Name: evaluation of exon inclusion induced by splice switching antisense oligonucleotides in sma patient fibroblasts
Uploaded: 2018-05-11T14:30:00
Description: Watch this Scientific Journal Video about Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts at JoVE.com

The authors thank Nicole McRorie for help with the experiments. This work was supported by the University of Alberta Faculty of Medicine and Dentistry, Slipchuk SMA Research Foundation Research Grant, the Canadian Institutes of Health Research (CIHR), the Friends of Garrett Cumming Research Funds, HM Toupin Neurological Science Research Funds, the Muscular Dystrophy Canada, the Canada Foundation for Innovation, Alberta Enterprise and Advanced Education, and the Women and Children's Health Research Institute (WCHRI).

1. Cell culture
<ol>
	<li>Culture SMA patient fibroblasts in the growth medium (Dulbecco&#39;s modified Eagle medium 1:1 F-12 (Ham) with 10% fetal bovine serum (FBS) and 0.5% penicillin/streptomycin) in a CO2 incubator at 37 &#176;C.</li>
	<li>Determine cell concentration using an automated cell counter and dilute cells to 1 x 105 cells/mL in the growth medium, then seed on the appropriate plate. Use 12-well plates (1&#160;mL per well) for RT-PCR or qPCR.</li>
	<li>Incubate the plates for 24 h in ...

