참고: 인공 intron의 필수 구성 요소 포함 5를 포함 하 여 여러 합의 뉴클레오티드 요소, &#39; GUAAGAGU, UACUAAC, 폴 리 pyrimidine 순서 보존된 지점 포인트 시퀀스 (BPS) 시퀀스와 기증자 스플라이스 사이트 (DS) 로 (PPT) 10 시퀀스 UCUUC(U) 3 &#39;-수락자 스플라이스 사이트 (AS) 시퀀스 GAUAUCCUGCAG ( 그림 1 A). 두 개의 Xba 나 제한 사이트 DS와 작은 RNA 식 시퀀스를 삽입 하는 데 사용할 수 있는 BPS 사이 소개 되었다. 이 인공 intron 포유류와 모기 세포에서 효과적으로 결합 하는 능력 이전 확인된 14 되었습니다.</li>
</ol> 2. 설계는 인공 Intronic 작은 RNA 식 카세트 참고: overexpression 또는 생 miRNA의 최저, 전조 미르 미르 스폰지를 인코딩 시퀀스 DS와 BPS 사이 삽입 했다. 예를 들어, 봉사 애 albopictus aal-하자-7에서 생 전조 미르 미르 overexpression 및 최저 재조합 형 바이러스 성 벡터를 생성 선정 됐다. 반대로 let 7 스폰지는 앞에서 설명한 방법 15에 따라 설계 되었습니다. 애벌레에서 대상 유전자를 허물고, 우리 설계 된 특정 인공 미르 (amiRNA) 또는 온라인 소프트웨어 16 , 17;를 사용 하 여 짧은 헤어핀 RNA (shRNA) 순서 예를 들어, V ATPase 소 단위를 mRNA 역할을 (취득 no. AY864912)는이 연구에서 유전자를 대상으로 선정 됐다. amiRNA 것입니다 라고 하 amiVTP이. 사전-미르, 스폰지, amiRNA, 및 shRNA 모든 시퀀스 세부 사항을 보충 표 1에 설명 되어 있습니다.
<ol><li>전조 miRNAs, 미르 스폰지, 및 Xba와 shRNA의 전장 cDNA 시퀀스의 화학 합성 주문 나 DNA 제조 업체에서 양쪽 끝에 제한 사이트.</li>
	<li>정렬 된 DNA, 스핀 10000-14000 x DNA 블록을 포함 하는 관을 받은 후 g 모두 DNA 건조 되도록 1 분에 대 한 튜브의 하단에는.</li>
	<li>10 ng / µ L의 최종 농도 달성 하기 위해 DNase 무료 물에 말린된 DNA resuspend.</li>
	<li>소화 플라스 미드 백본 및 DNA 시퀀스를 Xba와 내가 1 시간 동안 37 ° C에서 그리고 다음 5 dephosphorylate &#39;와 종 아리 장 알칼리 성 인산 가수분해 효소 (CIAP) 제조 업체에 따라 선형화 플라스 미드 등뼈의 끝 &#39; s 프로토콜 .</li>
	<li>65에서 60 분이 열에 의해 비활성화 CIAP ° c.</li>
	<li>는 1.0 %agarose 젤을 실행 하 고 선형화 등뼈를 잘라. 다음 제조 업체에 따라 젤 추출 키트를 사용 하 여 젤 조각에서 DNA를 추출 &#39; s 지침.</li>
	<li>Ligate 1 h. 22 ° C에서 backboneby T4 DNA 리가 (5 U / µ L)으로 DNA 조각</li>
	<li>유능한 대장균 (대장균)에 2.7 단계 세포 및 암 피 실린 (100 µ g/mL의 농도)에 포함 된 Lysogeny 국물 (파운드) 한 접시에 접시에서 결 찰 반응의 제품은 변환.
	<ol><li>수행 열 충격 방법 18를 사용 하 여 적절 한 대장균을 통해 변환 스트레인. 예를 들어 대장균 긴장 DH5α를 사용 하 여 열 충격 변화에 대 한.</li>
	</ol></li> <li>선택에서 단일 식민지 2.8 고 3 mL의 문화에서 품 어 농축 (100 µ g/mL의 농도)에서 중간 포함 암 피 실린.</li>
	<li>제조 업체에 따라 소형 예비 키트를 사용 하 여 세균성 문화에서 플라스 미드 DNA를 추출 &#39; s 지시. DNA 시퀀싱 회사 샘플 보내기. 
	참고: overexpression 또는 생 miRNA의 최저, 전조 미르 미르 스폰지를 인코딩 시퀀스 삽입 되었다 2 사이 Xba 나 사이트. 모든 미르 식 또는 스폰지 구조 400 보다 짧은 있어야 바이러스 19의 포장 제한 때문에 bp (바이러스 성 게놈 길이의 10%).</li>
</ol> 3. RAeaDV 구문 생성 하 플라스 미드 등뼈로 미르 또는 shRNA 식 카세트를 복제 참고: 촬영, 촬영 플라스 미드 포함 하는 AaeDV 게놈의 구성 하는 전염 성 클론 (3,981 nt) 19, 친절 하 게 교수 조나단 칼 슨에 의해 제공 되었다 고 이전 세부 사항 11에서 설명 하고있다. 비 구조 단백질 1 (NS1)를 표현 하는 p7NS1-DsRed-p7 발기인에서 빨간 형광 성 단백질 (DsRed) 융합 단백질 되었습니다 자세히 다른 14 설명. 인간 전용 미르-941-1 전조 20와 그것의 스폰지, 스크램블된 shRNA (CGACGACTATCGTGCAATTTCAAGAG AATTGCACGATAGTCGTCG), 또한 부정적인 제어로 AaeDV에 subcloned 했다.
<ol><li>Pre-미르, 스폰지, shRNA 또는 amiVTP 식 카세트 Hpa 사이트에 선의 촬영 플라스 미드 백본 프로토콜 단계 2.4 2.7에에서 설명 된 대로 AaeDV NS1 코딩 영역.</li>
	<li>유능한 대장균 세포 및 단계 2.8 2.10에서에서 설명한 대로 긍정적인 클론을 선택 Stbl3 DNA 변환.</li>
	<li>제조 업체에 따라 맥시 준비 키트를 사용 하 여 세균 세포에서 rAaeDV 플라스 미드 추출, 다음 &#39; s 지침. 
