We would like to acknowledge the laboratory of Lane Christenson for providing the digital PCR machine used in these experiments and for the technical support provided. We would also like to thank Dr. Thomas Yankee for his guidance and mentorship. These studies were supported by the Tripp Family Foundation.

All mouse experiments were performed in compliance, and with approval from, the University of Kansas Medical Center Institutional Animal Care and Use Committee. All healthy human blood samples were obtained under informed consent and with approval from the Institutional Review Board at the University of Kansas Medical Center.
1. Irradiation of NSG Mice
<ol>
	<li>One day prior to PBMC injection, irradiate 8&#8211;12-week old NSG mice (either sex can be used). In a sterile biosafety cabinet, place mice in a sterilized pie cage or microisolator. Irradiate mice in a Cs137 source or small animal irradiator (e.g., RS 2000) with a total dose of 150 cGy with slow rotation to ensure even irradiation.</li>
	<li>Place mice into clean cages in a sterile biosafety cabinet.</li>
</ol>
2. Preparation of human PBMC for injection
<ol>
	<li>Collect enough healthy human blood to isolate 1.1 x 107 PBMC per mouse. Dilute the heparinized blood in an equal volume of 2% fetal bovine serum (FBS) in phosphate buffered saline (PBS). 
	NOTE: With this protocol, the PMBC yield is generally 0.5&#8211;1 x 107 per 10 mL of whole blood. Each mouse will receive 107 PBMC in 100 &#181;L of PBS. The extra 1 x 106 in 10 &#181;L per mouse ensures that each mouse receives the full dosage of PBMC, should there be any issues with filling syringes.</li>
	<li>Add 15 mL lymphocyte separation density gradient medium (e.g., Ficoll) to a 50 mL conical tube and then carefully overlay up to 25 mL of diluted blood on top of the density gradient. Centrifuge the tube containing density gradient and diluted blood at 400 x g for 40 min at room temperature without brake.</li>
	<li>Harvest the PBMC interface into 10 mL of PBS in a 50 mL conical tube. Centrifuge the cells at 400 x g for 10 min. Remove the supernatant.</li>
	<li>Loosen pellet by flicking tube and resuspend in 10 mL PBS to wash the PBMC. Centrifuge the cells at 400 x g for 5 min.</li>
	<li>(Optional) Discard the supernatant and lyse red blood cells (RBCs) in the cell pellet by adding a volume of Ammonium-Chloride-Potassium (ACK) lysis buffer that is equal to the pellet volume. Gently resuspend the pellet and swirl the tube for 30&#8211;60 s. Fill tube with serum-free RPMI media and centrifuge the tube at 400 x g for 5 min.</li>
	<li>Remove the supernatant and re-suspend the cell pellet in 5 mL of PBS. Count the cells using trypan blue exclusion with a hemocytometer and a microscope.</li>
	<li>Centrifuge the cells at 400 x g for 5 min. Remove the supernatant and resuspend cells at 1 x 108 cells/mL in PBS.</li>
</ol>
3. Retro-orbital injection of human PBMC into mice21
<ol>
	<li>Place an anesthesia chamber in a laminar flow hood to maintain sterility. Pre-charge the anesthesia chamber with 5% isoflurane and 1 L/min oxygen flow rate for 5 min.</li>
	<li>Reduce isoflurane to 2% and put mice from the same cage into the anesthesia chamber. Once mice lose righting, anesthetize mice for 5 min in chamber. During this time, pre-fill syringe with 100 &#181;L (1 x 107 cells) of cell suspension.</li>
	<li>Place mouse on a heating pad with its nose in a nose cone to maintain anesthesia. Check for loss of consciousness by pinching a foot pad and checking for lack of reflex.</li>
	<li>Restrain mouse with the thumb and middle finger. Insert the 28 G 1/2 in needle with the bevel down lateral to the medial canthus, through the conjunctival membrane until the back of the eye is reached. Slightly retract the needle and slowly inject 100 &#956;L of cells (1 x 107 cells).</li>
	<li>Fully retract the needle and properly dispose of the syringe and needle. Close the eyelid and apply mild pressure to the injection site with a gauze sponge.</li>
	<li>Examine the injection site for swelling or other visible trauma. Allow the mouse to regain consciousness in a sterile cage lined with paper towels to prevent aspiration of bedding before moving to home cage.&#160;After any bleeding has stopped, apply a single drop of proparacaine to the eye for analgesia. 
	NOTE: Tail vein injection is an alternative method of intravenous injection of PBMC for this protocol as described by Macholz et al.22.</li>
</ol>
4. Clinical Scoring of acute GVHD in Mice (Figure 1)23
<ol>
	<li>Measure GVHD score every other day until mice reach a score of a 2 and then every day until day of sacrifice.
	<ol>
		<li>Place the cage in a laminar flow hood, remove the food and water and put the lid back on. Score activity by observing mice for 5 min and assign scores as follows: 0 = mouse starts walking within a couple minutes and keeps walking around cage, 1 = mouse takes a more than a couple minutes to get up and walks slowly around cage, 2 = mouse doesn&#8217;t get up in 5 min and only walks when touched.</li>
	</ol>
	</li>
	<li>Weigh each mouse in a glass beaker and give a weight loss score: 0 = &#60;10% change, 1 = 10&#8211;25% change and 2 = &#62;25% change.</li>
	<li>While the mouse is still in the beaker, inspect for posture: 0 = normal, 1 = hunching at rest, 2 = hunching impairs movement; fur texture: 0 = normal, 1 = mild to moderate ruffling, 2 = severe ruffling, and skin integrity : 0 = normal, 1 = scaling of paws/tail, 2 = obvious areas of denuded skin (look at ears, tail and paws for scaling).</li>
	<li>With five categories and a score of 0&#8211;2 for each category, a mouse can reach a maximum score of 10. When a mouse reaches a score of 7 or greater or reaches 42 days post-injection, euthanize mouse via CO2 euthanasia or other method approved by the local Institutional Animal Care and Use Committee. 
	NOTE: To ensure accuracy of results, the scoring is performed by a researcher who is blinded to the treatment groups24. Additionally, although &#62;20% of body weight loss is the recommended humane endpoint for many IACUC protocols, with additional justification IACUC approval of this protocol can be obtained.</li>
</ol>
5. Harvesting tissues for genomic DNA from euthanized mice and isolating genomic DNA
<ol>
	<li>Dissect mice using sterile surgical tools. Cut a small piece of tissue about 3 mm x 0.5 mm in size from an organ of interest, e.g., lung, liver, or spleen. Weigh the tissue sample and place the tissue piece in a sterile 1.5 mL tube. If collecting multiple tissues, wash tools with ethanol between cutting each organ.</li>
	<li>Freeze tissues by submerging the tubes containing the tissue in liquid nitrogen until it stops bubbling and store in -80 &#176;C overnight. Thaw the tissue samples and lyse them according to a genomic DNA (gDNA) isolation kit.</li>
	<li>Isolate genomic DNA according to manufacturer&#8217;s instructions as described in the kit. Be sure to note the amount of tissue that was processed per microliter of eluted gDNA (mg/&#956;L). 
	NOTE: Frozen tissues can be stored at -80 &#176;C for processing at a later time.</li>
</ol>
6. Quantification of human T cells using digital PCR (Figure 2)
<ol>
	<li>Prepare digital PCR reactions according to the protocol for DNA binding dyes for the digital PCR machine being used. Use the following primers specific for human CD3 epsilon genomic DNA (NCBI Reference Sequence: NG_007383.1); Forward Primer: AGGCTGCCTTAACTCCCAAG, Reverse Primer: GCCCTACCAGCTGTGGAAAC. These primers will yield a single band of 105 bp. 
	NOTE: Add 0.5 &#956;L of a restriction enzyme, such as HindIII, to each reaction to digest the genomic DNA. Be sure to test out different gDNA dilutions to optimize separation of positive and negative droplets. Additionally, a subset of infiltrating T cells may be non-pathogenic regulatory T cells. These cells can be quantified using additional primers for regulatory T cell markers.</li>
	<li>Carry out the digital PCR reaction under the following conditions: Lid at 105 &#176;C, 95 &#176;C for 10 min (1 cycle); 95 &#176;C for 30 s, ramp 2 &#176;C/s and 55 &#176;C for 1 min, ramp 2 &#176;C/s (40 cycles); 72 &#176;C for 10 min, 12 &#176;C hold. 
	NOTE: These parameters may need to be adjusted depending on digital PCR equipment.</li>
	<li>Acquire digital PCR data with analysis software. Report data as numbers of copies per mg of tissue using the following equation: (number of copies/&#956;L) x (&#956;L of gDNA in reaction) x (dilution factor)/(mg of tissue/&#956;L of total gDNA )</li>
</ol>