<ol>
	<li>Iascone, D. M., Henderson, C. E., Lee, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+muscular+atrophy:+from+tissue+specificity+to+therapeutic+strategies.">Spinal muscular atrophy: from tissue specificity to therapeutic strategies.</a> F1000Prime Rep. 7, 4 (2015).</li><li>Touznik, A., Lee, J. J., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+developments+in+exon+skipping+and+splice+modulation+therapies+for+neuromuscular+diseases.">New developments in exon skipping and splice modulation therapies for neuromuscular diseases.</a> Expert Opin Biol Ther. 14 (6), 809-819 (2014).</li><li>Lefebvre, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+Characterization+of+a+Spinal+Muscular+Atrophy-Determining+Gene.">Identification and Characterization of a Spinal Muscular Atrophy-Determining Gene.</a> Cell. 80 (1), 155-165 (1995).</li><li>Lorson, C. L., Hahnen, E., Androphy, E. J., Wirth, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+nucleotide+in+the+SMN+gene+regulates+splicing+and+is+responsible+for+spinal+muscular+atrophy.">A single nucleotide in the SMN gene regulates splicing and is responsible for spinal muscular atrophy.</a> Proc Natl Acad Sci U S A. 96 (11), 6307-6311 (1999).</li><li>Monani, U. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+nucleotide+difference+that+alters+splicing+patterns+distinguishes+the+SMA+gene+SMN1+from+the+copy+gene+SMN2.">A single nucleotide difference that alters splicing patterns distinguishes the SMA gene SMN1 from the copy gene SMN2.</a> Hum Mol Genet. 8 (7), 1177-1183 (1999).</li><li>Lee, J. J., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+therapy+in+neurology.">Antisense therapy in neurology.</a> J Pers Med. 3 (3), 144-176 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Ther. 27 (2), 67-69 (2017).</li><li>Hua, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peripheral+SMN+restoration+is+essential+for+long-term+rescue+of+a+severe+spinal+muscular+atrophy+mouse+model.">Peripheral SMN restoration is essential for long-term rescue of a severe spinal muscular atrophy mouse model.</a> Nature. 478 (7367), 123-126 (2011).</li><li>Hua, Y., Vickers, T. A., Baker, B. F., Bennett, C. F., Krainer, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+SMN2+exon+7+inclusion+by+antisense+oligonucleotides+targeting+the+exon.">Enhancement of SMN2 exon 7 inclusion by antisense oligonucleotides targeting the exon.</a> PLoS Biol. 5 (4), 73 (2007).</li><li>Passini, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+oligonucleotides+delivered+to+the+mouse+CNS+ameliorate+symptoms+of+severe+spinal+muscular+atrophy.">Antisense oligonucleotides delivered to the mouse CNS ameliorate symptoms of severe spinal muscular atrophy.</a> Sci Transl Med. 3 (72), (2011).</li><li>Hammond, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systemic+peptide-mediated+oligonucleotide+therapy+improves+long-term+survival+in+spinal+muscular+atrophy.">Systemic peptide-mediated oligonucleotide therapy improves long-term survival in spinal muscular atrophy.</a> Proc Natl Acad Sci U S A. 113 (39), 10962-10967 (2016).</li><li>Porensky, P. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+administration+of+morpholino+antisense+oligomer+rescues+spinal+muscular+atrophy+in+mouse.">A single administration of morpholino antisense oligomer rescues spinal muscular atrophy in mouse.</a> Hum Mol Genet. 21 (7), 1625-1638 (2012).</li><li>Touznik, A., Maruyama, R., Hosoki, K., Echigoya, Y., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LNA/DNA+mixmer-based+antisense+oligonucleotides+correct+alternative+splicing+of+the+SMN2+gene+and+restore+SMN+protein+expression+in+type+1+SMA+fibroblasts.">LNA/DNA mixmer-based antisense oligonucleotides correct alternative splicing of the SMN2 gene and restore SMN protein expression in type 1 SMA fibroblasts.</a> Sci Rep. 7 (1), 3672 (2017).</li><li>Obika, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+2'-O,4'-C-methyleneuridine+and+-cytidine.+Novel+bicyclic+nucleosides+having+a+fixed+C-3,-endo+sugar+puckering.">Synthesis of 2'-O,4'-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C-3,-endo sugar puckering.</a> Tetrahedron Letters. 38 (50), 8735-8738 (1997).</li><li>Singh, S. K., Nielsen, P., Koshkin, A. A., Wengel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LNA+(locked+nucleic+acids):+synthesis+and+high-affinity+nucleic+acid+recognition.">LNA (locked nucleic acids): synthesis and high-affinity nucleic acid recognition.</a> Chemical Communications. (4), 455-456 (1998).</li><li>Navarro, E., Serrano-Heras, G., Castano, M. J., Solera, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+detection+chemistry.">Real-time PCR detection chemistry.</a> Clin Chim Acta. 439, 231-250 (2015).</li><li>Urbanek, M. O., Nawrocka, A. U., Krzyzosiak, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+RNA+Detection+by+in+Situ+Hybridization+Methods.">Small RNA Detection by in Situ Hybridization Methods.</a> Int J Mol Sci. 16 (6), 13259-13286 (2015).</li><li>Wahlestedt, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+nontoxic+antisense+oligonucleotides+containing+locked+nucleic+acids.">Potent and nontoxic antisense oligonucleotides containing locked nucleic acids.</a> Proc Natl Acad Sci U S A. 97 (10), 5633-5638 (2000).</li><li>Rupaimoole, R., Slack, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+therapeutics:+towards+a+new+era+for+the+management+of+cancer+and+other+diseases.">MicroRNA therapeutics: towards a new era for the management of cancer and other diseases.</a> Nat Rev Drug Discov. 16 (3), 203-222 (2017).</li><li>Lanford, R. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Therapeutic+silencing+of+microRNA-122+in+primates+with+chronic+hepatitis+C+virus+infection.">Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection.</a> Science. 327 (5962), 198-201 (2010).</li><li>Shimo, T., Maruyama, R., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designing+Effective+Antisense+Oligonucleotides+for+Exon+Skipping.">Designing Effective Antisense Oligonucleotides for Exon Skipping.</a> Methods Mol Biol. 1687, 143-155 (2018).</li><li>Shimo, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+evaluation+of+locked+nucleic+acid-based+splice-switching+oligonucleotides+in+vitro.">Design and evaluation of locked nucleic acid-based splice-switching oligonucleotides in vitro.</a> Nucleic Acids Res. 42 (12), 8174-8187 (2014).</li><li>Nguyen, Q., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalized+Muscle+Cell+Model+to+Test+the+Exon+Skipping+Efficacy+for+Duchenne+Muscular+Dystrophy.">Immortalized Muscle Cell Model to Test the Exon Skipping Efficacy for Duchenne Muscular Dystrophy.</a> J. Pers. Med. 7 (4), 13 (2017).</li><li>Echigoya, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+Antisense+Screening+and+Optimization+for+Exon+51+Skipping+in+Duchenne+Muscular+Dystrophy.">Quantitative Antisense Screening and Optimization for Exon 51 Skipping in Duchenne Muscular Dystrophy.</a> Mol Ther. , (2017).</li><li>Saito, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+PMO+found+in+dystrophic+dog+model+was+effective+in+cells+from+exon+7-deleted+DMD+patient.">Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient.</a> PLoS One. 5 (8), 12239 (2010).</li><li>Donnelly, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+murine+model+of+SMA.">Characterization of a murine model of SMA.</a> Neurobiol Dis. 45 (3), 992-998 (2012).</li><li>Lim, K. R., Maruyama, R., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eteplirsen+in+the+treatment+of+Duchenne+muscular+dystrophy.">Eteplirsen in the treatment of Duchenne muscular dystrophy.</a> Drug Des Devel Ther. 11, 533-545 (2017).</li><li>Paton, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nusinersen:+antisense+oligonucleotide+to+increase+SMN+protein+production+in+spinal+muscular+atrophy.">Nusinersen: antisense oligonucleotide to increase SMN protein production in spinal muscular atrophy.</a> Drugs Today (Barc). 53 (6), 327-337 (2017).</li><li>Prakash, T. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparing+in+vitro+and+in+vivo+activity+of+2'-O-[2-(methylamino)-2-oxoethyl]-+and+2'-O-methoxyethyl-modified+antisense+oligonucleotides.">Comparing in vitro and in vivo activity of 2'-O-[2-(methylamino)-2-oxoethyl]- and 2'-O-methoxyethyl-modified antisense oligonucleotides.</a> J Med Chem. 51 (9), 2766-2776 (2008).</li><li>Aoki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bodywide+skipping+of+exons+45-55+in+dystrophic+mdx52+mice+by+systemic+antisense+delivery.">Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery.</a> Proc Natl Acad Sci U S A. 109 (34), 13763-13768 (2012).</li></ol>

The in vitro evaluation method described here is fast, easy, and sensitive enough for the testing of various AONs. This protocol is widely applicable to exon skipping and inclusion of other genes and various cell types. In addition, most AON chemistries (except PMOs) can be transfected using this method. AONs can regulate splicing of pre-mRNA from both endogenous and artificially introduced genes, and can be co-transfected with plasmid vectors carrying targeted genes.
A critical step ...