	참고: Stbl3 또는 Stbl4 대장균 세포 원치 않는 ITR 재결합을 최소화 하기 위해 rAaeDV DNA 변환에 대 한 활용 되어야 합니다. 맥시 prep rAaeDV 플라스 미드 DNA의 대량을 추출 하는 데 사용할 해야 (&#62; 100 µ g). 바이러스를 생성 하기 전에 rAaeDV 플라스 미드의 시퀀스 무결성 분석 해야 합니다 항상 여 DNA 시퀀싱 21.</li>
</ol> 4. RAaeDV 플라스 미드와 transfecting C6/36 셀 <ol><li>문화 C6/36 세포 로스웰 파크 기념 연구소 (RPMI) 1640 매체 10% 태아 둔감 한 혈 청 (FBS)와 28 ° C 배양 기에서 1% 페니실린/스 포함.</li>
	<li>0 일에 접시 10 25 cm 2 문화 플라스 크에 세포 transfection 90-95%는 1:2 희석에 confluent 셀을 분할 하기 전에 18-20 h. 
	참고: 하루 1, 셀에 도달 해야 90-95% 합류.</li>
	<li>하루에 1, rAaeDV 플라스 미드 22 시리즈와 셀 transfect.
	<li><ol>Microcentrifuge 튜브에서 RPMI 1640 매체의 600 µ L에 10 µ g의 DNA를 희석 하 고 부드럽게 혼합. 한편, RPMI 1640 매체의 600 µ L 25 µ L 당 transfection transfection 시 약의 준비.</li>
		<li>품 실 온 (RT)에서 5-10 분 그런 다음, 1640-플라스 미드 DNA 혼합물에 1640 transfection 시 혼합물의 625 µ L를 추가.</li>
		<li>는 실시간에 20-30 분 동안이 혼합물을 품 어 Transfection, 전에 씻어 RPMI 1640 매체의 2 mL로 두 번 셀.</li>
		<li>RT 후 보육 (4.3.3 단계), 25 cm 2 문화 플라스 크를 the1640 transfection 시 DNA 플라스 미드 혼합물을 추가 하 고 28에서 6 h에 대 한 품 어 ° c.</li>
		<li>약 6 h 후 transfection에 제거 transfection 미디어 RPMI 1640 매체의 5 mL로 두 번 셀을 세척 하 고 10%와 RPMI 1640 매체 추가 FBS. 
		그러나 참고: rAaeDV Ae albopictus 애벌레 감염 (95%)의 높은 속도에서는,, 우리의 경험에서는, 감염 된 애벌레의 거의 50%에서 감염 없이 1 차 감염 사이트 (예를 들어, 항문 용의자와 다름 셀)에 제한 했다 보급 23. 따라서, 여러 조직에서 애벌레를 감염 시킬 필요가 있는 경우에, 형광 단백질을 표현 하는 결함이 재조합 바이러스 감염 사이트의 시각화 수 있도록 공동 감염 되어야 합니다. 예를 들어 DsRed을 표현 하는 결함이 있는 재조합 바이러스 생산, p7NS1-DsRed 위에서 설명한 절차에 따라 C6/36 세포로 도우미 플라스 미드와 공동 transfected 이어야 한다 (cotransfection 농도 비율 2:1 이어야 함).</li>
	</ol></li></ol> 5. 페 C6/36 세포에서 rAaeDV Virions 수확 <ol><li>수확 세포 transfection 후 5 일. 꺼내 려 하 고 5 mL 유리 dropper, 문화 매체를 위아래로 pipetting으로 요리에 셀 중단. 모든 셀 정지 균 15 mL 튜브에 전송.</li>
	<li>-80 ° C에서 드라이 아이스/에탄올 목욕 30 분에 고정 하 고 37에 녹여 다음 1 분에 대 한 ° C. 소용돌이 동결 및 해 동 절차 3 번 반복.</li>
	<li>원심 4 °C.Collect은 상쾌한에 20 분 동안 4800 x g에서 샘플 하 고 펠 릿을 삭제. 그런 다음는 상쾌한 통과 0.22 μ m 일회용 주사기 필터. 최종 정제 virion-80에서 주식 약 수 및 저장소 ° c. 
	참고: 반복된 freeze-thaw 주기 방지.</li>
</ol> 6. RAaeDV 측정 <ol><li>준비 DNA 표준. 선형화 Hpa와 모든 rAaeDV 플라스 미드 나, 젤 추출 키트 24 소화 제품을 정화.</li>
	<li>절대 양적 표준 곡선을 생성 하 고 앞에서 설명한 방법 25에 따라 바이러스 titer 측정.</li>
</ol> 7. 모기 변환 <ol><li>세척 100 1 세인트 탈피 Ae albopictus 애벌레 세 번 사용 하 여 이온 물, 그리고 다음, 95 이온된 물 들어 있는 비 커에 애벌레를 전송. RAaeDV 주식 (최종 농도 10 복사본/10ml x 1.00)의 5 mL을 추가.</li>
	<li>품 어 24 28 ° c, h 이온된 수를 사용 하 여 시간 3 애벌레를 세척 하 고 다음 애벌레는 접시에 다시 전송 하 고 정기적으로 피드.</li>
	<li>모니터링 정량 또는 서쪽 오 점 (대표 결과 그림 3과 4에 나와 있습니다) 애벌레에 대상 유전자 발현의 수준. 
	참고: 형광 신호 검출 방식 보다 정확 하 게 감염 된 유 충을 사용할 수 있습니다. 예를 들어 DsRed을 표현 하는 재조합 형 바이러스에 감염 된 애벌레에서 형광 신호를 감지, 애벌레 수 오목 함 슬라이드에 배치 되며 감염 된 후 2 일까지 모든 8 h는 거꾸로 형광 현미경 관찰. 형광 애벌레 감지 되 면 이후 지속적인 관찰 수 있도록 개별 플라스틱 테스트 컵으로 분리 되어야 한다. 이 메서드를 사용 하 여 여러 조직 감염 된 애벌레를 확인할 수 있습니다.</li>
</ol>