<ol>
	<li>Jagasia, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Risk+factors+for+acute+GVHD+and+survival+after+hematopoietic+cell+transplantation.">Risk factors for acute GVHD and survival after hematopoietic cell transplantation.</a> Blood. 119 (1), 296-307 (2012).</li><li>Bolanos-Meade, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phase+3+clinical+trial+of+steroids/mycophenolate+mofetil+vs+steroids/placebo+as+therapy+for+acute+GVHD:+BMT+CTN+0802.">Phase 3 clinical trial of steroids/mycophenolate mofetil vs steroids/placebo as therapy for acute GVHD: BMT CTN 0802.</a> Blood. 124 (22), 3221-3227 (2014).</li><li>Gooley, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduced+mortality+after+allogeneic+hematopoietic-cell+transplantation.">Reduced mortality after allogeneic hematopoietic-cell transplantation.</a> New England Journal of Medicine. 363 (22), 2091-2101 (2010).</li><li>Hahn, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Significant+improvement+in+survival+after+allogeneic+hematopoietic+cell+transplantation+during+a+period+of+significantly+increased+use,+older+recipient+age,+and+use+of+unrelated+donors.">Significant improvement in survival after allogeneic hematopoietic cell transplantation during a period of significantly increased use, older recipient age, and use of unrelated donors.</a> Journal of Clinical Oncology. 31 (19), 2437-2449 (2013).</li><li>Khoury, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+survival+after+acute+graft-versus-host+disease+diagnosis+in+the+modern+era.">Improved survival after acute graft-versus-host disease diagnosis in the modern era.</a> Haematologica. 102 (5), 958-966 (2017).</li><li>King, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+peripheral+blood+leucocyte+non-obese+diabetic-severe+combined+immunodeficiency+interleukin-2+receptor+gamma+chain+gene+mouse+model+of+xenogeneic+graft-versus-host-like+disease+and+the+role+of+host+major+histocompatibility+complex.">Human peripheral blood leucocyte non-obese diabetic-severe combined immunodeficiency interleukin-2 receptor gamma chain gene mouse model of xenogeneic graft-versus-host-like disease and the role of host major histocompatibility complex.</a> Clinical &amp; Experimental Immunology. 157 (1), 104-118 (2009).</li><li>Lucas, P. J., Shearer, G. M., Neudorf, S., Gress, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+antimurine+xenogeneic+cytotoxic+response.+I.+Dependence+on+responder+antigen-presenting+cells.">The human antimurine xenogeneic cytotoxic response. I. Dependence on responder antigen-presenting cells.</a> Journal of Immunology. 144 (12), 4548-4554 (1990).</li><li>Ito, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+sensitive+model+for+xenogenic+GVHD+using+severe+immunodeficient+NOG+mice.">Highly sensitive model for xenogenic GVHD using severe immunodeficient NOG mice.</a> Transplantation. 87 (11), 1654-1658 (2009).</li><li>Kawasaki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+Analysis+of+the+Activation+and+Proliferation+Kinetics+and+Effector+Functions+of+Human+Lymphocytes,+and+Antigen+Presentation+Capacity+of+Antigen-Presenting+Cells+in+Xenogeneic+Graft-Versus-Host+Disease.">Comprehensive Analysis of the Activation and Proliferation Kinetics and Effector Functions of Human Lymphocytes, and Antigen Presentation Capacity of Antigen-Presenting Cells in Xenogeneic Graft-Versus-Host Disease.</a> Biology of Blood and Marrow Transplantation. 24 (8), 1563-1574 (2018).</li><li>Ito, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Novel+Xenogeneic+Graft-Versus-Host+Disease+Model+for+Investigating+the+Pathological+Role+of+Human+CD4(+)+or+CD8.">A Novel Xenogeneic Graft-Versus-Host Disease Model for Investigating the Pathological Role of Human CD4(+) or CD8.</a> T Cells Using Immunodeficient NOG Mice. American Journal of Transplantation. 17 (5), 1216-1228 (2017).</li><li>Trotta, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+anti-IL-2+antibody+that+potentiates+regulatory+T+cells+by+a+structure-based+mechanism.">A human anti-IL-2 antibody that potentiates regulatory T cells by a structure-based mechanism.</a> Nature Medicine. 24 (7), 1005-1014 (2018).</li><li>Dijke, I. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discarded+Human+Thymus+Is+a+Novel+Source+of+Stable+and+Long-Lived+Therapeutic+Regulatory+T+Cells.">Discarded Human Thymus Is a Novel Source of Stable and Long-Lived Therapeutic Regulatory T Cells.</a> American Journal of Transplantation. 16 (1), 58-71 (2016).</li><li>Huang, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+Gingiva-Derived+Mesenchymal+Stem+Cells+Inhibit+Xeno-Graft-versus-Host+Disease+via+CD39-CD73-Adenosine+and+IDO+Signals.">Human Gingiva-Derived Mesenchymal Stem Cells Inhibit Xeno-Graft-versus-Host Disease via CD39-CD73-Adenosine and IDO Signals.</a> Frontiers in Immunology. 8, 68 (2017).</li><li>Stockis, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blocking+immunosuppression+by+human+Tregs+in+vivo+with+antibodies+targeting+integrin+alphaVbeta8.">Blocking immunosuppression by human Tregs in vivo with antibodies targeting integrin alphaVbeta8.</a> Proceedings of the National Academy of Sciences of the United States of America. 114 (47), E10161-E10168 (2017).</li><li>Vogelstein, B., Kinzler, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR.">Digital PCR.</a> Proceedings of the National Academy of Sciences of the United States of America. 96 (16), 9236-9241 (1999).