Name: site-directed immobilization of bone morphogenetic protein 2 to solid surfaces by click chemistry
Uploaded: 2018-03-29T13:00:00
Description: Watch this Scientific Journal Video about Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry at JoVE.com

The authors thank Dr. M. Rubini (Konstanz, Germany) for providing the plasmid encoding pyrrolysyl-tRNA and for providing pRSFduet-pyrtRNAsynth encoding the corresponding aminoacyl-tRNA synthetase.

1. Production of the BMP2 Variant BMP2-K3Plk
<ol>
	<li>Cloning of BMP2-K3Plk by site-directed mutagenesis using PCR12
	<ol>
		<li>Amplify human mature BMP2 (hmBMP2) from a p25N-hmBMP2 vector (see Table of Materials) with a forward primer (5&#39; GACCAGGACATATGGCTCAAGCCTAGCACAAACAGC 3&#39;) and a reverse primer (5&#39; CCAGGAGGATCCTTAGCGACACCCACAACCCT 3&#39;) introducing an amber stop codon (TAG) at the position of the first lysine of BMP2&#180;s mature part. Per...

<ol>
	<li>Giannoudis, P. V., Dinopoulos, H., Tsiridis, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+substitutes:+An+update.">Bone substitutes: An update.</a> Injury. 36, S20-S27 (2005).</li><li>Oryan, A., Alidadi, S., Moshiri, A., Bigham-Sadegh, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+morphogenetic+proteins:+A+powerful+osteoinductive+compound+with+non-negligible+side+effects+and+limitations.">Bone morphogenetic proteins: A powerful osteoinductive compound with non-negligible side effects and limitations.</a> Biofactors. 40 (5), 459-481 (2014).</li><li>Luginbuehl, V., Meinel, L., Merkle, H. P., Gander, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Localized+delivery+of+growth+factors+for+bone+repair.">Localized delivery of growth factors for bone repair.</a> Eur J Pharm Biopharm. 58 (2), 197-208 (2004).</li><li>Haidar, Z. S., Hamdy, R. C., Tabrizian, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+recombinant+bone+morphogenetic+proteins+for+bone+regeneration+and+repair.+Part+A:+Current+challenges+in+BMP+delivery.">Delivery of recombinant bone morphogenetic proteins for bone regeneration and repair. Part A: Current challenges in BMP delivery.</a> Biotechnol Lett. 31 (12), 1817-1824 (2009).</li><li>Hollinger, J. O., Uludag, H., Winn, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sustained+release+emphasizing+recombinant+human+bone+morphogenetic+protein-2.">Sustained release emphasizing recombinant human bone morphogenetic protein-2.</a> Adv Drug Deliv Rev. 31 (3), 303-318 (1998).</li><li>Uludag, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Implantation+of+recombinant+human+bone+morphogenetic+proteins+with+biomaterial+carriers:+A+correlation+between+protein+pharmacokinetics+and+osteoinduction+in+the+rat+ectopic+model.">Implantation of recombinant human bone morphogenetic proteins with biomaterial carriers: A correlation between protein pharmacokinetics and osteoinduction in the rat ectopic model.</a> J Biomed Mater Res. 50 (2), 227-238 (2000).</li><li>Uludag, H., Golden, J., Palmer, R., Wozney, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotinated+bone+morphogenetic+protein-2:+In+vivo+and+in+vitro+activity.">Biotinated bone morphogenetic protein-2: In vivo and in vitro activity.</a> Biotechnol Bioeng. 65 (6), 668-672 (1999).</li><li>Aono, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+ectopic+bone-inducing+activity+of+bone+morphogenetic+protein-4/7+heterodimer.">Potent ectopic bone-inducing activity of bone morphogenetic protein-4/7 heterodimer.</a> Biochem Biophys Res Commun. 210 (3), 670-677 (1995).</li><li>Suzuki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alginate+hydrogel+linked+with+synthetic+oligopeptide+derived+from+BMP-2+allows+ectopic+osteoinduction+in+vivo.">Alginate hydrogel linked with synthetic oligopeptide derived from BMP-2 allows ectopic osteoinduction in vivo.