저자는 친절 하 게 공유 쥡니다 장치에 대 한 Tilman Borggrefe (Giessen의 대학)를 감사 하 고 싶습니다. M.L.S.에서 일 도이치 가운데 (SCHM 1417/8-3), SFB/TRR81, SFB1021, SFB1213, 우수 클러스터 심장-폐 시스템 (ECCPS, 147/2 실), 독일 Krebshilfe (111447)와 IMPRS HLR 프로그램에서 교부 금에 의해 지원 됩니다. 최대 Planck 학회.

1. 주 1: 세포 배양
<ol><li>원하는 금액에 분석할 셀 문화. 세포 배양 조건 및 미디어 조사 셀 형식에 따라 달라 집니다. 참고: 원칙적으로, 모든 진 핵 세포는 의무가 넘어갈 여 chromatin 접근성의 분석. 이 실험에 대 한 4 x 106 HEK 293T 세포는 10% (v/v) FBS와 1% (w/v) 페니실린/스, 보충 하 고 5% CO2 와 셀 70-80%의 합류를 도달할 때까지 24 시간 동안 37 ° C에서 incubated DMEM 매체에 단일 10 cm 접시에 시드 (~ 8 x 10 6 셀 접시 당)입니다.</li>
</ol>2. 주 2: 포름알데히드 가교와 셀 수확
주의: 포름알데히드는 매우 독성이 고 증기 두건에서 항상 사용 해야 합니다. 착용 보호 옷 (장갑 및 실험실 외 투). 폐기물을 적절 하 게 삭제 합니다.
<ol><li>1% (v/v) (세포 배양 매체의 10 mL을 37% (v/v) 포름알데히드의 270 µ L)의 최종 농도 도달 하는 증기 두건에서 세포 배양 매체에 직접 포 름 알 데히드를 추가 합니다. 실내 온도 (20-25 ° C)에서 10 분 동안 incubate 고 슬루 판 수동으로 모든 2 분. 참고: 가교 시간 셀 형식을 조정할 수 있습니다. 셀 라인의 대부분에 대 한 가교의 10 분의 적절 한입니다. 조직에 대 한 더 이상 외피 수 있도록 모든 셀의 고정 해야 수 있습니다.</li>
	<li>해소는 포 름 알 데히드 0.125 M의 최종 농도에 글리신을 추가 (문화 매체의 10 mL를 2.5 M 글리신 주식 500 µ L 추가). 실 온에서 5 분 동안 incubate 고 슬루 마다 2 분.</li>
	<li>3 세포를 씻어 얼음 차가운 PBS와 x (8 g/L NaCl, KCl, 1.44 g/L Na2HPO4 · 2 H2O, 0.24 g/L KH2포4, 0.2 g/L 조정 7.4 HCl 이나 NaOH를 pH). 매체를 발음 하 고 PBS의 10 mL를 추가 하 여 셀 문화 접시 또는 플라스 크에 직접 씻어. 두 번 느슨하게 부착 세포 HEK 293T 같은 경우 매우 조심 하 고이 단계를 반복 합니다. 추가 PBS 신중 하 게 접시의 측면에는 세포의 분리를 피하기 위하여.</li>
	<li>3 세척 후 1 ml의 얼음 차가운 PBS와 얼음에 1.5 mL 반응 관에 셀 resuspend. 셀 스 크레이 퍼를 사용 하 여 필요한 경우 셀을 분리. 참고: 시작할 때 제한 된 소재, 손실을 방지 하기 위해 샘플 절차 동안 낮은 DNA 바인딩 튜브를 사용 합니다.</li>
	<li>300 x g 냉각된 탁상 원심 분리기에 4 ° c에서 5 분 동안 원심 분리기. 신중 하 게 그것을 발음으로 상쾌한을 삭제 합니다.</li>
</ol>3. 세포 세포의 용 해 및 Chromatin 조각화
<ol><li>1 mL 랑 세포의 용 해 버퍼 (1% (w/v), 10 mM EDTA, 50 mM Tris HCl pH 8.1, 10 µ g/mL leupeptin, 10 µ g/mL aprotinin, 2 밀리미터 PMSF)에 셀 펠 릿을 resuspend 하 고 신중 하 게 여러 번 위아래로 pipetting으로 셀을 resuspend. 얼음에 20 분 동안 품 어. 필요한 경우이 단계에서-80 ° C에서 샘플을 저장 합니다.</li>
	<li>가교 된 200-300 bp의 평균 크기를 기울이려면 DNA sonicate sonicator의 특정 설정은 사용된 쥡니다 장치와 샘플의 각 소스에 대 한 결정 되어야 합니다. 어떤 경우에 DNA 전단 효율적으로 보장 합니다. DNA 전단에 대 한 최적화 단계 단계 5.14 설명 되어 있습니다. 샘플의 난방을 피하기 위해 쥡니다 동안 얼음에 샘플을 냉각 한다.</li>
	<li>15 분 및 4 ° c.에 13000 x g에 대 한 샘플을 원심</li>
	<li>새로운 반응 관에는 상쾌한을 전송. 100 µ L aliquots에서 샘플을 분할. 필요한 경우-80 ° C에서 샘플을 저장 합니다. 참고: 프로토콜이 시점에서 중단 될 수 있습니다.</li>
</ol>4입니다. 제어 DNA의 드 가교
<ol><li>Aliquot 단계 3.4는 crosslink 반대 하 고 총 DNA에 대 한 참조로 사용할 수에서 100 µ L을 가져가 라. RNase A (10 mg/mL)의 10 µ L을 추가 하 고 37 ° c.에 1 시간에 대 한 품 어</li>
	<li>10 µ L의 성분 K (20 mg/mL)를 추가 합니다. 프로그래밍 가능 온도-블록을 사용 하 여 37 ° C에서 4 시간 그리고 6 h 65 ° C 단백질을 쪼개 고 리버스는 crosslinks에서 품 어. 마지막으로, 샘플 4 ° C에서 프로토콜 다시 시작할 때까지 누른 다음 5 단계로 진행 합니다. 참고: 다른 시 키 프로토콜 참조, 따라서 데 가교11에 대 한 필요성을 폐지로 가교 화 되지 않은 세포에서 chromatin 샘플을 사용 합니다. 이러한 샘플은 하지 쥡니다 효율 또는 DNA 안정성 가교 된 차이 이어질 수 있는 사실은, 따라서 총 DNA 참조 샘플을 받은 테스트 샘플으로 동일한 절차를 사용 하 여 더 정확 하 게 이다.</li>