</li><li>Quan, P. L., Sauzade, M., Brouzes, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=dPCR:+A+Technology+Review.">dPCR: A Technology Review.</a> Sensors (Basel). 18 (4), (2018).</li><li>Sykes, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitation+of+targets+for+PCR+by+use+of+limiting+dilution.">Quantitation of targets for PCR by use of limiting dilution.</a> Biotechniques. 13 (3), 444-449 (1992).</li><li>Ma, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Bacterial+Contamination+in+Goat+Milk+Powder+Using+PacBio+Single+Molecule+Real-Time+Sequencing+and+Droplet+Digital+PCR.">Evaluation of Bacterial Contamination in Goat Milk Powder Using PacBio Single Molecule Real-Time Sequencing and Droplet Digital PCR.</a> Journal of Food Protection. , 1791-1799 (2018).</li><li>Vitale, S. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+optimized+workflow+to+evaluate+estrogen+receptor+gene+mutations+in+small+amounts+of+cell-free+DNA.">An optimized workflow to evaluate estrogen receptor gene mutations in small amounts of cell-free DNA.</a> Journal of Molecular Diagnostics. , (2018).</li><li>Gorgannezhad, L., Umer, M., Islam, M. N., Nguyen, N. T., Shiddiky, M. J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+tumor+DNA+and+liquid+biopsy:+opportunities,+challenges,+and+recent+advances+in+detection+technologies.">Circulating tumor DNA and liquid biopsy: opportunities, challenges, and recent advances in detection technologies.</a> Lab Chip. 18 (8), 1174-1196 (2018).</li><li>Yardeni, T., Eckhaus, M., Morris, H. D., Huizing, M., Hoogstraten-Miller, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retro-orbital+injections+in+mice.">Retro-orbital injections in mice.</a> LabAnimal. 40 (5), 155-160 (2011).</li><li>Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Manual+restraint+and+common+compound+administration+routes+in+mice+and+rats.">Manual restraint and common compound administration routes in mice and rats.</a> Journal of Visualized Experiments. (67), (2012).</li><li>Cooke, K. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+experimental+model+of+idiopathic+pneumonia+syndrome+after+bone+marrow+transplantation:+I.+The+roles+of+minor+H+antigens+and+endotoxin.">An experimental model of idiopathic pneumonia syndrome after bone marrow transplantation: I. The roles of minor H antigens and endotoxin.</a> Blood. 88 (8), 3230-3239 (1996).</li><li>Weisdorf, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prospective+grading+of+graft-versus-host+disease+after+unrelated+donor+marrow+transplantation:+a+grading+algorithm+versus+blinded+expert+panel+review.">Prospective grading of graft-versus-host disease after unrelated donor marrow transplantation: a grading algorithm versus blinded expert panel review.</a> Biology of Blood and Marrow Transplantation. 9 (8), 512-518 (2003).</li><li>Nervi, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Factors+affecting+human+T+cell+engraftment,+trafficking,+and+associated+xenogeneic+graft-vs-host+disease+in+NOD/SCID+beta2mnull+mice.">Factors affecting human T cell engraftment, trafficking, and associated xenogeneic graft-vs-host disease in NOD/SCID beta2mnull mice.</a> Experimental Hematology. 35 (12), 1823-1838 (2007).</li><li>Leon-Rico, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+haematopoietic+stem+cell+engraftment+through+the+retro-orbital+venous+sinus+and+the+lateral+vein:+alternative+routes+for+bone+marrow+transplantation+in+mice.">Comparison of haematopoietic stem cell engraftment through the retro-orbital venous sinus and the lateral vein: alternative routes for bone marrow transplantation in mice.</a> LabAnimal. 49 (2), 132-141 (2015).</li><li>Ali, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xenogeneic+graft-versus-host-disease+in+NOD-scid+IL-2Rgammanull+mice+display+a+T-effector+memory+phenotype.">Xenogeneic graft-versus-host-disease in NOD-scid IL-2Rgammanull mice display a T-effector memory phenotype.</a> PLoS One. 7 (8), e44219 (2012).</li><li>van Rijn, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+xenograft+model+for+graft-versus-host+disease+by+intravenous+transfer+of+human+peripheral+blood+mononuclear+cells+in+RAG2-/-+gammac-/-+double-mutant+mice.">A new xenograft model for graft-versus-host disease by intravenous transfer of human peripheral blood mononuclear cells in RAG2-/- gammac-/- double-mutant mice.</a> Blood. 102 (7), 2522-2531 (2003).</li><li>Wunderlich, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=OKT3+prevents+xenogeneic+GVHD+and+allows+reliable+xenograft+initiation+from+unfractionated+human+hematopoietic+tissues.">OKT3 prevents xenogeneic GVHD and allows reliable xenograft initiation from unfractionated human hematopoietic tissues.</a> Blood. 123 (24), e134-e144 (2014).</li><li>Schroeder, M. A., DiPersio, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+of+graft-versus-host+disease:+advances+and+limitations.">Mouse models of graft-versus-host disease: advances and limitations.</a> Disease Models &amp; Mechanisms. 4 (3), 318-333 (2011).</li><li>Zeiser, R., Blazar, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preclinical+models+of+acute+and+chronic+graft-versus-host+disease:+how+predictive+are+they+for+a+successful+clinical+translation?.">Preclinical models of acute and chronic graft-versus-host disease: how predictive are they for a successful clinical translation?.</a> Blood. 127 (25), 3117-3126 (2016).</li></ol>