</a> J Biomed Mater Res. 50 (3), 405-409 (2000).</li><li>Knaus, P., Sebald, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperativity+of+binding+epitopes+and+receptor+chains+in+the+BMP/TGFbeta+superfamily.">Cooperativity of binding epitopes and receptor chains in the BMP/TGFbeta superfamily.</a> Biol Chem. 382 (8), 1189-1195 (2001).</li><li>Wang, L., Xie, J., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+the+genetic+code.">Expanding the genetic code.</a> Annu Rev Biophys Biomol Struct. 35, 225-249 (2006).</li><li>Costa, G. L., Weiner, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+PCR+site-directed+mutagenesis.">Rapid PCR site-directed mutagenesis.</a> CSH Protoc. 2006 (1), (2006).</li><li>Kirsch, T., Nickel, J., Sebald, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+recombinant+BMP+receptor+IA+ectodomain+and+its+2:1+complex+with+BMP-2.">Isolation of recombinant BMP receptor IA ectodomain and its 2:1 complex with BMP-2.</a> FEBS Lett. 468 (2-3), 215-219 (2000).</li><li>Tabisz, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-directed+immobilization+of+BMP-2:+Two+approaches+for+the+production+of+innovative+osteoinductive+scaffolds.">Site-directed immobilization of BMP-2: Two approaches for the production of innovative osteoinductive scaffolds.</a> Biomacromolecules. 18 (3), 695-708 (2017).</li><li>Duong-Ly, K. C., Gabelli, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+ion+exchange+chromatography+to+purify+a+recombinantly+expressed+protein.">Using ion exchange chromatography to purify a recombinantly expressed protein.</a> Methods Enzymol. 541, 95-103 (2014).</li><li>Brunelle, J. L., Green, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-dimensional+SDS-polyacrylamide+gel+electrophoresis+(1D+SDS-PAGE).">One-dimensional SDS-polyacrylamide gel electrophoresis (1D SDS-PAGE).</a> Methods Enzymol. 541, 151-159 (2014).</li><li>Brunelle, J. L., Green, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coomassie+blue+staining.">Coomassie blue staining.</a> Methods Enzymol. 541, 161-167 (2014).</li><li>Kirsch, T., Nickel, J., Sebald, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BMP-2+antagonists+emerge+from+alterations+in+the+low-affinity+binding+epitope+for+receptor+BMPR-II.">BMP-2 antagonists emerge from alterations in the low-affinity binding epitope for receptor BMPR-II.</a> EMBO J. 19 (13), 3314-3324 (2000).</li><li>Hein, J. E., Fokin, V. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Copper-catalyzed+azide-alkyne+cycloaddition+(CuAAC)+and+beyond:+new+reactivity+of+copper(I)+acetylides.">Copper-catalyzed azide-alkyne cycloaddition (CuAAC) and beyond: new reactivity of copper(I) acetylides.</a> Chem Soc Rev. 39 (4), 1302-1315 (2010).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+kinetics+analysis+of+BMP2+uptake+into+cells+and+its+modulation+by+BMP+antagonists.">Quantitative kinetics analysis of BMP2 uptake into cells and its modulation by BMP antagonists.</a> J Cell Sci. 126 (Pt 1), 117-127 (2013).</li><li>Paarmann, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamin-dependent+endocytosis+of+Bone+Morphogenetic+Protein2+(BMP2)+and+its+receptors+is+dispensable+for+the+initiation+of+Smad+signaling.">Dynamin-dependent endocytosis of Bone Morphogenetic Protein2 (BMP2) and its receptors is dispensable for the initiation of Smad signaling.</a> Int J Biochem Cell Biol. 76, 51-63 (2016).</li><li>Pohl, T. L., Boergermann, J. H., Schwaerzer, G. K., Knaus, P., Cavalcanti-Adam, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surface+immobilization+of+bone+morphogenetic+protein+2+via+a+self-assembled+monolayer+formation+induces+cell+differentiation.">Surface immobilization of bone morphogenetic protein 2 via a self-assembled monolayer formation induces cell differentiation.</a> Acta Biomater. 8 (2), 772-780 (2012).</li></ol>