</ol>5. 주 3: 페 놀: 클로 프롬 정화 DNA의
<ol><li>3.4 단계에서 aliquot는 비-드-가교 된 가져가 라. RNase A (10 mg/mL)의 10 µ L을 추가 하 고 37 ° c.에 1 시간에 대 한 품 어</li>
	<li>비 데 가교 된 aliquot 양식 단계 5.1와 드-가교 된 샘플 단계 4.2에서에서 하 고 동시에 진행. H2O 도달 300 µ L의 최종 볼륨을 추가 합니다.</li>
	<li>증기 두건 및 소용돌이에서 페 놀: 클로 프롬: isoamyl 알콜 (25:24:1)의 300 µ L를 적극적으로 추가 합니다. 주의: 페 놀 부식성 이며 독성이 고 연기 후드를 항상 사용 해야 합니다. (장갑 및 실험실 코트) 보호 옷을 입고, 반응 관 긴밀 하 게 폐쇄 하 고 폐기물을 적절 하 게 처분.</li>
	<li>4 ° c.에 13000 x g에서 10 분 원심 분리기</li>
	<li>신중 하 게 새로운 반응 관에 위 수성 단계의 280 µ L를 전송. Interphase는 또한 단백질을 포함에서 어떤 파편 든 지를 취할 수 없어 있는지 확인 합니다. 유기 용 매 폐기물로 나머지 낮은 단계를 삭제 합니다.</li>
	<li>5.3-5.5 단계를 반복 하 고 신중 하 게 새로운 반응 관을 위 수성 단계의 270 µ L를 전송.</li>
	<li>증기 두건 및 소용돌이에서 클로 프롬의 270 µ L를 적극적으로 추가 합니다. 참고:이 단계는 샘플에서 모든 나머지 페 놀을 제거 하는 데 사용 됩니다.</li>
	<li>4 ° c.에 13000 x g에서 10 분 원심 분리기</li>
	<li>신중 하 게는 interphase에에서 어떤 파편 든 지를 수행 하지 않도록 주의 복용 새로운 반응 관을 위 수성 단계의 250 µ L를 전송 합니다. 유기 용 매 폐기물로 나머지 샘플을 삭제 합니다.</li>
	<li>5 M NaCl의 25 µ L 소 프로 파 놀의 250 µ L를 추가 합니다. DNA 운반대로 글 리 코겐 (20 mg/mL)의 5 µ L를 추가 합니다. 튜브를 거꾸로 하 여 잘 혼합 하 고 실 온에서 20 분 동안 품 어. DNA를 침전 하 4 ° C에서 13000 x g에서 10 분 원심 분리기.</li>
	<li>70% (v/v) 에탄올의 400 µ L로 DNA 펠 릿을 세척. 4 ° c.에 13000 x g에서 10 분 원심 분리기</li>
	<li>상쾌한을 신중 하 게 발음 하 고 펠 릿 실 온에서 10 분 동안 건조 하자. 100 µ L TE 버퍼 (10 mM Tris pH 8, 1 mM EDTA)에 resuspend.</li>
	<li>간 DNA crosslinks 제거를 65 ℃에서 4 h에 대 한 비 데 가교 화 무료 DNA 샘플을 품 어. -20 ° c.에 샘플 저장</li>
	<li>분 광 광도 계를 사용 하 여 DNA의 양을 계량 하 고 2% (w/v) agarose 젤에 조각 크기를 확인 하는 약 수를 실행 합니다. 전단 시간과 농도 조정할 agarose는 DNA 크기 분석의 결과 따라 젤 전기 이동 법, 200-300 bp의 평균 크기를 얻을.</li>
</ol>6. 양적 실시간 PCR (qRT-PCR)에 의해 무료 대 총 DNA의 결정
<ol><li>(다음 무료 DNA 라고 합니다)에 nucleosome 무료 DNA의 비율 대 총 DNA qRT-PCR17,18에 의해 결정 됩니다. 샘플은 microarray 교 잡 또는 게놈 넓은 결정을 위한 깊은 시퀀싱에 의해 양이 많게 분석 수 있습니다 또한.</li>
	<li>긍정적이 고 부정적인 컨트롤 및 테스트 영역에 대 한 정량 Pcr 뇌관 디자인. 참고: 적합 한 긍정적인 컨트롤은 ACTB, GAPDH, TPI1, TUBA1A 등 적극적으로 베낀된 하우스키핑 유전자의 발기인에 뇌관 (β-말라, GAPDH, TPI 또는 α-Tubulin 인코딩). 적절 한 부정적인 컨트롤 섬으로 지역 또는 유전자 사막에서 발견 된다. 게놈 지역 조사 로컬 복사본 번호 차이 (표 1)에 대 한 제어를 동적으로 레 귤 레이트 된 소재 시에 인접 한 다른 적합 한 부정적인 컨트롤을 디자인할 수 있습니다.</li>
	<li>TE 버퍼 10 ng / µ L의 최종 농도에 DNA 샘플을 희석 하 고 최종 계산에 대 한 계정에 희석 요인 (단계 6.5 참조).</li>
	<li>다음 반응 믹스 잘 당 96 잘 접시에 triplicates에서 정량 반응 설정: 템플릿 DNA: 20 (2 µ L), 앞으로 뇌관 200 nM (5 µ M 주식의 0.4 µ L), 역방향 뇌관 200 nM (5 µ M 주식의 0.4 µ L) 녹색 염료 (2 배 재고에서 5 µ L), 및 H2O 10 µ L를 포함 하는 반응 혼합을 사용 하 여 상업적인 준비.</li>
	<li>절대 부 량 모드를 사용 하 여 실시간 정량 Pcr 장치에서 실행 하 고 다른 뇌관 쌍으로 샘플의 Ct를 결정. 단계 6.3에서에서 희석 요인 고려 하는 다음 수식을 사용 하 여 각 뇌관에 대 한 총 DNA에 무료 한 DNA의 회복의 비율을 계산: <img alt="Equation 1" src="/files/ftp_upload/57272/57272eq1.jpg"> 대표 결과 예제 계산 표 2에 제공 됩니다.</li>
	<li>샘플 간의 차이 대 한 보상, 긍정적인 통제 복구 비율에 정상화: <img alt="Equation 2" src="/files/ftp_upload/57272/57272eq2.jpg">
</li>
</ol>