No conflicts of interest declared.

Disease progression is generally consistent in the xenoGVHD model, even with injection of PBMC from different donors, so multiple experiments can be combined. The key steps required to maintain this consistency are proper i.v. injection technique, blinding and consistent scoring. A study by Nervi et al.25 demonstrated that compared to intravenous tail vein injection, retro-orbital injections of PBMC resulted in more consistent engraftment and more severe GVHD. Leon-Rico et al.26<...

Allogeneic hematopoietic stem cell transplant (HSCT) has become routine treatment for patients suffering from hematological malignancies such as leukemia with poor prognosis. A significant complication of HSCT is acute graft-versus-host disease (GVHD). A 2012 study reported that acute GVHD developed in 39% of HSCT patients receiving transplants from sibling donors and 59% of patients receiving transplants from unrelated donors1. Acute GVHD occurs when donor-derived T cells attack recipient&#8217;s organs. The only successful therapy for GVHD is treatment with highly immunosuppressive drugs2, which are highly toxic and increase the risk of infection and tumor recurrence. Thus, despite improvements that have been made in acute GVHD survival in recent years3,4,5, there is still a critical need for improved GVHD therapies with minimal toxicity that promote long-term remission.
The overall goal of the following methods is to induce and score xenogeneic GVHD (xenoGVHD). The xenoGVHD model was developed as a tool to induce acute GVHD with human cells rather than murine cells allowing for more direct translation of pre-clinical GVHD research to clinical trials6. This model involves intravenously injecting human peripheral blood mononuclear cells (PBMC) into NOD-SCID IL-2R&#947;null (NSG) mice that are sublethally irradiated. Injected human T cells are activated by human antigen presenting cells (APCs) presenting murine antigen and the activated T cells migrate to distant tissues resulting in systemic inflammation and ultimately death6,7,8,9,10. Disease pathology and progression in the xenoGVHD model closely mimic human acute GVHD. Specifically, the pathogenic human T cells are reactive to murine major histocompatibility complex (MHC) proteins, which is similar to the T cell alloreactivity in human GVHD6,9. The primary advantage of the xenoGVHD model over the mouse MHC-mismatch model, the other widely used GVHD model, is it allows for testing of therapies on human cells rather than murine cells. This allows for testing of products that can directly be translated to the clinic without any modifications because they are made to target human cells. Recently, this model has been used to test a human anti-IL-2 antibody11, human thymic regulatory T cells (Tregs)12 and human mesenchymal stem cells13 as potential treatments for acute GVHD. In a wider context, this model can be used as an in vivo suppression assay for any drug or cell type that can suppress human T cell activity. For example, Stockis et al.14 used the xenoGVHD model to study the effect of blocking integrin &#945;V&#946;8 on Treg suppressive activity in vivo. Thus, the xenoGVHD model can provide insight into the mechanism of any therapy targeting T cells in an in vivo setting.
An additional method described in this protocol is how to detect human T cells in mouse tissues using digital polymerase chain reaction (dPCR). The goal of this method is to offer a tool to quantify migration and proliferation of T cells in target tissues, which measure efficacy of immunosuppressive therapies being tested in this model. dPCR is a relatively novel method for quantification of nucleic acids15. Briefly, the PCR reaction mixture is divided into partitions that contain small numbers of the target sequence or no target at all. The target sequence is then amplified and detected using DNA intercalating dyes or fluorescent target-specific probes. dPCR quantifies the number of copies of target sequence based on the fraction of positive partitions and Poisson&#8217;s statistics15,16. Detecting T cells with dPCR requires much less tissue compared with other alternative methods, including flow cytometry and histology, and can be performed on frozen or fixed tissue. dPCR does not require a standard curve to determine copy numbers, nor are technical replicates required. This reduces the amount of reagent and template DNA needed for dPCR compared to traditional quantitative PCR (qPCR)16. Partitioning the PCR reaction into sub-reactions in dPCR effectively concentrates targets17. Thus, dPCR is primarily a tool for detection of rare targets in a large amount of non-target DNA. For example, dPCR is being used to detect bacterial contamination in milk18, identify rare mutations in the estrogen receptor gene19, and detect circulating tumor DNA in the blood of patients20. In this protocol, dPCR serves as an efficient tool for detecting and quantifying human T cells in tissues of mice with xenoGVHD.