Spinal muscular atrophy (SMA) is a fatal neuromuscular disorder inherited in an autosomal recessive pattern. It is characterized by the degradation of motor neurons and progressive trunk and limb muscle paralysis1,2. The majority of SMA occurrences are due to a homozygous mutation in the survival of motor neuron 1 (SMN1) gene3. The survival of motor neuron 2 (SMN2) gene is an inverse duplicate of SMN1, and has a nearly identical sequence differing by only five bases4,5. A C-to-T transition in SMN2 located in exon 7 makes the gene nearly nonfunctional because the mutation leads to the essential exon 7 being excluded in nearly 90% of SMN2 transcripts (Figure 1a). SMN2 mRNAs missing exon 7 cannot compensate for the SMN1 function because its protein product is unstable and is rapidly degraded.
Antisense therapy recently emerged as a very promising strategy for treating SMA6. The recent approval of nusinersen by the U.S. Food and Drug Administration (FDA) made it the first drug available for treating SMA7. Nusinersen is an 18-mer antisense oligonucleotide (AON) with a 2&#8242;-O-methoxyethyl modification (MOE) and a phosphorothioate backbone. The drug targets the intronic splicing silencer N1 (ISS-N1) located in intron 7 of the SMN2 gene. Binding of nusinersen to ISS-N1 promotes the recovery of functional full-length SMN protein expression from the endogenous SMN2 gene by inducing exon 7 inclusion (Figure 1a)8,9,10. Currently, many studies involving AON therapy for SMA focus on investigating novel AON chemistries that may be more effective and less toxic than nusinersen. It has been demonstrated that AONs with other chemistries also efficiently induce exon inclusion in SMN2 exon 7 both in vitro and in vivo11,12,13.
Locked nucleic acids (LNAs) are chemically modified RNA analogs containing a methylene bridge connecting the 4&#8242;-Carbon with the 2&#8242;-Oxygen within the furanose structure (Figure 1b)14,15. Compared to DNAs or RNAs, LNAs have an increased affinity for binding to complementary RNA sequences and have the added benefit of being highly resistant to endogenous nucleases. The LNA chemistry has been applied for use as probes for fluorescence in situ hybridization (FISH) and in qPCR16,17. Also, it is utilized to regulate gene expression both in vitro and in vivo. GapmeR AONs are a combination of single-stranded DNA molecules flanked by several LNAs at the 5&#8242; and 3&#8242; ends. They knock down gene expression by binding complementary to targeted mRNAs, causing them to be degraded by the activated RNase H18. LNA/DNA mixmers are AONs which are composed of DNA nucleotides integrated in between LNAs. Presented in this orientation they can bind miRNA to inhibit its function (LNA-antimiR)19. Some LNA-antimiRs have reached clinical development. For examples, miravirsen (AntimiR-122) is an LNA-antimiR that inhibits miR-122 to treat hepatitis C infection and several Phase II clinical trials are currently ongoing19,20. Recently, it has been demonstrated that LNA/DNA mixmers can also modulate RNA splicing21. It can bind a specific sequence of mRNA and induce exon skipping in dystrophin mRNA and exon inclusion in SMN2 mRNA in vitro13,22.
In this article, we outline a methodology for the induction of exon inclusion using AONs and the evaluation of efficacy at the RNA and protein levels. To exemplify this method, we used the LNA/DNA mixmers targeting ISS-N1 in intron 7 of SMN2. AONs transfected into SMA patient cells by lipotransfection induced exon 7 inclusion in the final SMN2 transcript and upregulation of SMN protein production. One of the advantages of using LNA/DNA mixmers to induce the exon inclusion is that the effective concentration for the transfection is significantly lower than other chemistries13. This method can be used for many other AONs except for phosphorodiamidate morpholino oligomers (PMOs), which, due to their neutral charge, need to enter cells through endocytosis induced by the Endo-Porter co-transfection reagent.

<table border="0" cellpadding="0" cellspacing="0" style="width:655px;" width="655">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">SMA Fibroblasts</td>
			<td style="width:153px;">Coriell NIGMS human genetic cell repository</td>
			<td style="width:119px;">GM03813</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">11320033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fetal Bovine Serum</td>
			<td style="width:153px;">Sigma-Aldrich</td>
			<td style="width:119px;">F1051</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Penicillin-Streptomycin (10,000 U/mL)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15140122</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Trypsin-EDTA (0.05%), phenol red</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">25300062</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Serum-deprived media</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">31985070</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Transfection reagent</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15338100</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">guanidinium thiocyanate-phenol-chloroform (TRIzol)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15596-018</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">RT-PCR Primers</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>Sequence 5&#39; to 3&#39;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SMN2 forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>CTGCCTCCATTTCCTTCTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TGGTGTCATTTAGTGCTGCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TCCCTGAGCTGAACGGGAAG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GGAGGAGTTTGGTCGCTGT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">qPCR Primers</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">full-length SMN2 forward:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GCTATCATACTGGCTATTATATGGGTTTT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">full-length SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>CTCTATGCCAGCATTTCTCCTTAAT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">&#8710;7&#160;SMN2 forward:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TCTGGACCACCAATAATTCCCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">&#8710;7&#160;SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>ATGCCAGCATTTCCATATAATAGCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GCAAATTCCATGGCACCGT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH reverse:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>AGGGATCTCGCTCCTGGAA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chloroform</td>
			<td style="width:153px;">Sigma-Aldrich</td>
			<td style="width:119px;">P3803</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Glycogen, RNA grade</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">R0551</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">ImageJ Software</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Protease cocktail inhibitor&#160;</td>
			<td style="width:153px;">Roche</td>
			<td style="width:119px;">11836153001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cathode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.025 M Tris base + 40&#160;mM 6-aminocaproic acid + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Anode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.03 M Tris Base + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Concentred Anode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.3 M Tris base + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Beta Mercaptoethanol&#160;</td>
			<td style="width:153px;">Millipore</td>
			<td style="width:119px;">ES-007-E</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PVDF membrane&#160;</td>
			<td style="width:153px;">GE</td>
			<td style="width:119px;">10600021</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Loading/sample buffer for Western blotting</td>
			<td style="width:153px;">NuPage Invitrogen</td>
			<td style="width:119px;">NP007</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">One-Step RT-PCR kit&#160;</td>
			<td style="width:153px;">Qiagen&#160;</td>
			<td style="width:119px;">210210</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">dNTPs</td>
			<td style="width:153px;">Clontech</td>
			<td style="width:119px;">3040</td>
			<td></td>
		</tr>
	</tbody>
</table>