<ol>
	<li>Struhl, K., Segal, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determinants+of+nucleosome+positioning.">Determinants of nucleosome positioning.</a> Nat. Struct. Mol. Biol. 20 (3), 267-273 (2013).</li><li>Calo, E., Wysocka, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+enhancer+chromatin:+what,+how,+and+why?.">Modification of enhancer chromatin: what, how, and why?.</a> Mol. Cell. 49 (5), 825-837 (2013).</li><li>Wu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+5'+ends+of+Drosophila+heat+shock+genes+in+chromatin+are+hypersensitive+to+DNase+I.">The 5' ends of Drosophila heat shock genes in chromatin are hypersensitive to DNase I.</a> Nature. 286 (5776), 854-860 (1980).</li><li>Yuan, G. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+identification+of+nucleosome+positions+in+S.+cerevisiae.">Genome-scale identification of nucleosome positions in S. cerevisiae.</a> Science. 309 (5734), 626-630 (2005).</li><li>Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y., Greenleaf, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposition+of+native+chromatin+for+fast+and+sensitive+epigenomic+profiling+of+open+chromatin,+DNA-binding+proteins+and+nucleosome+position.">Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position.</a> Nat. Methods. 10 (12), 1213-1218 (2013).</li><li>Nagy, P. L., Cleary, M. L., Brown, P. O., Lieb, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomewide+demarcation+of+RNA+polymerase+II+transcription+units+revealed+by+physical+fractionation+of+chromatin.">Genomewide demarcation of RNA polymerase II transcription units revealed by physical fractionation of chromatin.</a> Proc. Natl. Acad. Sci. U. S. A. 100 (11), 6364-6369 (2003).</li><li>Nagy, P. L., Price, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formaldehyde-assisted+isolation+of+regulatory+elements.">Formaldehyde-assisted isolation of regulatory elements.</a> Wiley Interdiscip Rev Syst Biol Med. , (2009).</li><li>Krinner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CpG+domains+downstream+of+TSSs+promote+high+levels+of+gene+expression.">CpG domains downstream of TSSs promote high levels of gene expression.</a> Nucleic Acids Res. , 1-14 (2014).</li><li>Gomez, N. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+Chromatin+Accessibility+at+Repetitive+Elements+Links+Stem+Cells+with+Human+Cancer.">Widespread Chromatin Accessibility at Repetitive Elements Links Stem Cells with Human Cancer.</a> Cell Rep. 17 (6), 1607-1620 (2016).</li><li>Gaulton, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+map+of+open+chromatin+in+human+pancreatic+islets.">A map of open chromatin in human pancreatic islets.</a> Nat. Genet. 42 (3), 255-259 (2010).</li><li>Giresi, P. G., Kim, J., McDaniell, R. M., Iyer, V. R., Lieb, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FAIRE+(Formaldehyde-Assisted+Isolation+of+Regulatory+Elements)+isolates+active+regulatory+elements+from+human+chromatin.">FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin.</a> Genome Res. 17 (6), 877-885 (2007).</li><li>Hurtado, A., Holmes, K. A., Ross-Innes, C. S., Schmidt, D., Carroll, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FOXA1+is+a+key+determinant+of+estrogen+receptor+function+and+endocrine+response.">FOXA1 is a key determinant of estrogen receptor function and endocrine response.</a> Nat. Genet. 43 (1), 27-33 (2011).</li><li>Filion, G. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+protein+location+mapping+reveals+five+principal+chromatin+types+in+Drosophila+cells.">Systematic protein location mapping reveals five principal chromatin types in Drosophila cells.</a> Cell. 143 (2), 212-224 (2010).</li><li>Davie, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+transcription+factors+and+regulatory+regions+driving+in+vivo+tumor+development+by+ATAC-seq+and+FAIRE-seq+open+chromatin+profiling.">Discovery of transcription factors and regulatory regions driving in vivo tumor development by ATAC-seq and FAIRE-seq open chromatin profiling.</a> PLoS Genet. 11 (2), e1004994 (2015).</li><li>Meyer, C. A., Liu, X. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identifying+and+mitigating+bias+in+next-generation+sequencing+methods+for+chromatin+biology.">Identifying and mitigating bias in next-generation sequencing methods for chromatin biology.</a> Nat. Rev. Genet. 15 (11), 709-721 (2014).</li><li>Du, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+variation+associated+with+liver+metabolism+is+mediated+by+transposable+elements.">Chromatin variation associated with liver metabolism is mediated by transposable elements.</a> Epigenetics Chromatin. 9 (1), 28 (2016).</li><li>Skinner, D. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-Time+PCR:+Advanced+Technologies+and+Applications.">Real-Time PCR: Advanced Technologies and Applications.</a> Crop Sci. 54 (1), 455 (2014).</li><li>Nolan, T., Huggett, J., Sanchez, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Good+Practice+Guide+for+the+Application+of+Quantitative+PCR+(qPCR).">Good Practice Guide for the Application of Quantitative PCR (qPCR).</a> Natl. Meas. Syst. , 50 (2013).</li><li>Rodr&#237;guez-Gil, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CCR4-NOT+complex+contributes+to+repression+of+Major+Histocompatibility+Complex+class+II+transcription.">The CCR4-NOT complex contributes to repression of Major Histocompatibility Complex class II transcription.</a> Sci. Rep. 7 (1), 3547 (2017).</li><li>Steimle, V., Siegrist, C. A., Mottet, A., Lisowska-Grospierre, B., Mach, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+MHC+class+II+expression+by+interferon-gamma+mediated+by+the+transactivator+gene+CIITA.">Regulation of MHC class II expression by interferon-gamma mediated by the transactivator gene CIITA.</a> Science. 265 (5168), 106-109 (1994).</li><li>Choi, N. M., Majumder, P., Boss, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+major+histocompatibility+complex+class+II+genes.">Regulation of major histocompatibility complex class II genes.</a> Curr. Opin. Immunol. 23 (1), 81-87 (2011).</li><li>Ting, J. P. -. Y., Trowsdale, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+control+of+MHC+class+II+expression.">Genetic control of MHC class II expression.</a> Cell. 109 Suppl, S21-S33 (2002).</li><li>Nammo, T., Rodr&#237;guez-Segu&#237;, S. A., Ferrer, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+open+chromatin+with+formaldehyde-assisted+isolation+of+regulatory+elements.">Mapping open chromatin with formaldehyde-assisted isolation of regulatory elements.</a> Methods Mol. Biol. 791, 287-296 (2011).</li><li>Simon, J. M., Giresi, P. G., Davis, I. J., Lieb, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+formaldehyde-assisted+isolation+of+regulatory+elements+(FAIRE)+to+isolate+active+regulatory+DNA.">Using formaldehyde-assisted isolation of regulatory elements (FAIRE) to isolate active regulatory DNA.</a> Nat. Protoc. 7 (2), 256-267 (2012).</li><li>Simon, J. M., Giresi, P. G., Davis, I. J., Lieb, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+detailed+protocol+for+formaldehyde-assisted+isolation+of+regulatory+elements+(FAIRE).">A detailed protocol for formaldehyde-assisted isolation of regulatory elements (FAIRE).</a> Curr. Protoc. Mol. Biol. , (2013).</li><li>Giresi, P. G., Lieb, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+active+regulatory+elements+from+eukaryotic+chromatin+using+FAIRE+(Formaldehyde+Assisted+Isolation+of+Regulatory+Elements).">Isolation of active regulatory elements from eukaryotic chromatin using FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements).</a> Methods. 48 (3), 233-239 (2009).</li><li>Jung, S., Angarica, V. E., Andrade-Navarro, M. A., Buckley, N. J., Del Sol, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prediction+of+Chromatin+Accessibility+in+Gene-Regulatory+Regions+from+Transcriptomics+Data.">Prediction of Chromatin Accessibility in Gene-Regulatory Regions from Transcriptomics Data.</a> Sci. Rep. 7 (1), 4660 (2017).</li><li>Pique-Regi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accurate+inference+of+transcription+factor+binding+from+DNA+sequence+and+chromatin+accessibility+data.">Accurate inference of transcription factor binding from DNA sequence and chromatin accessibility data.</a> Genome Res. 21 (3), 447-455 (2011).</li></ol>