<table>
	<tbody>
		<tr>
			<td>1.5 mL eppendorf tubes</td>
			<td>Fisher</td>
			<td>05-408-129</td>
			<td></td>
		</tr>
		<tr>
			<td>10 mL serological pipet</td>
			<td>VWR International</td>
			<td>89130-898</td>
			<td></td>
		</tr>
		<tr>
			<td>10mL BD Vacutainers - Green capped with Sodium Heparin</td>
			<td>Becton Dickinson</td>
			<td>366480</td>
			<td></td>
		</tr>
		<tr>
			<td>250 &#181;L Ranin pipette tips</td>
			<td>Rainin</td>
			<td>17001118</td>
			<td>Do not use other pipettes or pipet tips for droplet generation</td>
		</tr>
		<tr>
			<td>50 mL conical tube</td>
			<td>VWR International</td>
			<td>89039-656</td>
			<td></td>
		</tr>
		<tr>
			<td>96-Well ddPCR plate</td>
			<td>Bio-Rad</td>
			<td>12001925</td>
			<td></td>
		</tr>
		<tr>
			<td>ACK (Ammonium-Chloride-Potassium) Lysing Buffer</td>
			<td>Lonza</td>
			<td>10-548E</td>
			<td>Optional</td>
		</tr>
		<tr>
			<td>Alcohol Wipes</td>
			<td>Fisher Scientific</td>
			<td>6818</td>
			<td></td>
		</tr>
		<tr>
			<td>Anesthesia Chamber</td>
			<td>World Precision Instruments</td>
			<td>EZ-178</td>
			<td>Provided by animal facility</td>
		</tr>
		<tr>
			<td>Anesthesia Machine</td>
			<td>Parkland Scientific</td>
			<td>PM1002</td>
			<td>Provided by animal facility</td>
		</tr>
		<tr>
			<td>BD Vacutainer Safety-Lok Blood Collection Set</td>
			<td>Becton Dickinson</td>
			<td>367281</td>
			<td></td>
		</tr>
		<tr>
			<td>DG8 Cartridges and Gaskets for QX100/QX200 Droplet Generator</td>
			<td>Bio-Rad</td>
			<td>1864007</td>
			<td></td>
		</tr>
		<tr>
			<td>DNAse and RNAse free Molecular Grade H2O</td>
			<td>Life Technologies</td>
			<td>1811318</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethyl alcohol, Pure,200 proof, for molecular biology</td>
			<td>Sigma-Aldrich</td>
			<td>E7023-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Atlanta Biologicals</td>
			<td>S11150</td>
			<td></td>
		</tr>
		<tr>
			<td>Ficoll</td>
			<td>Fisher Scientific</td>
			<td>45001750</td>
			<td></td>
		</tr>
		<tr>
			<td>Insulin Syringe</td>
			<td>Fisher Scientific</td>
			<td>329424</td>
			<td></td>
		</tr>
		<tr>
			<td>Isoflurane</td>
			<td>Sigma-Aldrich</td>
			<td>CDS019936</td>
			<td>Provided by animal facility</td>
		</tr>
		<tr>
			<td>Liquid nitrogen</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse Irradiator Pie Cage</td>
			<td>Braintree Scientific, Inc.</td>
			<td>MPC 1</td>
			<td>Holds up to 11 mice</td>
		</tr>
		<tr>
			<td>Nexcare Gentle Paper Tape (a.k.a. 3M Micropore Surgical Tape / 3/4&#34;)</td>
			<td>Fisher Scientific</td>
			<td>19-027-761</td>
			<td></td>
		</tr>
		<tr>
			<td>P1000 pipetman</td>
			<td>MidSci</td>
			<td>A-1000</td>
			<td></td>
		</tr>
		<tr>
			<td>P200 pipetman</td>
			<td>MidSci</td>
			<td>A-200</td>
			<td></td>
		</tr>
		<tr>
			<td>Pierceable Foil Heat Seal</td>
			<td>Bio-Rad</td>
			<td>1814040</td>
			<td></td>
		</tr>
		<tr>
			<td>Pipetaid Gilson Macroman</td>
			<td>Fisher Scientific</td>
			<td>F110756</td>
			<td></td>
		</tr>
		<tr>
			<td>Pipet-Lite Multi Pipette L8-200XLS+</td>
			<td>Rainin</td>
			<td>17013805</td>
			<td>Do not use other pipettes or pipet tips for droplet generation</td>
		</tr>
		<tr>
			<td>Qiagen DNeasy Blood and Tissue Kit</td>
			<td>Qiagen</td>
			<td>69506</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR plates</td>
			<td>VWR International</td>
			<td>89218-292</td>
			<td></td>
		</tr>
		<tr>
			<td>QX200 Droplet Digital PCR System</td>
			<td>Bio-Rad</td>
			<td>12001925</td>
			<td>Includes droplet generator, droplet reader, laptop computer, software, associated component consumables, for EvaGreen or probe-based digital PCR applications</td>
		</tr>
		<tr>
			<td>QX200 Droplet Generation Oil for EvaGreen</td>
			<td>Bio-Rad</td>
			<td>1864006</td>
			<td></td>
		</tr>
		<tr>
			<td>QX200 ddPCR EvaGreen Supermix</td>
			<td>Bio-Rad</td>
			<td>1864033</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase and DNase-free plate seal</td>
			<td>Thermo Scientific</td>
			<td>12565491</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI Advanced 1640</td>
			<td>Life Technologies</td>
			<td>12633012</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Gauze Pads (2&#34; x 2&#34;, 12-Ply)</td>
			<td>Fisher Scientific</td>
			<td>67522</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Phosphate Buffered Saline</td>
			<td>Fisher Scientific</td>
			<td>21040CV</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile reservoir</td>
			<td>VWR International</td>
			<td>89094-662</td>
			<td></td>
		</tr>
		<tr>
			<td>Surgial Scissors</td>
			<td>Kent Scientific</td>
			<td>INS600393-4</td>
			<td></td>
		</tr>
		<tr>
			<td>Surgical Forceps</td>
			<td>Kent Scientific</td>
			<td>INS650914-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