Generating tagged protein variants by genetic codon expansion allows the introduction of various non-natural amino acid analogs principally at any position of the primary protein sequence. In case of BMPs like BMP2, common tags such as a 6-Histidine (His) tag can only be introduced N-terminally, since the protein&#180;s C-terminal end is buried within the tertiary protein structure, and is thus not accessible from the outside. At other positions, the size of the introduced tag may very likely cause structural alterations...

The ultimate goal of bone tissue engineering and bone regeneration is to overcome the disadvantages and limitations occurring during common treatments of non-union fractures. Auto- or allo-transplantations are predominantly used as current therapy strategies, even though they both have several drawbacks. The ideal bone graft should induce osteogenesis by osteoinduction as well as osteoconduction, leading to the osteointegration of the graft into the bone. Nowadays, only auto-transplantation is considered as the &#34;gold standard&#34; since it provides all characteristics of an ideal bone graft. Unfortunately, it also presents important negative aspects, such as long surgery times, and a second trauma site that usually entails more complications (e.g., chronic pain, hematoma formations, infections, cosmetic defects, etc.). Allogenic grafts, on the other hand have suboptimal characteristics for all general aspects1. Alternative bone graft technologies have been improved in the last few years, with the aim to produce scaffolds that are osteoinductive, osteoconductive, biocompatible, and bioresorbable. Since many biomaterials do not show all of these osteogenic characteristics, different growth factors, mainly BMP2 and BMP7, have been incorporated in order to improve the osteogenic potential of the particular scaffold2.
As an essential criterion, such growth factor delivery systems should provide a controlled dose release over time in order to facilitate the essential events like cell recruitment and attachment, cell ingrowth, and angiogenesis. However, BMPs as well as other osteogenic growth factors have been commonly immobilized non-covalently3. Entrapment and adsorption techniques require the use of supra-physiological amounts of protein due to an initial burst release, which leads to severe disadvantages in vivo, typically affecting the surrounding tissues by inducing bone overgrowth, osteolysis, swelling, and inflammation4. Thus, the retention of growth factors at the delivery site for longer periods of time can be achieved by covalent immobilization methods. Chemically modified BMP2 (succinylated5, acetylated6 or biotinylated7), engineered heterodimers8, or BMP2 derived oligopeptides9 have been designed and used to overcome the limitations related to absorption. However, the bio-activity of these constructs is not predictable since the arrangement potentially inhibits the binding of the immobilized ligand to the cellular receptors. As previously shown, it is essential that all four receptor chains involved in the formation of activated ligand-receptor complexes interact with the immobilized BMP2 in order to fully activate all downstream signaling cascades10.
To overcome the problems of an inhomogeneous product outcome with limitations in terms of bioactivity, stability, and bioavailability of the immobilized factor, we designed a BMP variant capable of covalently binding scaffolds in a site-directed manner. This variant, termed BMP2-K3Plk, comprises an artificial amino acid which was introduced by genetic codon expansion11. This variant has been successfully linked to scaffolds using a covalent coupling strategy while maintaining its biological activity.