<ol>
	<li>Tolle, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosquito-borne+diseases.">Mosquito-borne diseases.</a> Current problems in pediatric and adolescent health care. 39, 97-140 (2009).</li><li>Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+Virus.">Zika Virus.</a> The New England journal of medicine. 374, 1552-1563 (2016).</li><li>Roberts, D. R., Andre, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insecticide+resistance+issues+in+vector-borne+disease+control.">Insecticide resistance issues in vector-borne disease control.</a> The American journal of tropical medicine and hygiene. 50, 21-34 (1994).</li><li>Attaran, A., Roberts, D. R., Curtis, C. F., Kilama, W. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Balancing+risks+on+the+backs+of+the+poor.">Balancing risks on the backs of the poor.</a> Nature medicine. 6, 729-731 (2000).</li><li>Volohonsky, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+Expression+of+the+Anti-parasitic+Factor+TEP1+in+the+Malaria+Mosquito+Anopheles+gambiae.">Transgenic Expression of the Anti-parasitic Factor TEP1 in the Malaria Mosquito Anopheles gambiae.</a> PLoS pathogens. 13, 1006113 (2017).</li><li>Galizi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+sex+ratio+distortion+system+for+the+control+of+the+human+malaria+mosquito.">A synthetic sex ratio distortion system for the control of the human malaria mosquito.</a> Nature communications. 5, 3977 (2014).</li><li>Bourtzis, K., Lees, R. S., Hendrichs, J., Vreysen, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=More+than+one+rabbit+out+of+the+hat:+Radiation,+transgenic+and+symbiont-based+approaches+for+sustainable+management+of+mosquito+and+tsetse+fly+populations.">More than one rabbit out of the hat: Radiation, transgenic and symbiont-based approaches for sustainable management of mosquito and tsetse fly populations.</a> Acta tropica. 157, 115-130 (2016).</li><li>Kumar, S. S., Puttaraju, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improvised+microinjection+technique+for+mosquito+vectors.">Improvised microinjection technique for mosquito vectors.</a> The Indian journal of medical research. 136, 971-978 (2012).</li><li>Attardo, G. M., Higgs, S., Klingler, K. A., Vanlandingham, D. L., Raikhel, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference-mediated+knockdown+of+a+GATA+factor+reveals+a+link+to+anautogeny+in+the+mosquito+Aedes+aegypti.">RNA interference-mediated knockdown of a GATA factor reveals a link to anautogeny in the mosquito Aedes aegypti.</a> Proceedings of the National Academy of Sciences of the United States of America. 100, 13374-13379 (2003).</li><li>Singh, A. D., Wong, S., Ryan, C. P., Whyard, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+delivery+of+double-stranded+RNA+in+larvae+of+the+yellow+fever+mosquito,+Aedes+aegypti:+implications+for+pest+mosquito+control.">Oral delivery of double-stranded RNA in larvae of the yellow fever mosquito, Aedes aegypti: implications for pest mosquito control.</a> Journal of insect science. 13, 69 (2013).</li><li>Ward, T. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aedes+aegypti+transducing+densovirus+pathogenesis+and+expression+in+Aedes+aegypti+and+Anopheles+gambiae+larvae.">Aedes aegypti transducing densovirus pathogenesis and expression in Aedes aegypti and Anopheles gambiae larvae.</a> Insect molecular biology. 10, 397-405 (2001).</li><li>Carlson, J., Suchman, E., Buchatsky, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Densoviruses+for+control+and+genetic+manipulation+of+mosquitoes.">Densoviruses for control and genetic manipulation of mosquitoes.</a> Advances in virus research. 68, 361-392 (2006).</li><li>Barreau, C., Jousset, F. X., Bergoin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogenicity+of+the+Aedes+albopictus+parvovirus+(AaPV),+a+denso-like+virus,+for+Aedes+aegypti+mosquitoes.">Pathogenicity of the Aedes albopictus parvovirus (AaPV), a denso-like virus, for Aedes aegypti mosquitoes.</a> Journal of invertebrate pathology. 68, 299-309 (1996).</li><li>Liu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+non-defective+recombinant+densovirus+vectors+for+microRNA+delivery+in+the+invasive+vector+mosquito,+Aedes+albopictus.">Development of non-defective recombinant densovirus vectors for microRNA delivery in the invasive vector mosquito, Aedes albopictus.</a> Scientific reports. 6, 20979 (2016).</li><li>Ortega, M. M., Bouamar, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guidelines+on+Designing+MicroRNA+Sponges:+From+Construction+to+Stable+Cell+Line.">Guidelines on Designing MicroRNA Sponges: From Construction to Stable Cell Line.</a> Methods in molecular biology. 1509, 221-233 (2017).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+plasmid+DNA+into+E.+coli+using+the+heat+shock+method.">Transformation of plasmid DNA into E. coli using the heat shock method.</a> Journal of visualized experiments : JoVE. , e253 (2007).</li><li>Afanasiev, B. N., Kozlov, Y. V., Carlson, J. O., Beaty, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Densovirus+of+Aedes+aegypti+as+an+expression+vector+in+mosquito+cells.">Densovirus of Aedes aegypti as an expression vector in mosquito cells.</a> Experimental parasitology. 79, 322-339 (1994).</li><li>Hu, H. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolution+of+the+human-specific+microRNA+miR-941.">Evolution of the human-specific microRNA miR-941.</a> Nature communications. 3, 1145 (2012).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proceedings of the National Academy of Sciences of the United States of America. 74, 5463-5467 (1977).</li><li>Dalby, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advanced+transfection+with+Lipofectamine+2000+reagent:+primary+neurons,+siRNA,+and+high-throughput+applications.">Advanced transfection with Lipofectamine 2000 reagent: primary neurons, siRNA, and high-throughput applications.</a> Methods (San Diego, Calif). 33, 95-103 (2004).</li><li>Gu, J. B., Dong, Y. Q., Peng, H. J., Chen, X. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+recombinant+AeDNA+containing+the+insect-specific+toxin,+BmK+IT1,+displayed+an+increasing+pathogenicity+on+Aedes+albopictus.">A recombinant AeDNA containing the insect-specific toxin, BmK IT1, displayed an increasing pathogenicity on Aedes albopictus.</a> The American journal of tropical medicine and hygiene. 83, 614-623 (2010).</li><li>Hou, Y., Zhang, H., Miranda, L., Lin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serious+overestimation+in+quantitative+PCR+by+circular+(supercoiled)+plasmid+standard:+microalgal+pcna+as+the+model+gene.">Serious overestimation in quantitative PCR by circular (supercoiled) plasmid standard: microalgal pcna as the model gene.</a> PloS one. 5, 9545 (2010).</li><li>Ding, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+rAAV9+to+Overexpress+or+Knockdown+Genes+in+Mouse+Hearts.">Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts.</a> Journal of visualized experiments : JoVE. , (2016).</li></ol>