evaluation of exon inclusion induced by splice switching antisense oligonucleotides in sma patient fibroblasts

Spinal muscular atrophy (SMA), a lethal neurological disease caused by the loss of SMN1, presents a unique case in the field of antisense oligonucleotide (AON)-mediated therapy. While SMN1 mutations are responsible for the disease, AONs targeting intronic splice silencer (ISS) sites in SMN2, including FDA-approved nusinersen, have been shown to restore SMN expression and ameliorate the symptoms. Currently, many studies involving AON therapy for SMA focus on investigating novel AON chemistries targeting SMN2 that may be more effective and less toxic than nusinersen. Here, we describe a protocol for in vitro evaluation of exon inclusion using lipotransfection of AONs followed by reverse transcription polymerase chain reaction (RT-PCR), quantitative polymerase chain reaction (qPCR), and Western blotting. This method can be employed for various types of AON chemistries. Using this method, we demonstrate that AONs composed of alternating locked nucleic acids (LNAs) and DNA nucleotides (LNA/DNA mixmers) lead to efficient SMN2 exon inclusion and restoration of SMN protein at a very low concentration, and therefore, LNA/DNA mixmer-based antisense oligonucleotides may be an attractive therapeutic strategy to treat splicing defects caused by genetic diseases. The in vitro evaluation method described here is fast, easy, and sensitive enough for the testing of various novel AONs.

Using SMA patient fibroblasts, we targeted the ISS-N1 silencer region in intron 7 of the SMN2 gene with eight different antisense LNA/DNA mixmers that were transfected at a 5 nM concentration (Figure 3). Each of the mixmers contained a modified phosphorothioated backbone which enabled them to resist nuclease degradation. To evaluate the efficacy of the mixmers, the rate of SMN2 exon 7 inclusion was quantified by RT-PCR and qPCR using primers...

Watch this Scientific Journal Video about Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts at JoVE.com

Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts

Various antisense oligonucleotides (AONs) have been shown to induce exon inclusion (splice modulation) and rescue SMN expression for spinal muscular atrophy (SMA). Here, we describe a protocol for AON lipotransfection to induce exon inclusion in the SMN2 gene and the evaluation methods to determine the efficacy in SMA patient fibroblasts.

Spinal muscular atrophy (SMA), a lethal neurological disease caused by the loss of SMN1, presents a unique case in the field of antisense oligonucleotide ...