<table border="0" cellpadding="0" cellspacing="0" style="width:1137px;" width="1138">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Material</td>
			<td style="width:203px;"></td>
			<td style="width:136px;"></td>
			<td style="width:403px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1-Step NBT/BCIP</td>
			<td style="width:203px;">Thermo Fisher</td>
			<td style="width:136px;">34042</td>
			<td style="width:403px;">Add solution to cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">3-Azido-7-hydroxycoumarin</td>
			<td style="width:203px;">BaseClick</td>
			<td style="width:136px;">BCFA-047-1</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Agarose low melting point</td>
			<td style="width:203px;">Biozym</td>
			<td style="width:136px;">840101</td>
			<td>Agarose for ALP assay&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Azide agarose beads</td>
			<td style="width:203px;">Jena Bioscience</td>
			<td style="width:136px;">CLK-1038-2</td>
			<td style="width:403px;">Beads used for reaction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">BamHI (Fast Digest enzyme)</td>
			<td>Thermo Fisher Scientific</td>
			<td>FD0054</td>
			<td>Restriction enzyme</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:396px;">BMP receptor IA (BMPR-IAEC)</td>
			<td>--</td>
			<td>--</td>
			<td>Produced in our lab</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Coomassie Brilliant Blue G-250 Dye</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:136px;">20279</td>
			<td>Chemical used for Coomassie Brilliant blue staining of SDS PAGE</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:396px;">Copper (II) sulfate anhydrous (CuSO4)</td>
			<td style="width:203px;">Alfa Aesar</td>
			<td style="width:136px;">A13986</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">DNA Polymerase and reaction buffer&#160;</td>
			<td>Kapabiosystems</td>
			<td>KK2102</td>
			<td>KAPA HiFi PCR Kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Dulbecco&#8217;s modified Eagle&#8217;s medium (DMEM) GlutaMAX</td>
			<td style="width:203px;">Gibco</td>
			<td style="width:136px;">61965-026</td>
			<td style="width:403px;">Cell culture media</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">ethylenediaminetetraacetic acid (EDTA)</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td style="width:136px;">E5134-1kg</td>
			<td style="width:403px;">Chemical used to stop click reaction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Isopropyl &#223;-D-1-thiogalactopyranoside (IPTG)</td>
			<td style="width:203px;">Carl Roth GmbH</td>
			<td style="width:136px;">2316.5</td>
			<td>Bacteria induction (1mM final concentration)&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NdeI (Fast Digest enzyme)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ER0581</td>
			<td>Restriction enzyme</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">NHS-activated Texas Red</td>
			<td style="width:203px;">Life technologies</td>
			<td style="width:136px;">T6134</td>
			<td style="width:403px;">Coupled to receptor</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">P- Nitrophenyl Phosphate</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td style="width:136px;">N4645-1G</td>
			<td style="width:403px;">Alkaline Phosphatase</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">p25N-hmBMP2&#160;</td>
			<td>--</td>
			<td>--</td>
			<td>Plasmid kindly provided from Walter Sebald to J. Nickel</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pET11a-pyrtRNA</td>
			<td>--</td>
			<td>--</td>
			<td>Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">propargyl-L-lysine (Plk)</td>
			<td>--</td>
			<td>--</td>
			<td>Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pSRFduet-pyrtRNAsynth</td>
			<td>--</td>
			<td>--</td>
			<td>Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Qiagen Gel Extraction Kit</td>
			<td style="width:203px;">Qiagen</td>
			<td style="width:136px;">28704</td>
			<td>Gel Purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Qiagen PCR purification Kit</td>
			<td style="width:203px;">Qiagen</td>
			<td>28104</td>
			<td style="width:403px;">PCR Purification&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Sodium L-ascorbate</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td style="width:136px;">A7631-100G</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">T4 DNA Ligase</td>
			<td style="width:203px;">ThermoScientific</td>
			<td style="width:136px;">EL0011</td>
			<td>Ligation&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">tris(3-hydroxypropyltriazolylmethyl)amine (THPTA)</td>
			<td style="width:203px;">BaseClick</td>
			<td style="width:136px;">BCMI-006-100</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td>X100-1L</td>
			<td style="width:403px;">Triton X 100&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Name</td>
			<td style="width:203px;">Company</td>
			<td style="width:136px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Equipment</td>
			<td style="width:203px;"></td>
			<td style="width:136px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Amicon concentrating cell 400 ml&#160;</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">UFSC40001</td>
			<td style="width:403px;">Concentrating unit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Amicon Ultra-15 Centrifugal Filter Units</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">UFC901024</td>
			<td style="width:403px;">Concentrating centrifugal unit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">&#196;KTA avant FPLC</td>
			<td>&#196;KTA</td>
			<td>--</td>
			<td>FPLC machine</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Avanti J-26XP</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">393124</td>
			<td>Centrifuge for bacterial culture</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Bacterial Shaking Incubator</td>
			<td style="width:203px;">Infors HT</td>
			<td style="width:136px;"></td>
			<td>Shaking incubator for bacterial culture</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">FluorChem Q system</td>
			<td style="width:203px;">proteinsimple</td>
			<td style="width:136px;">--</td>
			<td>Imaging and analysis system for SDS-PAGE</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Fluorescent miscroscope</td>
			<td style="width:203px;">Keyence</td>
			<td style="width:136px;">BZ-9000 (BIOREVO)</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fractogel&#174; EMD SO3- (M)</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">116882</td>
			<td style="width:403px;">Ion Exchange Chromatography column material</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Greiner CELLSTAR&#174;&#160;96 well plates</td>
			<td style="width:203px;">Sigma</td>
			<td>M5811-40EA</td>
			<td>96 well plates for cell culture (ALP Assay)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Heraeus Multifuge X1R</td>
			<td style="width:203px;">ThermoScientific</td>
			<td style="width:136px;">--</td>
			<td>Centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">M-20 Microplate Swinging Bucket Rotor</td>
			<td>ThermoScientific</td>
			<td style="width:136px;">75003624</td>
			<td>Rotor for Microcentrifuge for plate during ALP staining</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Microcentrifuge - 5417R</td>
			<td style="width:203px;">Eppendorf</td>
			<td style="width:136px;">--</td>
			<td>Centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">OriginPro 9.1 G&#160;</td>
			<td style="width:203px;">OriginLab</td>
			<td style="width:136px;">--</td>
			<td>software for stastic analysis of ALP assay data</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Polysine Slides</td>
			<td>ThermoScientific</td>
			<td>10143265</td>
			<td>microscope slides</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Rotor JA-10</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">--</td>
			<td>rotor for Avanti J-26XP centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Rotor JLA 8.1</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">--</td>
			<td>rotor for Avanti J-26XP centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Rotor JA 25.50</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">--</td>
			<td>rotor for Avanti J-26XP centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tecan infinite M200 multiplate reader</td>
			<td style="width:203px;">Tecan Deutschland GmbH</td>
			<td style="width:136px;">--</td>
			<td>Multiplate reader for ALP assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Thermocycler - Labcycler Gradient</td>
			<td style="width:203px;">SensoQuest GmbH</td>
			<td style="width:136px;">--</td>
			<td>PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">TxRed - microscope filter</td>
			<td style="width:203px;">Keyence</td>
			<td style="width:136px;"></td>
			<td>Filter for fluorescent microscope&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Ultrafiltration regenerated cellulose discs 3 kDa</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">PLBC04310</td>
			<td style="width:403px;">used with amicon concentrating cell 400ml</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Ultrafiltration regenerated cellulose discs 10 kDa</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">PLGC04310</td>
			<td style="width:403px;">used with amicon concentrating cell 400ml</td>
		</tr>
	</tbody>
</table>