induction and scoring of graft-versus-host disease in a xenogeneic murine model and quantification of human t cells in mouse tissues using digital pcr

Acute graft-versus-host disease (GVHD) is a significant limitation for patients receiving hematopoietic stem cell transplant as therapy for hematological deficiencies and malignancies. Acute GVHD occurs when donor T cells recognize host tissues as a foreign antigen and mount an immune response to the host. Current treatments involve toxic immunosuppressive drugs that render patients susceptible to infection and recurrence. Thus, there is ongoing research to provide an acute GVHD therapy that can effectively target donor T cells and reduce side effects. Much of this pre-clinical work uses the xenogenic GVHD (xenoGVHD) murine model that allows for testing of immunosuppressive therapies on human cells rather than murine cells in an in vivo system. This protocol outlines how to induce xenoGVHD and how to blind and standardize clinical scoring to ensure consistent results. Additionally, this protocol describes how to use digital PCR to detect human T cells in mouse tissues, which can subsequently be used to quantify efficacy of tested therapies. The xenoGVHD model not only provides a model to test GVHD therapies but any therapy that can suppress human T cells, which could then be applied to many inflammatory diseases.

Sublethally irradiated 8-12-week old NSG mice of both sexes that received human PBMC started displaying clinical signs of GVHD around day 10 post injection compared to negative control mice that received PBS only (Figure 1A). XenoGVHD mice had a median survival of 23.5 days (Figure 1B). With digital PCR, CD3 epsilon positive human T cells could be detected in the lung and liver samples of mice that received human PBMC. Tissue sam...

Watch this Scientific Journal Video about Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR at JoVE

Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR

디지털 PCR을 사용하여 마우스 조직에서 인간 T 세포의 Xegeneic Murine 모델 및 정량화에서 이식편 대 숙주 질환의 유도 및 채점

Here, we present a protocol to induce and score disease in a xenogeneic graft-versus-host disease (xenoGVHD) model. xenoGVHD provides an in vivo model to study immunosuppression of human T cells. Additionally, we describe how to detect human T cells in tissues with digital PCR as a tool to quantify immunosuppression.

Acute graft-versus-host disease (GVHD) is a significant limitation for patients receiving hematopoietic stem cell transplant as therapy for hematological ...

induction-scoring-graft-versus-host-disease-xenogeneic-murine-model

Research

JoVE Journal

Immunology and Infection

7.0K 조회수.  University of Kansas Medical Center. 이 프로토콜은 xenograft 대 숙주 질병, 또는 xenoGVHD를 유도하는 방법과 일관된 결과를 보장하기 위해 임상 점수를 장님및 표준화하는 방법을 설명합니다. xenoGVHD 모델은 뮤린 T 세포가 아닌 인간에 대한 면역 억제 요법을 테스트하여 이러한 연구의 번역을 클리닉으로 개선하는 생체 내 방법을 제공합니다. 절차를 시연하는 것은 내 실험실에서 대학원생 인 아마라 셍 (Amara Seng)이 ...

비디오: Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR

Retroviral Transduction of T-cell Receptors in Mouse T-cells

T-cell receptors (TCRs) play a central role in the immune system. TCRs on T-cell surfaces can specifically recognize peptide antigens presented by antigen presenting cells (APCs)1. This recognition leads to the activation of T-cells and a series of functional outcomes (e.g. cytokine production, killing of the target cells). Understanding the functional role of TCRs is critical to harness the power of the immune system to treat a variety of immunology related diseases (e.g. cancer or autoimmunity).
It is convenient to study TCRs in mouse models, which can be accomplished in several ways. Making TCR transgenic mouse models is costly and time-consuming and currently there are only a limited number of them available2-4. Alternatively, mice with antigen-specific T-cells can be generated by bone marrow chimera. This method also takes several weeks and requires expertise5. Retroviral transduction of TCRs into in vitro activated mouse T-cells is a quick and relatively easy method to obtain T-cells of desired peptide-MHC specificity. Antigen-specific T-cells can be generated in one week and used in any downstream applications. Studying transduced T-cells also has direct application to human immunotherapy, as adoptive transfer of human T-cells transduced with antigen-specific TCRs is an emerging strategy for cancer treatment6.
Here we present a protocol to retrovirally transduce TCRs into in vitro activated mouse T-cells. Both human and mouse TCR genes can be used. Retroviruses carrying specific TCR genes are generated and used to infect mouse T-cells activated with anti-CD3 and anti-CD28 antibodies. After in vitro expansion, transduced T-cells are analyzed by flow cytometry.