The overall goal of this lipotransfection protocol is to introduce antisense oligonucleotides into the cells and evaluate the efficacy of these drugs on exon inclusion in SMA cells. This method can help answer key questions in the antisense therapy field. Such as, the efficacy of new antisense oligos to provide treatment for patients.The main advantage of this technique is that it is fast, easy and sensitive enough for the testing of various antisense oligonucleotide chemistries. Though this method can be used for the transfection of antisense oligos into fibroblasts, it can also be applied to other cell types, such as primary myoblasts and various other cell lines. Demonstrating the procedure will be Aleks, a technician from my laboratory.First, thaw a 10 micromolar solution of LNA/DNA mixmer on ice. Dilute the mixmer solution in serum-deprived media to the required concentration in a 1.5 milliliter tube. Next, dilute the transfection reagent and add the diluted transfection reagent to the mixmer in a one to one ratio.It is critical that the cell confluency is around 65 to 80%while doing the transfection. If the confluency is over 80%the transfection efficiency will be reduced. Then, incubate the transfection reagent mixture at room temperature for 10 minutes.After 10 minutes, pipet 900 microliters of serum-deprived medium with 5%fetal bovine serum to the tube. Do not add the FBS before the incubation with the transfection reagent and the LNA/DNA mixmers, as it also affects the transfection efficiency. Then, aspirate the old medium from the culture plate.Now, add one milliliter of the medium containing the LNA/DNA mixmer to the culture plate. Then, leave the plate in the incubator at 37 degrees Celsius for 24 to 48 hours. Following incubation, aspirate the medium from the culture plate.Then, pipet one milliliter of GPC reagent to the cells. Next, wash the wells several times with the GPC reagent. After several washes, collect the cells in a 1.5 milliliter tube and keep the samples on ice.Next, vortex the tube at high speed for 30 seconds. Then, store the tube at minus 80 degrees Celsius for an hour. Now, thaw the sample at room temperature and quickly vortex it.Next, add 200 microliters of chloroform to the sample and vigorously shake it for 15 seconds. Then, incubate the tube at room temperature for three minutes. After three minutes, centrifuge the sample at 12, 000 g for 15 minutes at four degrees Celsius.Once the centrifugation is over, collect the aqueous phase from the top of the centrifuge tube. Then transfer the aqueous phase in a new tube. Next, add 500 microliters of isopropanol and one microliter of eight micrograms per microliter of RNA-grade glycogen to the aqueous phase.Quickly vortex the sample for 10 seconds and incubate at room temperature for 10 minutes. After the incubation, centrifuge the sample at 12, 000 g for 10 minutes at four degrees Celsius. Decant the supernatent after the run is over.Add one milliliter of cold 75%ethanol and briefly vortex to wash the obtained pellet. Again, centrifuge the sample at 7500 g for five minutes at four degrees Celsius. Then, expel all the ethanol and dry the pellet at room temperature.After the pellet has dried up, dissolve it in 30 microliters of DNAse/RNAse free water. Then, incubate the sample at 60 degree Celsius for 10 minutes. Next, read the concentration of the RNA at 260 nanometers in the spectrophotometer and adjust it to 15 nanograms per microliter.To constitute the RT-PCR master mix, add the two X RT-PCR reaction buffer, one step RT-PCR enzyme mix, forward and reverse primers and RNAse/DNAse free distilled water. Distribute the master mix into 0.2 millimeter PCR tubes and add the total RNA for each respective sample. Then start the PCR reaction.After the RT-PCR is complete, add five microliters of six X loading dye to the amplified product. Then, load five microliters of the mixture on a 2%agarose gel. Start the electrophoresis unit at 100 volts for 40 minutes.First, the efficiency of different mixmers are studied. To do this, inclusion of the SMN2 exon 7 and GAPDH levels in SMA fibroblasts transfected with the mixmers are analyzed. The gel image shows inclusion of exon 7 where the top and the lower bands represent the exon 7 included and excluded SMN2 RNA.The inclusion efficiency is also quantified to be 78 to 98%when transfected with the mixmers one through five. On the other hand, no significant results are obtained when mixmer six to eight are used to transfect the patient SMA fibroblasts in comparison to the control. In the experiment, GAPDH is used as a control.Next, quantitative PCR is done to analyze the relative expression of the full length SMN2 in comparison to GAPDH. A sharp increase in the quantity of the SMN2 transcript level is observed when transfected with mixmers one to three and number five, in comparison to the control. The SMN protein expression level is also studied, which shows an increase in the SMN protein expression level in the patient fibroblast transfected with mixmers one through five.A sharp 1.5 to 1.9-fold increase in the SMN protein level is observed. Here, the control used is cofilin. On the contrary, mixmer six to eight do not alter the SMN protein expression level.After watching this video, you should have a good understanding of how to transfect antisense oligo to fibroblasts and evaluate the efficacy in vitro.

evaluation-exon-inclusion-induced-splice-switching-antisense

Research

JoVE Journal

Medicine

Vascular Occlusion Training for Inclusion Body Myositis: A Novel Therapeutic Approach

Inclusion body myositis (IBM) is a rare idiopathic inflammatory myopathy. It is known to produces remarkable muscle weakness and to greatly compromise function and quality of life. Moreover, clinical practice suggests that, unlike other inflammatory myopathies, the majority of IBM patients are not responsive to treatment with immunosuppressive or immunomodulatory drugs to counteract disease progression1. Additionally, conventional resistance training programs have been proven ineffective in restoring muscle function and muscle mass in these patients2,3. Nevertheless, we have recently observed that restricting muscle blood flow using tourniquet cuffs in association with moderate intensity resistance training in an IBM patient produced a significant gain in muscle mass and function, along with substantial benefits in quality of life4. Thus, a new non-pharmacological approach for IBM patients has been proposed. Herein, we describe the details of a proposed protocol for vascular occlusion associated with a resistance training program for this population.

The present article presents the details pertaining to the application of resistance training associated to vascular occlusion in IBM patients.

Inclusion body myositis (IBM) is a rare idiopathic inflammatory myopathy. It is known to produces remarkable muscle weakness and to greatly compromise ...

Experimental Generation of Carcinoma-Associated Fibroblasts (CAFs) from Human Mammary Fibroblasts