site-directed immobilization of bone morphogenetic protein 2 to solid surfaces by click chemistry

Different therapeutic strategies for the treatment of non-healing long bone defects have been intensively investigated. Currently used treatments present several limitations that have led to the use of biomaterials in combination with osteogenic growth factors, such as bone morphogenetic proteins (BMPs). Commonly used absorption or encapsulation methods require supra-physiological amounts of BMP2, typically resulting in a so-called initial burst release effect that provokes several severe adverse side effects. A possible strategy to overcome these problems would be to covalently couple the protein to the scaffold. Moreover, coupling should be performed in a site-specific manner in order to guarantee a reproducible product outcome. Therefore, we created a BMP2 variant, in which an artificial amino acid (propargyl-L-lysine) was introduced into the mature part of the BMP2 protein by codon usage expansion (BMP2-K3Plk). BMP2-K3Plk was coupled to functionalized beads through copper catalyzed azide-alkyne cycloaddition (CuAAC). The biological activity of the coupled BMP2-K3Plk was proven in vitro and the osteogenic activity of the BMP2-K3Plk-functionalized beads was proven in cell based assays. The functionalized beads in contact with C2C12 cells were able to induce alkaline phosphatase (ALP) expression in locally restricted proximity of the bead. Thus, by this technique, functionalized scaffolds can be produced that can trigger cell differentiation towards an osteogenic lineage. Additionally, lower BMP2 doses are sufficient due to the controlled orientation of site-directed coupled BMP2. With this method, BMPs are always exposed to their receptors on the cell surface in the appropriate orientation, which is not the case if the factors are coupled via non-site-directed coupling techniques. The product outcome is highly controllable and, thus, results in materials with homogeneous properties, improving their applicability for the repair of critical size bone defects.