저자 들은 아무 경쟁 금융 관심사 선언 합니다.

그것은 두 rAaeDV 건설을 제한 하는 주요 장벽을 극복 하는 것이 중요입니다. 첫 번째 결함 재조합 바이러스의 생산 이다. 그것은 알려졌다 적절 하 게 표현 하는 벡터 크기의 GFP 단백질; 전갈 곤충 전용 neurotoxins20 등 외국 유전자 MDV를 사용할 수 있습니다. 그러나, 건설 전략에 MDV ORFs 삽입 또는 세 유전자를 대체 하는 일단 virions 형성할 수 없습니다 독립적으로 도우미 플라스 미드 누락 된 필수적인 ?...

모기-품 어진 질병 말라리아, 황열병, 뎅기열, zika 발열 등은 계속 글로벌 전염 성 질병 부담1,2의 중요 한 일부분을 담당 하는 주요 국제 공중 보건 문제입니다. 벡터에 대 한 응답에 사용 된, 전통적인 살충제 모기 품 어진 질병의 예방에 대 한 지속 가능한 통합된 모기 제어 전략의 주요 구성 요소입니다. 그러나, 이러한 전략 상대적으로 효과 없는 또는 관련된 부정적인 환경에 미치는 영향 뿐만 아니라 모기 인구3,4내성의 진화로 인해 원하지 않는 것을 입증 했다. 이러한 이유로, 모기의 다른 방법에 대 한 긴급 한 필요 제어 및 불 임 남성 모기를 생산 하는 유전자 변형 방법의 사용 이며 병원 체 저항 모기의 릴리스 유망한 새로운 제어 전략으로 발현. 개발 효과적인 새로운 컨트롤 방법, vivo에서 유전자 전달 모기 유전자 기능의 포괄적인 분석에 대 한 안전 하 고 효과적인 방법으로 필요한 같은.
플라스 미드 DNA, 더블의 직접 microinjection RNA (dsRNA) 좌초 또는 작은 간섭 RNA (siRNA)는 가장 일반적으로 사용 되 vivo에서 유전자 전달 방법 모기에. 사실, 모기의 유전자 변형 종자의 생산 여전히 태아 microinjection5,,67의 과정에 의존 합니다. 그러나, microinjection는 몇 가지 제한이 있습니다. 첫째,이 기술은 기술적으로 요구 하 고 복잡 한 절차를 포함 한다. 둘째, 주입 하면 태아, 애벌레, pupae, 및 성인 대상 생물의 생존에 직접적인 영향을 실제 모욕. 셋째, 대부분 수 중 서식 지에서 살고 먹 운동 특성을가지고 있기 때문에 microinjection에 대 한 모기 유 충을 무력화 하기가 어렵습니다. 넷째, 1st-2nd 탈피 애벌레의 크기는 10-에 20 배 작은 4번째 보다 탈피 및 오래 된 애벌레, 그리고 전 손톱 더 섬세 한. 이러한 기능 1st-2nd 탈피 애벌레 이전 단계에서 그들에 비해 조작 하기 어려울. 결합, 이러한 요소는 애벌레 (약 5%) 성인8에 비해 감소 후 주입 생존 율에 기여 한다. 바이러스 성 기반 전달 시스템 관련된 extracellular와 세포 장벽을 극복 하기 위해 개발 되었습니다. 이러한 시스템 쉬운 조작, 높은 변환 효율, 장기와 강력한 식의 수준과 영구 효과 vivo에서생산 하는 것의 이점이 있다. 따라서, 유전자 전달 시스템 활용 레트로 바이러스, lentiviruses, adenoviruses 널리 되었습니다 사용 모델 종 inmammalian 세포 라인. Sindbis 바이러스 식 시스템 이전 성인 모기;에 유전자 기능을 분석 하는 데 사용 되었다는 그러나 biosafety 관심사 외, 주입은 여전히 바이러스 감염9필요한 과정. DsRNA 해결책에 애벌레를 몸을 담글 하 여 구두 납품은으로 알려졌다 이전 가능한 전달 방법으로, 비록 작은 RNA 기능 분석10위해 적당 하다. 그래서, 효과적인 바이러스 전달 방법 아직도 모기에 대 한 개발 해야 합니다.
모기 densoviruses (MDVs) Parvoviridae, 그리고 Brevidensovirus11속에서 하나를 제외한 모든가 Densovirinae subfamily의 일부입니다. MDV virions 비 싸여 있으며 단일 가닥 DNA (ssDNA) 게놈과 icosahedral capsid의 구성 (20 nm 직경에서). 바이러스 성 게놈 크기에 약 4kb 이며 호스트 세포의 핵 내에서 복제 됩니다. MDVs 환경에서 상대적으로 안정 하 고 모기에 대 한 높은 특이성으로 좁은 호스트 범위를 보여. 이 바이러스를 확산 하 고 모기 인구에서 자연스럽 게 지속 가능성 있고 거의 모든 장기와 조직 midgut, 말 tubules, 뚱뚱한 몸, 근육, 신경, 그리고 침 샘12를 포함 하 여 이러한 곤충의 침입 수 있습니다.
그대로 MDV 유전자를 플라스 미드 기반의 전염 성 클론; 생성 하 플라스 미드 벡터에 subcloned 수 있습니다. 이러한 모기 세포에 배달, 바이러스 성 게놈 플라스 미드 벡터에서 추출 되 고 전염 성 바이러스 입자를 생산 됩니다. MDV 작은 ssDNA 게놈 있기 때문에, 전염 성 클론은 쉽게 건설 하 고 바이러스 성 게놈 쉽게 조작된11,13를 수 있습니다. 이러한 특성 모기 생물학 검토를 위해 귀중 한 에이전트 MDV 확인 합니다. 그러나, 바이러스 성 게놈 시퀀스의 거의 모든 바이러스 확산을 위해 필수적 이다, 때문에 교체를 통해 재조합 바이러스의 생성 또는 외국 유전자의 삽입 하면 손실 바이러스 성 포장 및/또는 복제 능력에 만듭니다 있는 유전자 납품 벡터로 MDVs의 개발에 대 한 장벽 했다. 여기, 우리는 인공 intronic 작은 RNA 식 전략을 사용 하 여 시스템을 개발 비 결함 rAaeDV vivo에서 RNA 배달은 쉽게 플라스 미드 건설의 이점 및 생성할 수 있는 기능 바이러스의 유지 보수를 보고 야생 형 바이러스에 대 한 필요 없이 호스트 세포에 안정적이 고 장기적인 식입니다. 또한이 메서드는 애벌레의 쉬운 변환에 대 한 수 있습니다.
다음 단계에 대 한 프로토콜은이 연구에서 설명 하는: 1) rAaeDVs 인코딩 intronic 작은 RNA 식 카세트, C6/36 포장 셀을 사용 하 여 재조합 바이러스 입자의 2) 생산의 디자인 라인, 셀 무료의 3) 정량 분석 rAaeDV 게놈 숫자, 및 4 복사) Ae albopictus 애벌레 애벌레 서식 지의 물 몸으로 바이러스의 직접 소개에 의해의 감염. 전반적으로,이 작품에는 특정 작은 RNAs 또는 대상 유전자 overexpressed 하거나 수 개발된 MDV 전달 시스템을 사용 하 여 모기 애벌레에 뜨 시연 했다.