Carcinomas are complex tissues comprised of neoplastic cells and a non-cancerous compartment referred to as the 'stroma'. The stroma consists of extracellular matrix (ECM) and a variety of mesenchymal cells, including fibroblasts, myofibroblasts, endothelial cells, pericytes and leukocytes 1-3.
The tumour-associated stroma is responsive to substantial paracrine signals released by neighbouring carcinoma cells. During the disease process, the stroma often becomes populated by carcinoma-associated fibroblasts (CAFs) including large numbers of myofibroblasts. These cells have previously been extracted from many different types of human carcinomas for their in vitro culture. A subpopulation of CAFs is distinguishable through their up-regulation of &alpha;-smooth muscle actin (&alpha;-SMA) expression4,5. These cells are a hallmark of 'activated fibroblasts' that share similar properties with myofibroblasts commonly observed in injured and fibrotic tissues 6. The presence of this myofibroblastic CAF subset is highly related to high-grade malignancies and associated with poor prognoses in patients.
Many laboratories, including our own, have shown that CAFs, when injected with carcinoma cells into immunodeficient mice, are capable of substantially promoting tumourigenesis 7-10. CAFs prepared from carcinoma patients, however, frequently undergo senescence during propagation in culture limiting the extensiveness of their use throughout ongoing experimentation. To overcome this difficulty, we developed a novel technique to experimentally generate immortalised human mammary CAF cell lines (exp-CAFs) from human mammary fibroblasts, using a coimplantation breast tumour xenograft model.
In order to generate exp-CAFs, parental human mammary fibroblasts, obtained from the reduction mammoplasty tissue, were first immortalised with hTERT, the catalytic subunit of the telomerase holoenzyme, and engineered to express GFP and a puromycin resistance gene. These cells were coimplanted with MCF-7 human breast carcinoma cells expressing an activated ras oncogene (MCF-7-ras cells) into a mouse xenograft. After a period of incubation in vivo, the initially injected human mammary fibroblasts were extracted from the tumour xenografts on the basis of their puromycin resistance 11.
We observed that the resident human mammary fibroblasts have differentiated, adopting a myofibroblastic phenotype and acquired tumour-promoting properties during the course of tumour progression. Importantly, these cells, defined as exp-CAFs, closely mimic the tumour-promoting myofibroblastic phenotype of CAFs isolated from breast carcinomas dissected from patients. Our tumour xenograft-derived exp-CAFs therefore provide an effective model to study the biology of CAFs in human breast carcinomas. The described protocol may also be extended for generating and characterising various CAF populations derived from other types of human carcinomas.

Experimental Generation of Carcinoma-Associated Fibroblasts CAFs from Human Mammary Fibroblasts

Carcinoma-associated fibroblasts (CAFs) rich in myofibroblasts present within the tumour stroma, play a major role in driving tumour progression. We developed a coimplantation tumour xengraft model for experimentally generating CAFs from human mammary fibroblasts. The protocol describes how to establish CAF myofibroblasts that acquire an ability to promote tumourigenesis.

Carcinomas are complex tissues comprised of neoplastic cells and a non-cancerous compartment referred to as the 'stroma'. The stroma consists of ...

Mouse Model of Intraluminal MCAO: Cerebral Infarct Evaluation by Cresyl Violet Staining

Stroke is the third cause of mortality and the leading cause of disability in the World. Ischemic stroke accounts for approximately 80% of all strokes. However, the thrombolytic tissue plasminogen activator (tPA) is the only treatment of acute ischemic stroke that exists. This led researchers to develop several ischemic stroke models in a variety of species. Two major types of rodent models have been developed: models of global cerebral ischemia or focal cerebral ischemia. To mimic ischemic stroke in patients, in whom approximately 80% thrombotic or embolic strokes occur in the territory of the middle cerebral artery (MCA), the intraluminal middle cerebral artery occlusion (MCAO) model is quite relevant for stroke studies. This model was first developed in rats by Koizumi et al. in 1986 1. Because of the ease of genetic manipulation in mice, these models have also been developed in this species 2-3.
	Herein, we present the transient MCA occlusion procedure in C57/Bl6 mice. Previous studies have reported that physical properties of the occluder such as tip diameter, length, shape, and flexibility are critical for the reproducibility of the infarct volume 4. Herein, a commercial silicon coated monofilaments (Doccol Corporation) have been used. Another great advantage is that this monofilament reduces the risk to induce subarachnoid hemorrhages. Using the Zeiss stereo-microscope Stemi 2000, the silicon coated monofilament was introduced into the internal carotid artery (ICA) via a cut in the external carotid artery (ECA) until the monofilament occludes the base of the MCA. Blood flow was restored 1 hour later by removal of the monofilament to mimic the restoration of blood flow after lysis of a thromboembolic clot in humans. The extent of cerebral infarct may be evaluated first by a neurologic score and by the measurement of the infarct volume. Ischemic mice were thus analyzed for their neurologic score at different post-reperfusion times. To evaluate the infarct volume, staining with 2,3,5-triphenyltetrazolium chloride (TTC) was usually performed. Herein, we used cresyl violet staining since it offers the opportunity to test many critical markers by immunohistochemistry. In this video, we report the MCAO procedure; neurological scores and the evaluation of the infarct volume by cresyl violet staining.

The intraluminal middle cerebral occlusion model in mice is herein presented. The extent of cerebral infarct is evaluated by a neurologic score and cresyl violet staining, an alternative staining to TTC, offering the great advantage to test in parallel many interest markers.

Stroke is the third  cause of mortality and the leading cause of disability in the World. Ischemic  stroke accounts for approximately 80% of all strokes. ...

Cardiac Stress Test Induced by Dobutamine and Monitored by Cardiac Catheterization in Mice

Dobutamine is a &beta;-adrenergic agonist with an affinity higher for receptor expressed in the heart (&beta;1) than for receptors expressed in the arteries (&beta;2). When systemically administered, it increases cardiac demand. Thus, dobutamine unmasks abnormal rhythm or ischemic areas potentially at risk of infarction. 
Monitoring of heart function during a cardiac stress test can be performed by either ecocardiography or cardiac catheterization. The latter is an invasive but more accurate and informative technique that the former.
Cardiac stress test induced by dobutamine and monitored by cardiac catheterization accomplished as described here allows, in a single experiment, the measurement of the following hemodynamic parameters: heart rate (HR), systolic pressure, diastolic pressure, end-diastolic pressure, maximal positive pressure development (dP/dtmax) and maximal negative pressure development (dP/dtmin), at baseline conditions and under increasing doses of dobutamine.
As expected, in normal mice we observed a dobutamine dose-related increase in HR, dP/dtmax and dP/dtmin. Moreover, at the highest dose tested (12 ng/g/min) the cardiac decompensation of high fat diet-induced obese mice was unmasked.