In this article, we describe a method to covalently couple a new BMP2 variant, BMP2-K3Plk, to commercially available azide functionalized agarose beads (Figure 1). The bioactivity of the produced BMP2-K3Plk variant was validated by the induction of alkaline phosphatase (ALP) gene expression in C2C12 cells. The in vitro test shows similar ALP expression levels induced by wild type BMP2 (BMP2-WT) and BMP2-K3Plk (Figure 2)....

Watch this Scientific Journal Video about Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry at JoVE.com

Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry

Biomaterials doped with Bone Morphogenetic Protein 2 (BMP2) have been used as a new therapeutic strategy to heal non-union bone fractures. To overcome side effects resulting from an uncontrollable release of the factor, we propose a new strategy to site-directly immobilize the factor, thus creating materials with improved osteogenic capabilities.

Different therapeutic strategies for the treatment of non-healing long bone defects have been intensively investigated. Currently used treatments present ...

The overall goal of this study, is the robust and reproducible production of an osteogenic scaffold by site-directed and covalent coupling of a newly designed BMP2 variant by click chemistry. This method can help to overcome problems connected with commonly use techniques for the treatment of non-healing of long bone defects. Absorption or encapsulation methods require super physiological amounts of BMP2 that provoke several severe side effects.The main advantage of this technique is to use lower amounts of the new designed BMP2 variant being covalently linked to scaffolds in a side-directed manner. Propagate a single colony overnight in 50 milliliters of LB medium with 50 micrograms per milliliter of kanamycin and 100 micrograms per milliliter of ampicillin at 37 degrees Celsius. Dilute the overnight cultures one to 20 into 800 milliliters of terrific broth medium supplemented with 50 micrograms per milliliter of kanamycin and 100 micrograms per milliliter of ampicillin.Grow the cultures at 37 degrees Celsius until an optical density at 600 nanometers of 0.7 is reached. Then add propofol L-Lycine to a final concentration of 10 millimolar. Induce gene expression by the addition of IPTG for a final concentration of one millimolar.Grow the culture at 37 degrees Celsius for 16 hours in an orbital shaker at 180 RPM. Following incubation, centrifuge the whole culture at 9, 000 times g for 30 minutes. Discard the supernatant and re-suspend the bacterial pellet in 30 milliliters of TBSE buffer.Weigh an empty centrifuge beaker and transfer the re-suspended pellet into the empty beaker. Then centrifuge the re-suspended pellet at 6, 360 times g for 20 minutes. Discard the supernatant and weigh the beaker with the pellet.Subtract the weight of the empty beaker to calculate the weight of the pellet. Then re-suspend the pellet in STE buffer. Use 200 milliliters of STE buffer for every 10 grams of pellet.Sonicate the suspension on ice before centrifuging at 6, 360 times g for 20 minutes. Discard the supernatant and weigh the pellet. After repeating the sonication and centrifugation steps four times, re-suspend the pellet in 100 milliliters of TBS buffer.Centrifuge at 6, 360 times g for 20 minutes. Then discard the supernatant and weigh the pellet. Re-suspend the pellet in nuclease buffer with freshly added nuclease using 10 milliliters per gram of pellet.Incubate the suspension overnight at room temperature on a stirring plate at 30 RPM. The next day add Triton Buffer to the suspension. The volume of Triton Buffer to add corresponds to a 0.5 volume part of the suspension.After incubating for 10 minutes at room temperature, centrifuge the suspension at 6, 360 times g for 20 minutes. Discard the supernatant and weigh the pellet. Next re-suspend the pellet in TE Buffer using eight milliliters per gram of pellet.After centrifuging as before, discard the supernatant and weigh the pellet. Now re-suspend the pellet by adding four milliliters per gram of 25 millimolar sodium acitate, PH5, and five milliliters per gram of six molar guanidinium chloride with one millimolar DTT. Incubate the suspension overnight at four degrees Celsius on a stirring plate.Following centrifugation at 75, 500 times g for 20 minutes, the supernatant contains the unfolded, monomeric BMP2 protein. Collect the supernatant and concentrate this extract to an optical density per milliliter of 20 using a three kilodalton molecular weight cut-off membrane in a concentrating cell. Add the concentrated monomers in single drops to the Renaturation Buffer while stirring.Then incubate the solution at room temperature for 120 hours in the dark. Adjust the pH of the solution to 3.0 using concentrated hydrochloric acid before dialyzing the solution against one millimolar hydrochloric acid. Concentrate the dialyzed solution using a 10 kilodalton