저자는 공개 없다.

넘어갈은 nucleosome 무료 지역 식별 수 있도록 강력 하 고 저렴 한 방법입니다. 그것은 nucleosomes를 감싸 DNA는 히스톤에 가교 된 수 쉽게 원칙을 기반으로 합니다. 페 놀: 클로 프롬 적 출 그리고 interphase (그림 1)에서 어느 정도 낮은 페 놀 단계에서 발견 되는 단백질 바인딩 DNA에서 비 가교 화와 단백질 없는 DNA 파편을 분리 하는 데 사용 됩니다. 따라서, nucleosome 무료 지역 무료 DNA의 분수에서 overrepresented 수성 단계에 있습니다. 간행물의 수 시 키 방법23,24,25,26, 여기에 설명 된 절차를 보완 하기 위해 상담 될 수 있는 상세한 프로토콜을 설명 합니다.
마찬가지로 염색 질 구조를 결정 하는 데 사용 하는 다른 방법에 넘어갈 메서드 또한 비판적으로 달려 있다 DNA의 최적의 전단. 조각을 너무 긴 경우에, 어떤 nucleosome 무료 지역 인접 chromatin 바인딩된 DNA에 의해 마스크 됩니다. 조각이 너무 작은 경우, 정량 또는 깊은 시퀀싱에 의해 검출 매우 어려워집니다. 이러한 이유로, DNA의 쥡니다 제어 하 고 조각 주위를 얻기 위해 최적화 해야 하는 중요 한 매개 변수는 1-2 nucleosomes (그림 4)를 대표 하는 200-300 bp 길이.
최종 결과 영향을 미칠 수 있는 다른 매개 변수는 샘플의 가교 이다. 여기에 설명 된 고정 절차는 대부분 세포 라인에 대 한 유효, 비록 연구원 해야 합니다 신중 하 게 연구, 특정 샘플에 대 한이 단계 특히 사용할 때 평가 조직, 어디 긴 고정 시간을 허용 해야 할 수도 있습니다는 모든 조직 샘플에서 세포를 도달 하는 포름알데히드.
다른 메서드와 달리 DNase 같은 또는 micrococcal nuclease 과민성, 칩, 또는 ATAC, 시 키에 의존 하지 않는 효소 활동 또는 특정 항 체, 그리고 따라서 그것은 적정 또는 반응 조건의 최적화 필요 하지 않습니다. 이것은 시 키 염색 질 chromatin 필드에서 조금 경험을 가진 실험실에 대 한 내게 필요한 옵션을 측정 하는 이상적인 방법 있습니다. 또한, 파일럿 실험만 DNA 전단 단계와 가교 시간을 최적화 하는 데 필요한 필요한 경우.
메서드를 처음 개발한 것 효 모6, 하지만 그것은 또한 포유류 세포에 확장 되었습니다. Chromatin의 게놈 넓은 특성을 수 있도록 깊은 시퀀싱 시 키 방법으로 정화 하는 DNA는 사용할 수 있습니다. 이것은 이미 연구8,9,10,11,12,13,,1927, 의 수에 유용한 입증 28.
시 키-seq 실험 결과 차이가 발생 하지만 큰 오버랩 DNase-seq14, 등 다른 방법으로 얻은 결과 표시. 이 예를 들면 편안한 또는 리 모델링 nucleosomes 여전히 DNase에 의해 분열을 방해 수 방법론 차이, 이러한 DNA 영역 DNA/단백질 crosslinks를 생산 하는 경향이 덜 될 것 이라고 따라서 결정으로 nucleosome 무료 시 키9를 사용 하 여 영역입니다. 또한, 비 히스톤 단백질 RNA polymerases와 같은 또는 epigenetic 마크 리더 단백질의 존재 수 DNA/단백질 crosslinks 되며 따라서 넘어갈 실험에서 단백질 포장 영역으로 해석 될 것 이다. 이러한 한계는 chromatin 상태, 따라서 포괄적인 통찰력을 얻기 위해 다른 방법의 조합을 사용 하는 필요를 제기의 결정에 사용 되는 모든 방법에.

진 핵 세포의 게놈 DNA는 단단히 nucleosomes 제거 하거나 DNA와 다른 단백질의 상호 작용을 허용 하기 위하여 개조 하는으로 포장 됩니다. 유전자의 transcriptional 활성화 일반적으로 이끌어 낸다1+ 1 nucleosome 특히, nucleosomal 구조의 더 오픈 구성 RNA 중 합 효소에 의해 전사를 촉진 하기 위하여. 또한, 발기인, 증강 등의 규제 지역 chromatin 한정자 또는 녹음 방송 요인2와 상호 작용 수 있도록 그들의 chromatin 접근성에서 동적인 변화를 겪는 다. 몇 가지 방법은 이러한 nucleosome 무료 영역을 식별 하기 위해 개발 되었습니다. 이들은 DNase 같은 nucleases에 감도 나3 또는 micrococcal nuclease4그것은 하지 단단히 감싸 nucleosomes 때 DNA만 액세스할 수 있습니다. 오픈 chromatin 또는 무료 DNA의 식별을 위한 다른 방법을 포함 retrotransposable 요소 (ATAC 염색 질 Transposase 액세스할 수에 대 한 분석 결과)의 중재 하는 transposase 통합5또는 chromatin immunoprecipitation (칩)을 사용 하 여 히스톤에 대 한 항 체 넘어갈 방법은 DNA를 도달 하는 효소의 용량 또는 특정 단백질에 항 체의 바인딩을에 기반 하지 않은 하지만 페 놀: 클로 프롬 추출6,7nucleosome 무료 지역 정화에 의존 하는 대신. 이 방법에서는, DNA chromatin 단백질 covalently 가교 에이전트 포 름 알 데히드에 의해 바인딩되어 고 쥡니다에 의해 작은 조각 나중 전단. 그러나 DNA 영역 또는 몇 nucleosomes 거의 비슷하게 가교 된 DNA/단백질 복합물 해야한다 단단히 포장된 chromatin 지역 풍부한 DNA/단백질 crosslinks, 있을 것 이다. 페 놀: 클로 프롬 추출 정화를 비-가교 된 단백질을 DNA 가교 된 동안 수성 단계에서 무료 DNA 유기 페 놀 단계 또는 단백질 함께 수성 유기 interphase 캡처 수 있습니다. 총 DNA 샘플의 기준에 비해이 무료 DNA의 정량화 chromatin 무료 지역 식별 수 있습니다. 넘어갈 메서드를 사용 하면 여기에 설명 된 대로 개별 게놈 지역 특성에 대 한 사용할 수 있지만 다른 모델8 에 설명 된 대로 깊은 시퀀싱을 결합 하면 게놈 넓은 chromatin 접근성의 식별에 적합 , 9 , 10 , 11 , 12 , 13. 시 키-seq와 ATAC seq 같은 다른 방법에 의해 얻은 결과 크게14를 중복. 넘어갈 방법은 매우 강력, 저렴 한, 그리고 nucleosome 무료 영역을 식별 하는 방법을 수행 하기 쉬운. 다른 메서드와 달리 nucleases (DNase seq, MNase-seq) 또는 transposases (ATAC-seq)에 필요한 소화의 적절 한 수준을 결정 하는 시범 실험을 필요 하지 않습니다 그것과 최근 검토15에서 자세히 설명. 조정 해야 하는 유일한 매개 변수는 쥡니다 조건 및 어떤 경우에 고정 시간 있습니다. 이 문서에서는 간단한 프로토콜을 개요로 그림 1 에 표시 되 고 그는 sonicator 이외의 어떤 특별 한 장비를 필요 하지 않습니다 설명 합니다. 프로토콜은 합리적으로 짧은 시간에 수행할 수 있습니다 그리고 다양 한 1 차 셀 마우스 간16에서 얻은 폐 세포11 에서 배열 하는 다른 세포 유형 chromatin 내게 필요한 옵션을 테스트 하는 쉽고 안정적인 방법 시 키 게.