We present a protocol to produce antigen-specific mouse T-cells using retroviral transduction

마우스 T - 세포에서 T - 세포 수용체의 Retroviral 전달

T-cell receptors (TCRs) play a central role in the immune system. TCRs on T-cell surfaces can specifically recognize peptide antigens presented by antigen ...

연구

면역학 및 감염병학

Induction of Graft-versus-host Disease and In Vivo T Cell Monitoring Using an MHC-matched Murine Model

Graft-versus-host disease (GVHD) is the limiting barrier to the broad use of bone marrow transplant as a curative therapy for a variety of hematological deficiencies. GVHD is caused by mature alloreactive T cells present in the bone marrow graft that are infused into the recipient and cause damage to host organs. However, in mice, T cells must be added to the bone marrow inoculum to cause GVHD. Although extensive work has been done to characterize T cell responses post transplant, bioluminescent imaging technology is a non-invasive method to monitor T cell trafficking patterns in vivo. 
Following lethal irradiation, recipient mice are transplanted with bone marrow cells and splenocytes from donor mice. T cell subsets from L2G85.B6 (transgenic mice that constitutively express luciferase) are included in the transplant. By only transplanting certain T cell subsets, one is able to track specific T cell subsets in vivo, and based on their location, develop hypotheses regarding the role of specific T cell subsets in promoting GVHD at various time points. At predetermined intervals post transplant, recipient mice are imaged using a Xenogen IVIS CCD camera. Light intensity can be quantified using Living Image software to generate a pseudo-color image based on photon intensity (red = high intensity, violet = low intensity). 
Between 4-7 days post transplant, recipient mice begin to show clinical signs of GVHD. Cooke et al.1 developed a scoring system to quantitate disease progression based on the recipient mice fur texture, skin integrity, activity, weight loss, and posture. Mice are scored daily, and euthanized when they become moribund. Recipient mice generally become moribund 20-30 days post transplant. 
Murine models are valuable tools for studying the immunology of GVHD. Selectively transplanting particular T cell subsets allows for careful identification of the roles each subset plays. Non-invasively tracking T cell responses in vivo adds another layer of value to murine GVHD models.

Induction of Graft-versus-host Disease and In Vivo T Cell Monitoring Using an MHC-matched Murine Model

Murine bone marrow transplantation is a widely used technique to study immunological mechanisms governing graft-versus-host disease in humans. The ability to monitor T cell trafficking patterns in vivo allows for detailed analysis of the development and perpetuation of T cell responses during graft-versus-host disease.

이식 - 대 - 호스트 질병의 유도 및<em&gt; 생체 내</emMHC 검색 손쥐 모델을 사용&gt; T 셀 모니터링

Graft-versus-host disease (GVHD) is the limiting barrier to the broad use of bone marrow transplant as a curative therapy for a variety of hematological ...

piggyBac Transposon System Modification of Primary Human T Cells

The piggyBac transposon system is naturally active, originally derived from the cabbage looper moth1,2. This non-viral system is plasmid based, most commonly utilizing two plasmids with one expressing the piggyBac transposase enzyme and a transposon plasmid harboring the gene(s) of interest between inverted repeat elements which are required for gene transfer activity. PiggyBac mediates gene transfer through a "cut and paste" mechanism whereby the transposase integrates the transposon segment into the genome of the target cell(s) of interest. PiggyBac has demonstrated efficient gene delivery activity in a wide variety of insect1,2, mammalian3-5, and human cells6 including primary human T cells7,8. Recently, a hyperactive piggyBac transposase was generated improving gene transfer efficiency9,10.
Human T lymphocytes are of clinical interest for adoptive immunotherapy of cancer11. Of note, the first clinical trial involving transposon modification of human T cells using the Sleeping beauty transposon system has been approved12. We have previously evaluated the utility of piggyBac as a non-viral methodology for genetic modification of human T cells. We found piggyBac to be efficient in genetic modification of human T cells with a reporter gene and a non-immunogenic inducible suicide gene7. Analysis of genomic integration sites revealed a lack of preference for integration into or near known proto-oncogenes13. We used piggyBac to gene-modify cytotoxic T lymphocytes to carry a chimeric antigen receptor directed against the tumor antigen HER2, and found that gene-modified T cells mediated targeted killing of HER2-positive tumor cells in vitro and in vivo in an orthotopic mouse model14. We have also used piggyBac to generate human T cells resistant to rapamycin, which should be useful in cancer therapies where rapamycin is utilized15.
Herein, we describe a method for using piggyBac to genetically modify primary human T cells. This includes isolation of peripheral blood mononuclear cells (PBMCs) from human blood followed by culture, gene modification, and activation of T cells. For the purpose of this report, T cells were modified with a reporter gene (eGFP) for analysis and quantification of gene expression by flow cytometry.
PiggyBac can be used to modify human T cells with a variety of genes of interest. Although we have used piggyBac to direct T cells to tumor antigens14, we have also used piggyBac to add an inducible safety switch in order to eliminate gene modified cells if needed7. The large cargo capacity of piggyBac has also enabled gene transfer of a large rapamycin resistant mTOR molecule (15 kb)15. Therefore, we present a non-viral methodology for stable gene-modification of primary human T cells for a wide variety of purposes.

piggyBac Transposon System Modification of Primary Human T Cells

We describe a method to genetically modify primary human T cells with a transgene using the non-viral piggyBac transposon system. T cells modified to using the piggyBac transposon system exhibit stable transgene expression.

기본 인간 T 세포 piggyBac Transposon 시스템 변경

The piggyBac transposon system is naturally active, originally derived from the cabbage looper moth1,2. This non-viral system is plasmid based, most ...