molecular weight cut-off membrane in a concentrating cell.Next load the protein solution onto the equilibrated column, dilute fractions using a linear gradient of Buffer B, collecting two milliliter fractions. Analyze 20 microliters of each fraction by SDS Polyacrylamide gel electrophoresis followed by Coomassie Brilliant Blue staining to determine the fractions containing monomers and the fractions containing dimers. Next pull dimer containing fractions.Dialyze the pool of dimer containing fractions overnight at four degrees Celsius against five liters of one millimolar hydrochloric acid. Concentrate the product by using a 10 kilodalton concentrating centrifugal filter unit before analyzing the final product by SDS-PAGE and Coomassie Brilliant Blue staining. Combine 20 micromolar of BMP2-K3Plk or BMP2-while type which is used as a negative control with 20 microliters of Azide activated agarose beads in Reaction Buffer at a total volume of 500 microliters.Incubate for two hours at room temperature on a rotating mixture at 20 RPM. Stop the reaction by adding a final concentration of five millimolar EDTA. Incubate the solution at room temperature for 15 minutes on a rotating mixer at 20 RPM.Then centrifuge the samples at 20, 000 times g for one minute at room temperature and collect the supernatants. Next wash the pellet containing the beads with 1, 000 microliters of HBS 500 Buffer. Centrifuge the sample at 20, 000 times g for one minute at room temperature and collect the supernatant.Repeat this washing procedure twice more with HBS 500 Buffer, three times with four molar magnesium chloride, and two times with PBS, collecting the supernatant each time. Store the coupled beads in 1, 000 microliters of PBS at four degrees Celsius. Perform the ALP assay as described in the text protocol.To perform ALP staining, culture promyoblastic C2C12 cells in DMEM with 10%fetal calf serum as well as 100 units per milliliter of Penicillin G and Streptomycin at 37 degrees Celsius in a humidified atmosphere at 5%carbon dioxide. Feed C2C12 cells at a density of 30, 000 cells per well in a 96 well microplate. After letting the cells attach overnight, remove the medium and add 20 microliters per well of PMB2-K3PLK coupled beads.Then add 20 microliters of 0.4%low melting-point agarose in each well. Centrifuge the 96 well micro-plate at 2, 000 times g for five minutes at 20 degrees Celsius. Then add 80 microliters of the same medium.Incubate at 37 degrees Celsius in a humidified atmosphere at 5%carbon dioxide for 72 hours. Following incubation, remove the medium being careful not to detach the solidified 0.4%agarose. Add 100 microliters per well of one step MBT-BCIP sub-straight solution.Analyze alkaline phosphatidate staining using light microscopy immediately after the purple staining becomes apparent. Use bright field microscopy and take pictures. The bio-activity of the newly produced BMP2-K3Plk variant is validated by induction of alkaline phosphatase gene expression in C2C12 cells.The in vitro test shows similar alkaline phosphatase gene expression levels induced by either while type BMP2 or BMP2-K3Plk. Beads coated with BMP2-K3Plk via cover catalyzed azide alkyne cyclo addition yielded fluorescents when incubated with the dilabeled BMP receptor 1A eco-domain. The binding of BMP receptor 1A to the BMP2-K3Plk confirms retention of the bioactivity after coupling.The bioactivity of the BMP2-K3Plk functionalized beads was proved by ALP mediated staining. Staining occurred only in those cells which were in direct contact with the BMP2-K3Plk functionalized beads, confirming that the protein is indeed covalently linked to the beads and not just absorbed. If the protein would be released in the absorbed situation, a more spread out staining at larger distances would have been observed, as seen here for alkaline phosphatase staining upon treatment with soluble BMP2-K2Plk.After watching this video you should have a good understanding of how to express and produce biologically active proteins by genetical expansion and how to covalently couple a fictionalized protein to microspheres by click chemistry reaction. Generating protein variance by genetical expansion allows, in principle, the introduction of artificial amino acid at any position of the primary protein sequence. Introducing a mutation into the BMP2 sequence can effect the refolding efficiency and can also change the protein parameters.The BMP2-K3Plk production required a modification of the established method for the expression of while type BMP2. The produced BMP2-K3Plk showed biological activity comparable to that of the while type protein. Our approach to covalently couple the BMP2 variant to a azire fictionalized agarose beads by click chemistry could be realized with high efficiency, resulting in fictionalized beads, figuring a genetic differentiation in vitro.Standard protection according to good laboratory practice must be assured.