<table><tbody><tr><td>Centrifuge machine</td><td>Thermo Scientific</td><td>75004260</td><td></td></tr><tr><td>Centrifuge System</td><td>Beckman Coulter</td><td>363118</td><td></td></tr><tr><td>GeneJET Gel Extraction Kit</td><td>Thermo Scientific</td><td>K0691</td><td></td></tr><tr><td>E.Z.N.A. Plasmid Midi Kit</td><td>Omega Biotech</td><td>D6904</td><td></td></tr><tr><td>Purified Agar</td><td>OXOID</td><td>LP0028A</td><td></td></tr><tr><td>FastAP Thermosensitive Alkaline Phosphatase (1 U/&amp;micro;L)</td><td>Thermo Scientific</td><td>EF0651</td><td></td></tr><tr><td>FastDigest &lt;em&gt;HpaI&lt;/em&gt;</td><td>Thermo Scientific</td><td>FD1034</td><td></td></tr><tr><td>FastDigest &lt;em&gt;XbaI&lt;/em&gt;</td><td>Thermo Scientific</td><td>FD0684</td><td></td></tr><tr><td>T4 DNA Ligase (5 U/&amp;micro;L)</td><td>Thermo Scientific</td><td>EL0011</td><td></td></tr><tr><td>TransStbl3 Chemically Competent Cell</td><td>Beijing Transgen Biotech</td><td>CD521-01</td><td></td></tr><tr><td>Ampicillin&amp;nbsp;</td><td>Beijing Tiangen Biotech</td><td>RT501</td><td></td></tr><tr><td>Proteinase K</td><td>Promega</td><td>MC5008</td><td></td></tr><tr><td>SuperReal PreMix Plus (SYBR Green)</td><td>Beijing Tiangen Biotech</td><td>FP205</td><td></td></tr></tbody></table>

use of a recombinant mosquito densovirus as a gene delivery vector for the functional analysis of genes in mosquito larvae

Vivo에서 microinjection 개별 모기의 유전자 기능 분석을 위한 가장 일반적으로 사용 되 진 전송 기술입니다. 그러나,이 방법을 기술적으로 요구 하는 작업이 더 필요 하 고 그들의 작은 크기, 상대적으로 얇고 깨지기 쉬운 표 피 및 높은 사망률, 그것의 응용 프로그램을 제한 하는 애벌레에서 사용 하는 경우에 특히 복잡 한 절차를 포함. 반면, 유전자 배달에 대 한 바이러스 성 벡터 extracellular와 세포 장벽을 극복 하 개발 되었습니다. 이러한 시스템 쉬운 조작, 높은 유전자 전달 효율, 유전자 발현의 장기적인 유지 관리 및 영구 효과 vivo에서생산 하는 것의 이점이 있다. 모기 densoviruses (MDVs)는 효과적으로 모기 세포;로 외국 핵 산을 제공할 수 있는 모기 관련, 작은 단일 가닥 DNA 바이러스 그러나, 교체 또는 일반적으로 재조합 바이러스를 만드는 외국 유전자의 삽입으로 배달 벡터가이 바이러스의 개발에 장애가 포장 또는 복제 능력의 손실을 발생 합니다.
여기, 우리가 아닌 결함 재조합 Aedes aegypti densovirus (AaeDV) vivo에서 전달 시스템을 개발 하는 인공 intronic 작은 RNA 식 전략을 사용 하 여 보고 합니다. 건설, 포장 및 rAaeDV 벡터의 정량 분석 그리고 애벌레 감염에 대 한 자세한 절차를 설명 합니다.
이 학문은 설명 한다, 처음으로 비 결함 재조합 MDV 마이크로 RNA (miRNA) 식 시스템 개발, 따라서 모기에서 유전자의 기능 분석을 위한 강력한 도구를 제공 하 고 기본 설정의 타당성은 모기 품 어진 질병을 제어 하기 위한 바이러스 paratransgenesis의 응용 프로그램. 우리는 Aedes albopictus 1세인트 탈피 애벌레 감염 될 수 쉽게 그리고 효과적으로 사이트를 사육 하는 애벌레의 물 본문에 바이러스를 도입 하 여와 개발된 rAaeDVs overexpress 또는 노크 하는 데 사용 될 수 입증 된 유전자 모기의 기능 분석을 위한 도구를 제공 하는 유 충에 특정 대상 유전자의 표현.

RAaeDV 건설을 위한 전략 결함이 rAaeDV 벡터 모기 애벌레에 DsRed 유전자를 표현 하기 위해 생성 되었습니다. 결과 플라스 미드 부사장 단백질 삭제 (그림 1A) 함께 NS1 DsRed 융합 단백질 카세트를 포함. rAaeDV 미르에 대 한 식 구문을 포함 하는 플라스 미드, 미르 스폰지, shRNA 및 amiRNA 설계 되었습니다 ( 그림 1...