We describe the protocol to perform a cardiac stress test induced by dobutamine and monitored by cardiac catheterization in normal mice. Also we show its application to unmask subclinical cardiac disease in high fat diet-induced obese mice.

Dobutamine is a &beta;-adrenergic agonist with an affinity higher for receptor expressed in the heart (&beta;1) than for receptors expressed in the ...

Evaluation of Lung Metastasis in Mouse Mammary Tumor Models by Quantitative Real-time PCR

Metastatic disease is the spread of malignant tumor cells from the primary cancer site to a distant organ and is the primary cause of cancer associated death 1. Common sites of metastatic spread include lung, lymph node, brain, and bone 2. Mechanisms that drive metastasis are intense areas of cancer research. Consequently, effective assays to measure metastatic burden in distant sites of metastasis are instrumental for cancer research. Evaluation of lung metastases in mammary tumor models is generally performed by gross qualitative observation of lung tissue following dissection. Quantitative methods of evaluating metastasis are currently limited to ex vivo and in vivo imaging based techniques that require user defined parameters. Many of these techniques are at the whole organism level rather than the cellular level 3-6. Although newer imaging methods utilizing multi-photon microscopy are able to evaluate metastasis at the cellular level 7, these highly elegant procedures are more suited to evaluating mechanisms of dissemination rather than quantitative assessment of metastatic burden. Here, a simple in vitro method to quantitatively assess metastasis is presented. Using quantitative Real-time PCR (QRT-PCR), tumor cell specific mRNA can be detected within the mouse lung tissue.

This protocol describes how to use quantitative Real-time PCR (QRT-PCR) to detect tumor cell specific mRNA representing metastasis within the mouse lung tissue.

Metastatic disease is the spread of malignant tumor cells from the primary cancer site to a distant organ and is the primary cause of cancer associated ...

Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy

Duchenne muscular dystrophy (DMD) is one of the most common lethal genetic diseases worldwide, caused by mutations in the dystrophin (DMD) gene. Exon skipping employs short DNA/RNA-like molecules called antisense oligonucleotides (AONs) that restore the reading frame and produce shorter but functional proteins. However, exon skipping therapy faces two major hurdles: limited applicability (up to only 13% of patients can be treated with a single AON drug), and uncertain function of truncated proteins. These issues were addressed with a cocktail AON approach. While approximately 70% of DMD patients can be treated by single exon skipping (all exons combined), one could potentially treat more than 90% of DMD patients if multiple exon skipping using cocktail antisense drugs can be realized. The canine X-linked muscular dystrophy (CXMD) dog model, whose phenotype&#160;is&#160;more similar to human DMD patients, was&#160;used to test the systemic efficacy and safety of multi-exon skipping of exons 6 and 8. The CXMD dog model harbors a splice site mutation in intron 6, leading to a lack of exon 7 in dystrophin mRNA. To restore the reading frame in CXMD requires multi-exon skipping of exons 6 and 8; therefore, CXMD is a good middle-sized animal model for testing the efficacy and safety of multi-exon skipping. In the current study, a cocktail of antisense morpholinos targeting exon 6 and exon 8 was designed and it restored dystrophin expression in body-wide skeletal muscles. Methods for transfection/injection of cocktail oligos and evaluation of the efficacy and safety of multi-exon skipping in the CXMD dog model are presented.

Exon skipping is currently a&#160;most promising therapeutic option for Duchenne muscular dystrophy (DMD). To expand the applicability for DMD patients and to optimize the stability/function of the resulting truncated dystrophin proteins, a multi-exon skipping approach using cocktail antisense oligonucleotides was developed and we demonstrated systemic dystrophin rescue in a dog model.

Duchenne muscular dystrophy (DMD) is one of the most common lethal genetic diseases worldwide, caused by mutations in the dystrophin (DMD) gene. Exon ...

A Model of Glaucoma Induced by Circumlimbal Suture in Rats and Mice

The circumlimbal suture is a technique for inducing experimental glaucoma in rodents by chronically elevating intraocular pressure (IOP), a well-known risk factor for glaucoma. This protocol demonstrates a step-by-step guide on this technique in Long Evans rats and C57BL/6 mice. Under general anesthesia, a "purse-string" suture is applied on the conjunctiva, around the equator and behind the limbus of the eye. The fellow eye serves as an untreated control. Over the duration of our study, which was a period of 8 weeks for rats and 12 weeks for mice, IOP remained elevated, as measured regularly by rebound tonometry in conscious animals without topical anesthesia. In both species, the sutured eyes showed electroretinogram features consistent with preferential inner retinal dysfunction. Optical coherence tomography showed selective thinning of the retinal nerve fiber layer. Histology of the rat retina in cross-section found reduced cell density in the ganglion cell layer, but no change in other cellular layers. Staining of flat-mounted mouse retinae with a ganglion cell specific marker (RBPMS) confirmed ganglion cell loss. The circumlimbal suture is a simple, minimally invasive and cost-effective way to induce ocular hypertension that leads to ganglion cell injury in both rats and mice.