<table border="0" cellpadding="0" cellspacing="0" width="849">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:368px;">Phenol:chloroform:isoamyl alcohol 25:24:1</td>
			<td style="width:143px;">Carl Roth</td>
			<td style="width:133px;">A156.1</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Glycogen, 20 mg/ml</td>
			<td>Thermo Fisher</td>
			<td>R0561</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ABsolute QPCR Mix, SYBR-Green, Rox</td>
			<td>Thermo Fisher</td>
			<td>AB1162B</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Proteinase K, 20 mg/ml</td>
			<td>Thermo Fisher</td>
			<td>EO0491</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNase A, 10 mg/ml</td>
			<td>Thermo Fisher</td>
			<td>EN0531</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Leupeptin</td>
			<td>Sigma</td>
			<td>L8511</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Aprotinin</td>
			<td>Sigma</td>
			<td>A1603</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Phenylmethylsulfonyl fluoride (PMSF)</td>
			<td>Sigma</td>
			<td>78830</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">milliTUBE 1 ml AFA Fiber</td>
			<td>Covaris</td>
			<td>520130</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Holder milliTUBE 1ml</td>
			<td>Covaris</td>
			<td>500371</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Covaris S220 Focused-ultrasonicator</td>
			<td>Covaris</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">StepOnePlus Real-Time PCR System</td>
			<td>Applied Biosistems</td>
			<td>4376600</td>
			<td></td>
		</tr>
	</tbody>
</table>

formaldehyde-assisted isolation of regulatory elements to measure chromatin accessibility in mammalian cells

Extracellular 신호, 즉, 조직 및 계보 특정 유전자 전사, 응답에 적절 한 유전자 발현은 비판적 chromatin 조직의 높은 정의 상태에 따라 달라 집니다. 핵의 동적 아키텍처는 여러 메커니즘에 의해 제어 됩니다 고 transcriptional 출력 프로그램 모양. 그것은, 따라서, 선호 독립적인 실험 가변성의 잠재적으로 혼동 원천이 될 수 있는 항 체에서 신뢰할 수 있는 패션에 로커 스 특정 chromatin 접근을 결정 하는 것이 중요. 다양 한 방법으로, Formaldehyde-Assisted 절연의 규제 요소 (시 키) 분석 결과 포함 하 여 셀의 상대적으로 낮은 수에서 일반 chromatin 접근성의 결심을 허용 하는 chromatin 접근성을 측정할 수 있습니다. 여기는 낮은 단백질 인 게놈 영역, 신뢰할 수 있는, 간단 하 고 빠른 식별 수 있는 시 키 프로토콜에 설명 합니다. 이 방법에서는 DNA covalently 교차 결합 시키는 대리인으로 포름알데히드를 사용 하 여 염색 질 단백질에 바인딩된 이며 작은 조각에 전단. 무료 DNA 이후에 페 놀: 클로 프롬 적 출을 사용 하 여 농축입니다. 무료 DNA의 비율 정량적 중 합 효소 연쇄 반응 (정량) 또는 전체 DNA를 나타내는 컨트롤 샘플에 비해 DNA 시퀀싱 (DNA-seq)에 의해 결정 됩니다. 패자 chromatin 구조와 지역 무료 DNA 샘플, 낮은 chromatin 압축 게놈 영역 식별 되므로 농축 됩니다.