Watch this Scientific Journal Video about Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae at JoVE.com

Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae

모기 유 충에서 유전자의 기능 분석에 대 한 유전자 납품 벡터로 재조합 모기 Densovirus의 사용

우리는 비 결함 재조합 Aedes aegypti densovirus (AaeDV) vivo에서 전달 시스템을 개발 하는 인공 intronic 작은 RNA 식 전략을 사용 하 여 보고 합니다. 건설, 포장, 및 애벌레 감염에 관해서는 뿐만 아니라 rAaeDV 벡터의 정량 분석에 대 한 자세한 절차를 설명 합니다.

In vivo microinjection is the most commonly used gene transfer technique for analyzing the gene functions in individual mosquitoes. However, this method ...

use-recombinant-mosquito-densovirus-as-gene-delivery-vector-for

Research

JoVE Journal

Developmental Biology

6.7K 조회수.  Southern Medical University. 우리는 비 결함 재조합 Aedes aegypti densovirus (AaeDV) vivo에서 전달 시스템을 개발 하는 인공 intronic 작은 RNA 식 전략을 사용 하 여 보고 합니다. 건설, 포장, 및 애벌레 감염에 관해서는 뿐만 아니라 rAaeDV 벡터의 정량 분석에 대 한 자세한 절차를 설명 합니다.

비디오: Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae

Transfection and Mutagenesis of Target Genes in Mosquito Cells by Locked Nucleic Acid-modified Oligonucleotides

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new infections each year. Despite decades of research, there is still no vaccine against malaria, highlighting the need for novel control strategies. One innovative approach is the use of genetically modified mosquitoes to effectively control malaria parasite transmission. Deliberate alterations of cell signaling pathways in the mosquito, via targeted mutagenesis, have been found to regulate parasite development 1. From these studies, we can begin to identify potential gene targets for transformation. Targeted mutagenesis has traditionally relied upon the homologous recombination between a target gene and a large DNA molecule. However, the construction and use of such complex DNA molecules for generation of stably transformed cell lines is costly, time consuming and often inefficient. Therefore, a strategy using locked nucleic acid-modified oligonucleotides (LNA-ONs) provides a useful alternative for introducing artificial single nucleotide substitutions into episomal and chromosomal DNA gene targets (reviewed in 2). LNA-ON-mediated targeted mutagenesis has been used to introduce point mutations into genes of interest in cultured cells of both yeast and mice 3,4. We show here that LNA-ONs can be used to introduce a single nucleotide change in a transfected episomal target that results in a switch from blue fluorescent protein (BFP) expression to green fluorescent protein (GFP) expression in both Anopheles gambiae and Anopheles stephensi cells. This conversion demonstrates for the first time that effective mutagenesis of target genes in mosquito cells can be mediated by LNA-ONs and suggests that this technique may be applicable to mutagenesis of chromosomal targets in vitro and in vivo.

Oligonucleotides can be used to site specifically substitute a single nucleotide of transfected target genes in both Anopheles gambiae and Anopheles stephensi cells.

옥내 핵산 - 수정 Oligonucleotides에 의해 Transfection 및 모기 세포 대상 유전자의 돌연변이 유발

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new ...

연구

면역학 및 감염병학

Alphavirus Transducing System:  Tools for Visualizing Infection in Mosquito Vectors

Alphavirus transducing systems (ATSs) are important tools for expressing genes of interest (GOI) during infection. ATSs are derived from cDNA clones of mosquito-borne RNA viruses (genus Alphavirus; family Togaviridae). The Alphavirus genus contains about 30 different mosquito-borne virus species. Alphaviruses are enveloped viruses and contain single-stranded RNA genomes (~11.7 Kb). Alphaviruses transcribe a subgenomic mRNA that encodes the structural proteins of the virus required for encapsidation of the genome and maturation of the virus. Alphaviruses are usually highly lytic in vertebrate cells, but persistently infect susceptible mosquito cells with minimal cytopathology. These attributes make them excellent tools for gene expression in mosquito vectors. The most common ATSs in use are derived from Sindbis virus (SINV). The broad species tropism of SINV allows for infection of insect, avian, and mammalian cells8. However, ATSs have been derived from other alphaviruses as well9,10,20. Foreign gene expression is made possible by the insertion of an additional viral subgenomic RNA initiation site or promoter. ATSs in which an exogenous gene sequence is positioned 5' to the viral structural genes is used for stable protein expression in insects. ATSs, in which a gene sequence is positioned 3' to the structural genes, is used to trigger RNAi and silence expression of that gene in the insect.
ATSs have proven to be valuable tools for understanding vector-pathogen interactions, molecular details of viral replication and maintenance infectious cycles3,4,11,19,21. In particular, the expression of fluorescent and bioluminescent reporters has been instrumental tracking the viral infection in the vector and virus transmission5,14-16,18. Additionally, the vector immune response has been described using two strains of SINV engineered to express GFP2,9.
Here, we present a method for the production of SINV containing a fluorescent reporter (GFP) from the cDNA infectious clone. Infectious, full-length RNA is transcribed from the linearized cDNA clone. Infectious RNA is introduced into permissive target cells by electroporation. Transfected cells generate infectious virus particles expressing the GOI. Harvested virus is used to infect mosquitoes, as described here, or other host species (not shown herein). Vector competence is assessed by detecting fluorescence outside the midgut or by monitoring virus transmission7. Use of a fluorescent reporter as the GOI allows for convenient estimation of virus spread throughout a cell culture, for determination of rate of infection, dissemination in exposed mosquitoes, virus transmission from the mosquito and provides a rapid gauge of vector competence.

Methods for using alphavirus transducing systems to express fluorescent reporters in vitro and in adult mosquitoes are described. This technique may be adapted to express any protein of interest in lieu of or in addition to a reporter.

Alphavirus Transducing 시스템 : 모기 벡터의 감염을 떠올리을위한 도구

Alphavirus transducing systems (ATSs) are important tools for expressing genes of interest (GOI) during infection.  ATSs are derived from cDNA clones of ...

Injection of dsRNA into Female A. aegypti Mosquitos

Reverse genetic approaches have proven extremely useful for determining  which genes underly resistance to vector pathogens in mosquitoes.  This video protocol illustrates a method used by the James lab to inject dsRNA into female A. aegypti mosquitoes, which harbor the dengue virus.  The technique for calibrating injection needles, manipulating the injection setup, and injecting dsRNA into the thorax is illustrated.