Chronic ocular hypertension is induced by applying a circumlimbal suture in rats and mice, leading to functional and structural deterioration of the retinal ganglion cells consistent with glaucoma.

The circumlimbal suture is a technique for inducing experimental glaucoma in rodents by chronically elevating intraocular pressure (IOP), a well-known ...

Quantitative [18F]-Naf-PET-MRI Analysis for the Evaluation of Dynamic Bone Turnover in a Patient with Facetogenic Low Back Pain

Imaging techniques that reflect dynamic bone turnover may aid in characterizing a wide range of bone pathologies. Bone is a dynamic tissue undergoing continuous remodeling with the competing activity of osteoblasts, which produce the new bone matrix, and osteoclasts, whose function is to eliminate mineralized bone. [18F]-NaF is a positron emission tomography (PET) radiotracer that enables visualization of bone metabolism. [18F]-NaF is chemically absorbed into hydroxyapatite in the bone matrix by osteoblasts and can thus noninvasively detect osteoblastic activity, which is occult to conventional imaging techniques. Kinetic modeling of dynamic [18F]-NaF-PET data provides detailed quantitative measures of bone metabolism. Conventional semi-quantitative PET data, which utilizes standardized uptake values (SUVs) as a measure of radiotracer activity, is referred to as a static technique due to its snapshot of tracer uptake in time.&#160; Kinetic modeling, however, utilizes dynamic image data where tracer levels are continuously acquired providing tracer uptake temporal resolution. From the kinetic modeling of dynamic data, quantitative values like blood flow and metabolic rate (i.e., potentially informative metrics of tracer dynamics) can be extracted, all with respect to the measured activity in the image data. When combined with dual modality PET-MRI, region-specific kinetic data can be correlated with anatomically registered high-resolution structural and pathologic information afforded by MRI. The goal of this methodological manuscript is to outline detailed techniques for performing and analyzing dynamic [18F]-NaF-PET-MRI data. The lumbar facet joint is a common site of degenerative arthritis disease and a common cause for axial low back pain.&#160; Recent studies suggest [18F]-NaF-PET may serve as a useful biomarker of painful facetogenic disease.&#160; The human lumbar facet joint will, therefore, be used as a prototypical region of interest for dynamic [18F]-NaF-PET-MRI analysis in this manuscript.

Quantitative [18F]-Naf-PET-MRI Analysis for the Evaluation of Dynamic Bone Turnover in a Patient with Facetogenic Low Back Pain

Imaging techniques that reflect dynamic bone turnover may aid in characterizing a wide range of bone pathologies. We present detailed methodologies for performing and analyzing dynamic [18F]-NaF-PET-MRI data in a patient with facetogenic low back pain using the lumbar facet joints as a prototypical region of interest.

Imaging techniques that reflect dynamic bone turnover may aid in characterizing a wide range of bone pathologies. Bone is a dynamic tissue undergoing ...

Invasive Hemodynamic Assessment for the Right Ventricular System and Hypoxia-Induced Pulmonary Arterial Hypertension in Mice

Pulmonary arterial hypertension (PAH) is a chronic and severe cardiopulmonary disorder. Mice are a popular animal model used to mimic this disease. However, the evaluation of right ventricular pressure (RVP) and pulmonary artery pressure (PAP) remains technically challenging in mice. RVP and PAP are more difficult to measure than left ventricular pressure because of the anatomical differences between the left and right heart systems. In this paper, we describe a stable right heart hemodynamic measurement method and its validation using healthy and PAH mice. This method is based on open-chest surgery and mechanical ventilation support. It is a complicated procedure compared to closed chest procedures. While a well-trained surgeon is required for this surgery, the advantage of this procedure is that it can generate both RVP and PAP parameters at the same time, so it is a preferable procedure for the evaluation of PAH models.

Here, we present a protocol to perform an invasive hemodynamic assessment of the right ventricle and pulmonary artery in mice using an open-chest surgery approach.

Pulmonary arterial hypertension (PAH) is a chronic and severe cardiopulmonary disorder. Mice are a popular animal model used to mimic this disease. ...

Osteoarthritis Pain Model Induced by Intra-Articular Injection of Mono-Iodoacetate in Rats

The current animal models of osteoarthritis (OA) can be divided into spontaneous models and induced models, both of which aim to simulate the pathophysiological changes of human OA. However, as the main symptom in the late stage of OA, pain affects the patients&#39; daily life, and there are not many available models. The mono-iodoacetate (MIA)-induced model is the most widely used OA pain model, mainly used in rodents. MIA is an inhibitor of glyceraldehyde-3-phosphate dehydrogenase, which causes chondrocyte death, cartilage degeneration, osteophyte, and measurable changes in animal behavior. Besides, expression changes of matrix metalloproteinase (MMP) and pro-inflammatory cytokines (IL1 &#946; and TNF &#945;) can be detected in the MIA-induced model. Those changes are consistent with OA pathophysiological conditions in humans, indicating that MIA can induce a measurable and successful OA pain model. This study aims to describe the methodology of intra-articular injection of MIA in rats and discuss the resulting pain-related behaviors and histopathological changes.

This study describes the method of intra-articular injection of mono-iodoacetate in rats and discusses the resulting pain-related behaviors and histopathological changes, which provide references for future applications.