게시 된19로 HEK293T 세포에 MHC 종류 II 유전자의 chromatin 접근성에 차이 측정을 넘어갈 방법을 사용 했습니다. MHC 클래스 II 인코딩 유전자는 항 원 제시 세포 (Apc), constitutively 또는 cytokine20신호에 대 한 응답에 표시 됩니다. MHCII 유전자의 표현 XY 상자, 발기인 및이 유전자21,22의 강화 되 나 특정 DNA 요소에 바인딩하는 활성기 복잡 한에 의해 구동 됩니다. 이 MHC 종류 II 유전자 HLA DPB1 및 HLA-DMA에서 선택 된 영역의 우리의 시 키 분석에 의해 계시 된 대로, chromatin의 수준에서 반영 됩니다. 이 실험 동안 유전자 시체 (그림 2)에서 더 조밀한 XY 상자를 포괄 하는 지역에는 염색 질은 보여주었다.
예를 들어, 특정 실험에서 계산에 대 한 우리는 총을 희석 DNA 샘플 10 배 (희석 요인 10), 그리고 무료 DNA 샘플 희석 하지은 (희석 비율 1) qRT-PCR를 위한. Cts 테스트 하는 다른 지역에 대 한 고 최종 복구 비율 및 상대 복구 비율 계산에 나열 된 표 2. 이러한 상대 복구 비율 긍정적인 컨트롤로 ACTB 발기인을 사용 하 여 얻은 했다. 참고 그림 2에 표시 된 결과 생성 하는 데 사용 하는 복제의 한이 계산 됩니다.
다른 문맥에서는, chromatin 접근성 유도할 수 있는 유전자 발현에 대 한 모델에서 테스트 되었습니다. 이 경우에, chromatin 압축 프로-염증 성 자극 종양 괴 사 인자 (TNF)에 대 한 응답의 급격 한 변화를 측정 했다. 헬러 세포 치료 또는 TNF와 자극 시 키 인코딩 TNF 반응 사이토카인 인터 루 킨 8 (IL8) 유전자의 발기인 지구 제어 식에서 chromatin 압축을 측정 하 여 다음 1 시간 남았다. 이러한 결과 TNF 자극 세포 (그림 3)의 IL8 발기인에 강하게 증가 chromatin 접근성을 보였다. TNF 자극 후 IL-8 발기인에 접근성이 규제 지역에서 개장 하는 chromatin 극적인 보여주는 ACTB 발기인에 있는 보다도 높습니다. 으로 얻은 복구 비율이 경우 긍정적인 제어 (ACTB 발기인)로 사용 하는 지역에서 얻은 것 보다 더 높은 상대 복구 비율 보다 높은 수준 이다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57272/57272fig1.jpg"> 그림 1:이 시 키 워크플로. 셀 포 름 알 데히드 (A)를 추가 하 여 세포 배양 플라스 크 또는 접시에 직접 가교 된 있습니다. 포 름 알 데히드의 냉각 후 셀 얼음 차가운 PBS (B)로 세 번 세척 하 고 넘어갈 세포의 용 해 버퍼에서 resuspended 하 고 (C) DNA를 기울이려면 sonicated 반응 관에 전송. 추출된 chromatin의 한 약 수 총 DNA 참조 (D)에 65 ° C에서가 열 하 여 드-가교 화 이며 나중 무료 DNA 페 놀: 클로 프롬은 가교 화와 드-가교 된 aliquots (E)에서 모두를 사용 하 여 추출 됩니다. 마지막으로, DNA 정량 하 고 DNA는 총 대 무료의 비율 계산 (F). <a href="https://cloudflare.jove.com/files/ftp_upload/57272/57272fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57272/57272fig2.jpg"> 그림 2: HEK293T 세포에 MHC 종류 II 유전자에서 chromatin 접근성의 클러스터. HEK293T 세포는 시 키에 의해 분석 되었다. 사이의 비율 총 DNA 대 무료 (즉,., 상대 복구 비율) ACTB 유전자의 발기인에 대 한 긍정적인 통제, 부정적인 컨트롤로 chr. 12에 섬으로 지역 규제 지역 및는 MHC의 유전자 시체로 결정 했다 클래스 II 유전자 HLA-DMA와 HLA DPB1 상부는 로커 스의 도식 표현 및 뇌관의 위치를 보여줍니다. 오차 막대는 두 생물 복제 triplicates 측정에서 표준 편차를 나타냅니다. 그림19게시 된 보고서 수정 되었습니다. <a href="https://cloudflare.jove.com/files/ftp_upload/57272/57272fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57272/57272fig3.jpg"> 그림 3: TNF 치료에 대 한 응답에서 IL8 발기인에 DNA 접근성의 변화. HeLa 세포는 TNF와 자극 했다 (20 ng/mL) 1 h와 시 키에 의해 분석. 사이의 비율 DNA ACTB (긍정적인 제어)의 발기인, chr. 12 (부정적인 제어), 섬으로 지역 및 IL8 발기인에 대 한 결정은 총 대 무료. 오차 막대는 3 생물 복제 중복 측정에서 평균 (SEM)의 표준 오류를 나타냅니다. <a href="https://cloudflare.jove.com/files/ftp_upload/57272/57272fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57272/57272fig4.jpg"> 그림 4: 쥡니다 조건의 최적화. Chromatin 293T 세포에서 추출한 집중된 sonicator 적절 한 튜브 (자료 테이블)와 함께 사용 하 여 sonified 했다. chromatin 30의 반복으로 지정 된 시간 동안 sonicated은 다음 설정 사용 하 여 s: 피크 파워 150, 듀티 계수 15, 버스트 500, 초당 사이클 버스트 500 초당 사이클 듀티 계수 15, 30 s: 피크 전력 2.5 다음. 결과 chromatin 드-가교 화, 2 %agarose 젤에 로드 및 페 놀: 클로 프롬 추출에 의해 순화 했다. ethidium 평범한 사람 젤을 얼룩이 표시 되 고 분자량 마커의 위치 혈압에 표시 됩니다. 이 실험에서 최적의 chromatin 크기 (200-300 bp) 쥡니다의 20 분 후 얻은 것입니다. <a href="https://cloudflare.jove.com/files/ftp_upload/57272/57272fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>뇌관</td>
			<td>시퀀스</td>
		</tr>
<tr>
<td>ACTB-발기인-F</td>
			<td>AAAGGCAACTTTCGGAACGG</td>
		</tr>
<tr>
<td>ACTB-발기인-R</td>
			<td>TTCCTCAATCTCGCTCTCGC</td>
		</tr>
<tr>
<td>Chr. 12 부정적인 제어-F</td>
			<td>ATGGTTGCCACTGGGGATCT</td>
		</tr>
<tr>
<td>Chr. 12 부정적인 제어-R</td>
			<td>TGCCAAAGCCTAGGGGAAGA</td>
		</tr>
<tr>
<td>HLA-DMA-XY-상자-F</td>
			<td>CATCAGTCACTGGGGAGACG</td>
		</tr>
<tr>
<td>HLA-DMA-XY-상자-R</td>
			<td>GCTTCCCAGCCCAGTTACAT</td>
		</tr>
<tr>
<td>HLA-DMA-5'-F</td>
			<td>GGAGAGAACAATCTCCGCTTCA</td>
		</tr>
<tr>
<td>HLA-DMA-5'-R</td>
			<td>AGCTGCTATGTGTGGTTGGT</td>
		</tr>
<tr>
<td>HLA-DMA-3'-F</td>
			<td>TGGGGACCTAGTTAGGGAGC</td>
		</tr>
<tr>
<td>HLA-DMA-3'-R</td>
			<td>AGATCCATGGGAGGAGGCTT</td>
		</tr>
<tr>
<td>HLA-DPB1-XY-상자-F</td>
			<td>GTCCAATCCCAGGGTCACAG</td>
		</tr>
<tr>
<td>HLA-DPB1-XY-상자-R</td>
			<td>TGAAAAGAGCTGCAGTCAGGA</td>
		</tr>
<tr>
<td>HLA-DPB1-5'-F</td>
			<td>GCGTGTTCATGTCTGCATCC</td>
		</tr>
<tr>
<td>HLA-DPB1-5'-R</td>
			<td>TGATCCTCAGAGCCTGGACA</td>
		</tr>
<tr>
<td>HLA-DPB1-3'-F</td>
			<td>CCAGCCTAGGGTGAATGTTT</td>
		</tr>
<tr>
<td>HLA-DPB1-3'-R</td>
			<td>GCCTGGGTAGAAATCCGTCA</td>
		</tr>
<tr>
<td>IL8 발기인-F</td>
			<td>GTGATGACTCAGGTTTGCCCT</td>
		</tr>
<tr>
<td>IL8 발기인-R</td>
			<td>CTTATGGAGTGCTCCGGTGG</td>
		</tr>
</tbody></table>표 1: 정량 Pcr 위한 뇌관입니다.
<img alt="Table 2" src="/files/ftp_upload/57272/57272table2.jpg"> 표 2: 예 랑 상대 복구 비율의 계산. <a href="http://cloudflare.jove.com/files/ftp_upload/57272/Table_2.xlsx">이 파일을 다운로드 하려면 여기를 클릭 하십시오.</a>

Watch this Scientific Journal Video about Formaldehyde-assisted Isolation of Regulatory Elements to Measure Chromatin Accessibility in Mammalian Cells at JoVE.com

Formaldehyde-assisted Isolation of Regulatory Elements to Measure Chromatin Accessibility in Mammalian Cells

포유류 세포에 측정 Chromatin 접근 규제 요소의 포 름 알 데히드 기반 격리

핵 건축의 소성 비 코딩 RNAs, DNA 메 틸 화, nucleosome 위치 뿐만 아니라 히스톤 구성 및 수정 등 동적 후 성적인 기계 장치에 의해 제어 됩니다. 여기는 재현할 싸고 간단 방식 chromatin 접근성의 결정을 허용 하는 Formaldehyde-Assisted 절연의 규제 요소 (시 키) 프로토콜에 설명 합니다.

Appropriate gene expression in response to extracellular cues, that is, tissue- and lineage-specific gene transcription, critically depends on highly ...

formaldehyde-assisted-isolation-regulatory-elements-to-measure

Research

JoVE Journal

Genetics

11.2K 조회수.  University Hospital Virgen del Rocío. 핵 건축의 소성 비 코딩 RNAs, DNA 메 틸 화, nucleosome 위치 뿐만 아니라 히스톤 구성 및 수정 등 동적 후 성적인 기계 장치에 의해 제어 됩니다. 여기는 재현할 싸고 간단 방식 chromatin 접근성의 결정을 허용 하는 Formaldehyde-Assisted 절연의 규제 요소 (시 키) 프로토콜에 설명 합니다.