Reverse genetic approaches have proven extremely useful for determining which genes underly resistance to vector pathogens in mosquitoes. This video protocol illustrates a method used by the James lab to inject dsRNA into female A. aegypti mosquitoes, which harbor the dengue virus. The technique for calibrating injection needles, manipulating the injection setup, and injecting dsRNA into the thorax is illustrated.

여성 A. aegypti 모기에의 dsRNA의 분사

Reverse genetic approaches have proven extremely useful for determining  which genes underly resistance to vector pathogens in mosquitoes.  This video ...

생물학

Protocol for RNAi Assays in Adult Mosquitoes (A. gambiae)

Reverse genetic approaches have proven extremely useful for determining  which genes underly resistance to vector pathogens in mosquitoes.  This video protocol illustrates a method used by the Dimopoulos lab to inject dsRNA into Anopheles gambiae mosquitoes, which harbor the malaria parasite.  The technique manipulating the injection setup and injecting dsRNA into the thorax is illustrated.

Protocol for RNAi Assays in Adult Mosquitoes A. gambiae

Reverse genetic approaches have proven extremely useful for determining which genes underly resistance to vector pathogens in mosquitoes. This video protocol illustrates a method used by the Dimopoulos lab to inject dsRNA into Anopheles gambiae mosquitoes, which harbor the malaria parasite. The technique manipulating the injection setup and injecting dsRNA into the thorax is illustrated.

성인 모기 (A. gambiae)에서 RNAi의 Assays을위한 프로토콜

Reproducible dsRNA Microinjection and Oviposition Bioassay in Mosquitoes and House Flies

Synthetic dsRNAs, used to induce RNA interference, may have dose dependent phenotypic effects. These effects are difficult to define if the dsRNAs are delivered using a non-quantitative method. Accurate delivery of known quantities of nucleic acids or other chemicals is critical to measure the efficacy of the compound being tested and to allow reliable comparison between compounds.
Here we provide a reproducible, quantitative microinjection protocol that ensures accurate delivery of specific doses of dsRNA, reducing the mortality typically induced by injection injury. These modifications include the addition of Rhodamine B, a graduated injection needle, and an improved recovery method borrowed from Isoe and Collins. This method allows calculation of dose responses and facilitates comparisons between compounds. Versions of this method have been successfully used on three genera of mosquitoes as well as house flies to assess the reduction in fecundity resulting from gene silencing of ribosomal RNA transcripts.
This protocol provides strategies to reduce several challenges of small insect microinjection. Together, mechanical delivery of dsRNAs accompanied by visual verification, identification of effective locations for delivery, and inclusion of a post-injection recovery period ensure accurate dosing and low injury mortality. This protocol also describes an oviposition bioassay for uniform determination of effects on fecundity.

This protocol describes a microinjection methodology that we have standardized and used for several years to deliver specific quantities of nucleic acids directly to the hemolymph of mosquitoes and house flies. This protocol results in minimal injection mortality and allows dose correlated measurements of fecundity.

재현할 수 dsRNA Microinjection 및 산란 검정 집 파리 모기에

Synthetic dsRNAs, used to induce RNA interference, may have dose dependent phenotypic effects. These effects are difficult to define if the dsRNAs are ...

환경과학

Using the GAL4-UAS System for Functional Genetics in Anopheles gambiae

The bipartite GAL4-UAS system is a versatile and powerful tool for functional genetic analysis. The essence of the system is to cross transgenic 'driver' lines that express the yeast transcription factor GAL4 in a tissue specific manner, with transgenic 'responder' lines carrying a candidate gene/RNA interference construct whose expression is controlled by Upstream Activation Sequences (UAS) that bind GAL4. In the ensuing progeny, the gene or silencing construct is thus expressed in a prescribed spatiotemporal manner, enabling the resultant phenotypes to be assayed and gene function inferred. The binary system enables flexibility in experimental approaches to screen phenotypes generated by transgene expression in multiple tissue-specific patterns, even if severe fitness costs are induced. We have adapted this system for Anopheles gambiae, the principal malaria vector in Africa.
In this article, we provide some of the common procedures used during GAL4-UAS analysis. We describe the An. gambiae GAL4-UAS lines already generated, as well as the cloning of new responder constructs for upregulation and RNAi knockdown. We specify a step by step guide for sexing of mosquito pupae to establish genetic crosses, that also includes screening progeny to follow inheritance of fluorescent gene markers that tag the driver and responder insertions. We also present a protocol for clearing An. gambiae embryos to study embryonic development. Finally, we introduce potential adaptions of the method to generate driver lines through CRISPR/Cas9 insertion of GAL4 downstream of target genes.

Using the GAL4-UAS System for Functional Genetics in Anopheles gambiae

The bipartite GAL4-UAS system is a versatile tool for modification of gene expression in a controlled spatiotemporal manner which permits functional genetic analysis in Anopheles gambiae. The procedures described for using this system are a semi-standardized cloning strategy, sexing and screening of pupae for fluorescent protein markers and embryo fixation.

Anopheles 감비아에서 기능 유전학을 위한 GAL4-UAS 시스템을 이용하십시오

The bipartite GAL4-UAS system is a versatile and powerful tool for functional genetic analysis. The essence of the system is to cross transgenic 'driver' ...

유전학

Indel Detection following CRISPR/Cas9 Mutagenesis using High-resolution Melt Analysis in the Mosquito Aedes aegypti

Mosquito gene editing has become routine in several laboratories with the establishment of systems such as transcription-activator-like effector nucleases (TALENs), zinc-finger nucleases (ZFNs), and homing endonucleases (HEs). More recently, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) technology has offered an easier and cheaper alternative for precision genome engineering. Following nuclease action, DNA repair pathways will fix the broken DNA ends, often introducing indels. These out-of-frame mutations are then used for understanding gene function in the target organisms. A drawback, however, is that mutant individuals carry no dominant marker, making identification and tracking of mutant alleles challenging, especially at scales needed for many experiments. 
High-resolution melt analysis (HRMA) is a simple method to identify variations in nucleic acid sequences and utilizes PCR melting curves to detect such variations. This post-PCR analysis method uses fluorescent double-stranded DNA-binding dyes with instrumentation that has temperature ramp control data capture capability and is easily scaled to 96-well plate formats. Described here is a simple workflow using HRMA for the rapid detection of CRISPR/Cas9-induced indels and the establishment of mutant lines in the mosquito Ae. aegypti. Critically, all steps can be performed with a small amount of leg tissue and do not require sacrificing the organism, allowing genetic crosses or phenotyping assays to be performed after genotyping.