Research

JoVE Journal

Bioengineering

Micropatterned Surfaces to Study Hyaluronic Acid Interactions with Cancer Cells

Cancer invasion and progression involves a motile cell phenotype, which is under complex regulation by growth factors/cytokines and extracellular matrix ...

Thermodynamics of Membrane Protein Folding Measured by Fluorescence Spectroscopy

Membrane protein folding is an emerging topic with both fundamental and health-related significance.  The abundance of membrane proteins in cells ...

Bacterial Immobilization for Imaging by Atomic Force Microscopy

AFM is a high-resolution (nm scale) imaging tool that mechanically probes a surface.  It has the ability to image cells and biomolecules, in a liquid ...

Fluorescence detection methods for microfluidic droplet platforms

The development of microfluidic platforms for performing chemistry and biology has in large part been driven by a range of potential benefits that ...

Monitoring Protein Adsorption with Solid-state Nanopores

Solid-state nanopores have been used to perform measurements at the single-molecule level to examine the local structure and flexibility of nucleic acids ...

Hydrophobic Salt-modified Nafion for Enzyme Immobilization and Stabilization

Over the last decade, there has been a wealth of application for immobilized and stabilized enzymes including biocatalysis, biosensors, and biofuel ...

Preparation of Thermoresponsive Nanostructured Surfaces for Tissue Engineering

Thermoresponsive poly(N-isopropylacrylamide) (PIPAAm)-immobilized surfaces for controlling cell adhesion and detachment were fabricated by the ...

Wet Chemistry and Peptide Immobilization on Polytetrafluoroethylene for Improved Cell-adhesion

Endowing materials surface with cell-adhesive properties is a common strategy in biomaterial research and tissue engineering. This is particularly ...

Engineering 'Golden' Fluorescence by Selective Pressure Incorporation of Non-canonical Amino Acids and Protein Analysis by Mass Spectrometry and Fluorescence

Fluorescent proteins are fundamental tools for the life sciences, in particular for fluorescence microscopy of living cells. While wild-type and ...

Making Conjugation-induced Fluorescent PEGylated Virus-like Particles by Dibromomaleimide-disulfide Chemistry

The recent rise in virus-like particles (VLPs) in biomedical and materials research can be attributed to their ease of biosynthesis, discrete size, ...