비디오: Formaldehyde-assisted Isolation of Regulatory Elements to Measure Chromatin Accessibility in Mammalian Cells

Sequential Salt Extractions for the Analysis of Bulk Chromatin Binding Properties of Chromatin Modifying Complexes

Elucidation of the binding properties of chromatin-targeting proteins can be very challenging due to the complex nature of chromatin and the heterogeneous nature of most mammalian chromatin-modifying complexes. In order to overcome these hurdles, we have adapted a sequential salt extraction (SSE) assay for evaluating the relative binding affinities of chromatin-bound complexes. This easy and straightforward assay can be used by non-experts to evaluate the relative difference in binding affinity of two related complexes, the changes in affinity of a complex when a subunit is lost or an individual domain is inactivated, and the change in binding affinity after alterations to the chromatin landscape. By sequentially re-suspending bulk chromatin in increasing amounts of salt, we are able to profile the elution of a particular protein from chromatin. Using these profiles, we are able to determine how alterations in a chromatin-modifying complex or alterations to the chromatin environment affect binding interactions. Coupling SSE with other in vitro and in vivo assays, we can determine the roles of individual domains and proteins on the functionality of a complex in a variety of chromatin environments.

Sequential salt extraction of chromatin bound proteins is a useful tool for determining the binding properties of large protein complexes. This method can be employed to evaluate the role of individual subunits or domains in the overall affinity of a protein complex to bulk chromatin.

바인딩 속성 수정 복합물 Chromatin의 대량 Chromatin의 분석에 대 한 순차적 소금 기사

Elucidation of the binding properties of chromatin-targeting proteins can be very challenging due to the complex nature of chromatin and the heterogeneous ...

연구

유전학

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide RNA (sgRNA) that confers specificity, the Cas9 protein cleaves both DNA strands at the targeted locus. The DNA break can trigger either non-homologous end joining (NHEJ) or homology directed repair (HDR). NHEJ can introduce small deletions or insertions which lead to frame-shift mutations, while HDR allows for larger and more precise perturbations. Here, we present protocols for generating knockout cell lines by coupling established CRISPR/Cas9 methods with two options for downstream selection/screening. The NHEJ approach uses a single sgRNA cut site and selection-independent screening, where protein production is assessed by dot immunoblot in a high-throughput manner. The HDR approach uses two sgRNA cut sites that span the gene of interest. Together with a provided HDR template, this method can achieve deletion of tens of kb, aided by the inserted selectable resistance marker. The appropriate applications and advantages of each method are discussed.

Recent advances in the ability to genetically manipulate somatic cell lines hold great potential for basic and applied research. Here, we present two approaches for CRISPR/Cas9 generated knockout production and screening in mammalian cell lines, with and without the use of selectable markers.

포유류 세포에서 CRISPR / Cas9 매개 유전자 knockouts의 선택 의존 및 독립적 생성

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

Chromatin Immunoprecipitation (ChIP) in Mouse T-cell Lines

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational modifications (PTMs) of histone tails, the exchange of canonical histones with histone variants, and nucleosome eviction. Such regulation requires the binding of signal-sensitive transcription factors (TFs) that recruit chromatin-modifying enzymes at regulatory elements defined as enhancers. Understanding how signaling cascades regulate enhancer activity requires a comprehensive analysis of the binding of TFs, chromatin modifying enzymes, and the occupancy of specific histone marks and histone variants. Chromatin immunoprecipitation (ChIP) assays utilize highly specific antibodies to immunoprecipitate specific protein/DNA complexes. The subsequent analysis of the purified DNA allows for the identification the region occupied by the protein recognized by the antibody. This work describes a protocol to efficiently perform ChIP of histone proteins in a mature mouse T-cell line. The presented protocol allows for the performance of ChIP assays in a reasonable timeframe and with high reproducibility.

Chromatin Immunoprecipitation ChIP in Mouse T-cell Lines

This work describes a protocol for chromatin immunoprecipitation (ChIP) using a mature mouse T-cell line. This protocol is suitable to investigate the distribution of specific histone marks at specific promoter sites or genome-wide.

마우스 T- 세포주에서 Chromatin Immunoprecipitation (ChIP)

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational ...

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV integration sites can be used as functional markers of active regulatory elements. Here, we present a retroviral scanning tool, which allows the genome-wide identification of cell-specific enhancers and promoters. Briefly, the target cell population is transduced with an mLV-derived vector and genomic DNA is digested with a frequently cutting restriction enzyme. After ligation of genomic fragments with a compatible DNA linker, linker-mediated polymerase chain reaction (LM-PCR) allows the amplification of the virus-host genome junctions. Massive sequencing of the amplicons is used to define the mLV integration profile genome-wide. Finally, clusters of recurrent integrations are defined to identify cell-specific regulatory regions, responsible for the activation of cell-type specific transcriptional programs.
The retroviral scanning tool allows the genome-wide identification of cell-specific promoters and enhancers in prospectively isolated target cell populations. Notably, retroviral scanning represents an instrumental technique for the retrospective identification of rare populations (e.g. somatic stem cells) that lack robust markers for prospective isolation.

Here, we describe a protocol for genome-wide mapping of the integration sites of Moloney murine leukemia virus-based retroviral vectors in human cells.

레트로 바이러스 스캐닝 : MLV 통합 사이트 맵핑으로 세포 특정 규제 지역 정의

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

Chromatin Immunoprecipitation (ChIP) Protocol for Low-abundance Embryonic Samples

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, transcription factors, or chromatin-modifying enzymes at a given locus or on a genome-wide scale. The combination of ChIP assays with next-generation sequencing (i.e., ChIP-Seq) is a powerful approach to globally uncover gene regulatory networks and to improve the functional annotation of genomes, especially of non-coding regulatory sequences. ChIP protocols normally require large amounts of cellular material, thus precluding the applicability of this method to investigating rare cell types or small tissue biopsies. In order to make the ChIP assay compatible with the amount of biological material that can typically be obtained in vivo during early vertebrate embryogenesis, we describe here a simplified ChIP protocol in which the number of steps required to complete the assay were reduced to minimize sample loss. This ChIP protocol has been successfully used to investigate different histone modifications in various embryonic chicken and adult mouse tissues using low to medium cell numbers (5 x 104 - 5 x 105 cells). Importantly, this protocol is compatible with ChIP-seq technology using standard library preparation methods, thus providing global epigenomic maps in highly relevant embryonic tissues.

Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples

Here, we describe a chromatin immunoprecipitation (ChIP) and ChIP-seq library preparation protocol to generate global epigenomic profiles from low-abundance chicken embryonic samples.

낮은 풍부 배아 샘플 chromatin Immunoprecipitation (칩) 프로토콜

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, ...

Adaptation of Hybridization Capture of Chromatin-associated Proteins for Proteomics to Mammalian Cells

The hybridization capture of chromatin-associated proteins for proteomics (HyCCAPP) technology was initially developed to uncover novel DNA-protein interactions in yeast. It allows analysis of a target region of interest without the need for prior knowledge about likely proteins bound to the target region. This, in theory, allows HyCCAPP to be used to analyze any genomic region of interest, and it provides sufficient flexibility to work in different cell systems. This method is not meant to study binding sites of known transcription factors, a task better suited for Chromatin Immunoprecipitation (ChIP) and ChIP-like methods. The strength of HyCCAPP lies in its ability to explore DNA regions for which there is limited or no knowledge about the proteins bound to it. It can also be a convenient method to avoid biases (present in ChIP-like methods) introduced by protein-based chromatin enrichment using antibodies. Potentially, HyCCAPP can be a powerful tool to uncover truly novel DNA-protein interactions. To date, the technology has been predominantly applied to yeast cells or to high copy repeat sequences in mammalian cells. In order to become the powerful tool we envision, HyCCAPP approaches need to be optimized to efficiently capture single-copy loci in mammalian cells. Here, we present our adaptation of the initial yeast HyCCAPP capture protocol to human cell lines, and show that single-copy chromatin regions can be efficiently isolated with this modified protocol.