Indel Detection following CRISPR/Cas9 Mutagenesis using High-resolution Melt Analysis in the Mosquito Aedes aegypti

This article details a protocol for rapid identification of indels induced by CRISPR/Cas9 and selection of mutant lines in the mosquito Aedes aegypti using high-resolution melt analysis.

모기 Aedes aegypti에서 고해상도 용융 분석을 사용하여 CRISPR/ Cas9 돌연변이 발생 에 따른 인델 검출

Mosquito gene editing has become routine in several laboratories with the establishment of systems such as transcription-activator-like effector nucleases ...

Chitosan/Interfering RNA Nanoparticle Mediated Gene Silencing in Disease Vector Mosquito Larvae

Vector mosquitoes inflict more human suffering than any other organism&#8212;and kill more than one million people each year. The mosquito genome projects facilitated research in new facets of mosquito biology, including functional genetic studies in the primary African malaria vector Anopheles gambiae and the dengue and yellow fever vector Aedes aegypti. RNA interference- (RNAi-) mediated gene silencing has been used to target genes of interest in both of these disease vector mosquito species. Here, we describe a procedure for preparation of chitosan/interfering RNA nanoparticles that are combined with food and ingested by larvae. This technically straightforward, high-throughput, and relatively inexpensive methodology, which is compatible with long double stranded RNA (dsRNA) or small interfering RNA (siRNA) molecules, has been used for the successful knockdown of a number of different genes in A. gambiae and A. aegypti larvae. Following larval feedings, knockdown, which is verified through qRT-PCR or in situ hybridization, can persist at least through the late pupal stage. This methodology may be applicable to a wide variety of mosquito and other insect species, including agricultural pests, as well as other non-model organisms. In addition to its utility in the research laboratory, in the future, chitosan, an inexpensive, non-toxic and biodegradable polymer, could potentially be utilized in the field.

Here we describe a procedure for inhibiting gene function in disease vector mosquitoes through the use of chitosan/interfering RNA nanoparticles that are ingested by larvae.

질병 벡터 모기 유충의 키토산 / 간섭 RNA 나노 입자 중재 유전자 음소거

Vector mosquitoes inflict more human suffering than any other organism&#8212;and kill more than one million people each year. The mosquito genome projects ...

RNAi Trigger Delivery into Anopheles gambiae Pupae

RNA interference (RNAi), a naturally occurring phenomenon in eukaryotic organisms, is an extremely valuable tool that can be utilized in the laboratory for functional genomic studies. The ability to knockdown individual genes selectively via this reverse genetic technique has allowed many researchers to rapidly uncover the biological roles of numerous genes within many organisms, by evaluation of loss-of-function phenotypes. In the major human malaria vector Anopheles gambiae, the predominant method used to reduce the function of targeted genes involves injection of double-stranded (dsRNA) into the hemocoel of the adult mosquito. While this method has been successful, gene knockdown in adults excludes the functional assessment of genes that are expressed and potentially play roles during pre-adult stages, as well as genes that are expressed in limited numbers of cells in adult mosquitoes. We describe a method for the injection of Serine Protease Inhibitor 2 (SRPN2) dsRNA during the early pupal stage and validate SRPN2 protein knockdown by observing decreased target protein levels and the formation of melanotic pseudo-tumors in SRPN2 knockdown adult mosquitoes. This evident phenotype has been described previously for adult stage knockdown of SRPN2 function, and we have recapitulated this adult phenotype by SRPN2 knockdown initiated during pupal development. When used in conjunction with a dye-labeled dsRNA solution, this technique enables easy visualization by simple light microscopy of injection quality and distribution of dsRNA in the hemocoel.

RNAi Trigger Delivery into Anopheles gambiae Pupae

RNA interference (RNAi) is an extremely valuable tool for uncovering gene function. However, the ability to target genes using RNAi during pre-adult stages is limited in the major human malaria vector Anopheles gambiae. We describe an RNAi protocol to reduce gene function via direct injection during pupal development.

에 RNAi의 트리거 배달<em&gt; 아노 펠 레스 gambiae</em&gt; 번데기

RNA interference (RNAi), a naturally occurring phenomenon in eukaryotic organisms, is an extremely valuable tool that can be utilized in the laboratory ...

Effective Oral RNA Interference (RNAi) Administration to Adult Anopheles gambiae Mosquitoes

RNA interference has been a heavily utilized tool for reverse genetic analysis for two decades. In adult mosquitoes, double-stranded RNA (dsRNA) administration has been accomplished primarily via injection, which requires significant time and is not suitable for field applications. To overcome these limitations, here we present a more efficient method for robust activation of RNAi by oral delivery of dsRNA to adult Anopheles gambiae. Long dsRNAs were produced in Escherichia coli strain HT115 (DE3), and a concentrated suspension of heat-killed dsRNA-containing bacteria in 10% sucrose was offered on cotton balls ad-libitum to adult mosquitoes. Cotton balls were replaced every 2 days for the duration of the treatment. Use of this method to target doublesex (a gene involved in sex differentiation) or fork head (which encodes a salivary gland transcription factor) resulted in reduced target gene expression and/or protein immunofluorescence signal, as measured by quantitative Real-Time PCR (qRT-PCR) or fluorescence confocal microscopy, respectively. Defects in salivary gland morphology were also observed. This highly flexible, user-friendly, low-cost, time-efficient method of dsRNA delivery could be broadly applicable to target genes important for insect vector physiology and beyond.

Effective Oral RNA Interference RNAi Administration to Adult Anopheles gambiae Mosquitoes

The oral administration of dsRNA produced by bacteria, a delivery method for RNA interference (RNAi) that is routinely used in Caenorhabditis elegans, was successfully applied here to adult mosquitoes. Our method allows for robust reverse genetics studies and transmission-blocking vector studies without the use of injection.

모기 유 충에서 유전자의 기능 분석에 대 한 유전자 납품 벡터로 재조합 모기 Densovirus의 사용

요약

더 많은 비디오 탐색

이 비디오의 챕터