This is a method to identify novel DNA-interacting proteins at specific target loci, relying on sequence-specific capture of crosslinked chromatin for subsequent proteomic analyses. No prior knowledge about potential binding proteins, nor cell modifications are required. Initially developed for yeast, the technology has now been adapted for mammalian cells.

교 잡의 적응 포유류 세포 단백질 Chromatin 관련 단백질의 캡처

The hybridization capture of chromatin-associated proteins for proteomics (HyCCAPP) technology was initially developed to uncover novel DNA-protein ...

A Simple, Rapid, and Quantitative Assay to Measure Repair of DNA-protein Crosslinks on Plasmids Transfected into Mammalian Cells

The purpose of this method is to provide a flexible, rapid, and quantitative technique to examine the kinetics of DNA-protein crosslink (DPC) repair in mammalian cell lines. Rather than globally assaying removal of xenobiotic-induced or spontaneous chromosomal DPC removal, this assay examines the repair of a homogeneous, chemically defined lesion specifically introduced at one site within a plasmid DNA substrate. Importantly, this approach avoids the use of radioactive materials and is not dependent on expensive or highly-specialized technology. Instead, it relies on standard recombinant DNA procedures and widely available real-time, quantitative polymerase chain reaction (qPCR) instrumentation. Given the inherent flexibility of the strategy utilized, the size of the crosslinked protein, as well as the nature of the chemical linkage and the precise DNA sequence context of the attachment site can be varied to address the respective contributions of these parameters to the overall efficiency of DPC repair. Using this method, plasmids containing a site-specific DPC were transfected into cells and low molecular weight DNA recovered at various times post-transfection. Recovered DNA is then subjected to strand-specific primer extension (SSPE) using a primer complementary to the damaged strand of the plasmid. Since the DPC lesion blocks Taq DNA polymerase, the ratio of repaired to un-repaired DNA can be quantitatively assessed using qPCR. Cycle threshold (CT) values are used to calculate percent repair at various time points in the respective cell lines. This SSPE-qPCR method can also be used to quantitatively assess the repair kinetics of any DNA adduct that blocks Taq polymerase.

The goal of this protocol is to quantify the repair of defined DNA-protein crosslinks on plasmid DNA. Lesioned plasmids are transfected into recipient mammalian cell lines and low-molecular weight harvested at multiple time points post-transfection. DNA repair kinetics are quantified using strand-specific primer extension followed by qPCR.

간단 하 고 빠른, 양적 분석 결과에 플라스 미드 DNA-단백질 Crosslinks의 측정 수리에 포유류 세포로 페

The purpose of this method is to provide a flexible, rapid, and quantitative technique to examine the kinetics of DNA-protein crosslink (DPC) repair in ...

CRISPR-Mediated Reorganization of Chromatin Loop Structure

Recent studies have clearly shown that long-range, three-dimensional chromatin looping interactions play a significant role in the regulation of gene expression, but whether looping is responsible for or a result of alterations in gene expression is still unknown. Until recently, how chromatin looping affects the regulation of gene activity and cellular function has been relatively ambiguous, and limitations in existing methods to manipulate these structures prevented in-depth exploration of these interactions. To resolve this uncertainty, we engineered a method for selective and reversible chromatin loop re-organization using CRISPR-dCas9 (CLOuD9). The dynamism of the CLOuD9 system has been demonstrated by successful localization of CLOuD9 constructs to target genomic loci to modulate local chromatin conformation. Importantly, the ability to reverse the induced contact and restore the endogenous chromatin conformation has also been confirmed. Modulation of gene expression with this method establishes the capacity to regulate cellular gene expression and underscores the great potential for applications of this technology in creating stable de novo chromatin loops that markedly affect gene expression in the contexts of cancer and development.

Chromatin looping plays a significant role in gene regulation; however, there have been no technological advances that allow for selective and reversible modification of chromatin loops. Here we describe a powerful system for chromatin loop re-organization using CRISPR-dCas9 (CLOuD9), demonstrated to selectively and reversibly modulate gene expression at targeted loci.

Recent studies have clearly shown that long-range, three-dimensional chromatin looping interactions play a significant role in the regulation of gene ...

Chromatin Immunoprecipitation Assay Using Micrococcal Nucleases in Mammalian Cells

To express cellular phenotypes in organisms, living cells execute gene expression accordingly, and transcriptional programs play a central role in gene expression. The cellular transcriptional machinery and its chromatin modification proteins coordinate to regulate transcription. To analyze transcriptional regulation at the molecular level, several experimental methods such as electrophoretic mobility shift, transient reporter and chromatin immunoprecipitation (ChIP) assays are available. We describe a modified ChIP assay in detail in this article because of its advantages in directly showing histone modifications and the interactions between proteins and DNA in cells. One of the key steps in a successful ChIP assay is chromatin shearing. Although sonication is commonly used for shearing chromatin, it is difficult to identify reproducible conditions. Instead of shearing chromatin by sonication, we utilized enzymatic digestion with micrococcal nuclease (MNase) to obtain more reproducible results. In this article, we provide a straightforward ChIP assay protocol using MNase.

Chromatin immunoprecipitation (ChIP) is a powerful tool for understanding the molecular mechanisms of gene regulation. However, the method involves difficulties in obtaining reproducible chromatin fragmentation by mechanical shearing. Here, we provide an improved protocol for a ChIP assay using enzymatic digestion.

포유류 세포에서 미세 Coccal 뉴클레아제사용 염색질 면역침전 분석

To express cellular phenotypes in organisms, living cells execute gene expression accordingly, and transcriptional programs play a central role in gene ...

Exploring Sequence Space to Identify Binding Sites for Regulatory RNA-Binding Proteins

Gene regulation plays an important role in all cells. Transcriptional, post-transcriptional (or RNA processing), translational, and post-translational steps are used to regulate specific genes. Sequence-specific nucleic acid-binding proteins target specific sequences to control spatial or temporal gene expression. The binding sites in nucleic acids are typically characterized by mutational analysis. However, numerous proteins of interest have no known binding site for such characterization. Here we describe an approach to identify previously unknown binding sites for RNA-binding proteins. It involves iterative selection and amplification of sequences starting with a randomized sequence pool. Following several rounds of these steps-transcription, binding, and amplification-the enriched sequences are sequenced to identify a preferred binding site(s). Success of this approach is monitored using in vitro binding assays. Subsequently, in vitro and in vivo functional assays can be used to assess the biological relevance of the selected sequences. This approach allows identification and characterization of a previously unknown binding site(s) for any RNA-binding protein for which an assay to separate protein-bound and unbound RNAs exists.

Sequence specificity is critical for gene regulation. Regulatory proteins that recognize specific sequences are important for gene regulation. Defining functional binding sites for such proteins is a challenging biological problem. An iterative approach for identification of a binding site for an RNA-binding protein is described here and is applicable to all RNA-binding proteins.

규제 RNA 결합 단백질에 대한 결합 부위를 식별하기 위한 서열 공간 탐색

Gene regulation plays an important role in all cells. Transcriptional, post-transcriptional (or RNA processing), translational, and post-translational ...