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages and disadvantages. We describe here an experimental colitis model that is initiated by adoptive transfer of syngeneic splenic CD4+CD45RBhigh T cells into T and B cell deficient recipient mice. The CD4+CD45RBhigh T cell population that largely consists of na&#239;ve effector cells is capable of inducing chronic intestinal inflammation, closely resembling key aspects of human IBD. This method can be manipulated to study aspects of disease onset and progression. Additionally it can be used to study the function of innate, adaptive, and regulatory immune cell populations, and the role of environmental exposures, i.e., the microbiota, in intestinal inflammation. In this article we illustrate the methodology for inducing colitis with a step-by-step protocol. This includes a video demonstration of key technical aspects required to successfully develop this murine model of experimental colitis for research purposes.

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Here, we present a protocol to induce colonic inflammation in mice by adoptive transfer of syngeneic CD4+CD45RBhigh T cells into T and B cell deficient recipients. Clinical and histopathological features mimic human inflammatory bowel diseases. This method allows the study of the initiation of colonic inflammation and progression of disease.

이펙터 CD4의 입양 전송하여 쥐과 장내 염증의 유도<sup&gt; +</sup&gt; CD45RB<sup&gt; 높은</sup&gt; 면역 결핍 마우스에게 T 세포

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages ...

Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) resulting in cognitive and motor impairment. Experimental autoimmune encephalomyelitis (EAE) is a useful animal model of MS, because it is also characterized by lesion formation in the CNS, motor impairment and is also driven by autoimmune and inflammatory reactions. One of the EAE models is induced with a peptide derived from the myelin oligodendrocyte protein (MOG)35-55 in mice. The EAE mice develop a progressive disease course. This course is divided into three phases: the preclinical phase (day 0 - 9), the disease onset (day 10 - 11) and the acute phase (day 12 - 14). MS and EAE are induced by autoreactive T cells that infiltrate the CNS. These T cells secrete chemokines and cytokines which lead to the recruitment of further immune cells. Therefore, the immune cell distribution in the spinal cord during the three disease phases was investigated. To highlight the time point of the disease at which the activation/proliferation/accumulation of T cells, B cells and monocytes starts, the immune cell distribution in lymph nodes, spleen and blood was also assessed. Furthermore, the levels of several cytokines (IL-1&#946;, IL-6, IL-23, TNF&#945;, IFN&#947;) in the three disease phases were determined, to gain insight into the inflammatory processes of the disease. In conclusion, the data provide an overview of the functional profile of immune cells during EAE pathology.

This manuscript describes the methods for induction and scoring of the experimental autoimmune encephalomyelitis (EAE) model, together with the assessment of immune cell distribution and mRNA cytokine levels in lymph nodes, spleen, blood and spinal cord using flow cytometry and quantitative PCR, respectively, at various disease phases.

다양한 조직에서 면역 세포의 질병에 의존하는 유통의 마우스 및 평가에 실험자가 면역 뇌척수염의 유도

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) ...

Induction of Paralysis and Visual System Injury in Mice by T Cells Specific for Neuromyelitis Optica Autoantigen Aquaporin-4

While it is recognized that aquaporin-4 (AQP4)-specific T cells and antibodies participate in the pathogenesis of neuromyelitis optica (NMO), a human central nervous system (CNS) autoimmune demyelinating disease, creation of an AQP4-targeted model with both clinical and histologic manifestations of CNS autoimmunity has proven challenging. Immunization of wild-type (WT) mice with AQP4 peptides elicited T cell proliferation, although those T cells could not transfer disease to na&#239;ve recipient mice. Recently, two novel AQP4 T cell epitopes, peptide (p) 135-153 and p201-220, were identified when studying immune responses to AQP4 in AQP4-deficient (AQP4-/-) mice, suggesting T cell reactivity to these epitopes is normally controlled by thymic negative selection. AQP4-/- Th17 polarized T cells primed to either p135-153 or p201-220 induced paralysis in recipient WT mice, that was associated with predominantly leptomeningeal inflammation of the spinal cord and optic nerves. Inflammation surrounding optic nerves and involvement of the inner retinal layers (IRL) were manifested by changes in serial optical coherence tomography (OCT). Here, we illustrate the approaches used to create this new in vivo model of AQP4-targeted CNS autoimmunity (ATCA), which can now be employed to study mechanisms that permit development of pathogenic AQP4-specific T cells and how they may cooperate with B cells in NMO pathogenesis.

Here, we present a protocol to induce paralysis and opticospinal inflammation by transfer of aquaporin-4 (AQP4)-specific T cells from AQP4-/- mice into WT mice. In addition, we demonstrate how to use serial optical coherence tomography to monitor visual system dysfunction.

마비 및 비주얼 시스템 부상 Neuromyelitis Optica Autoantigen Aquaporin-4에 대 한 T 세포 관련 하 여 쥐에서의 유도

While it is recognized that aquaporin-4 (AQP4)-specific T cells and antibodies participate in the pathogenesis of neuromyelitis optica (NMO), a human ...

Induction of Intestinal Graft-versus-host Disease and Its Mini-endoscopic Assessment in Live Mice

Acute graft-versus-host disease (GvHD) represents the most severe complication that patients previously undergoing allogeneic hematopoietic stem cell transplantation (allo-HCT) face and is frequently associated with a poor clinical outcome. While, for instance, GvHD manifestations of the skin are usually responsive to established immune-suppressive therapies and are, hence, not taking a fatal course, the presence and the intensity of intestinal GvHD, especially of the mid-to-lower parts of the gut, strongly influence the outcome and overall survival of patients with acute GvHD. Therapeutic options are essentially limited to the classic immune-suppressive agents yielding only moderate disease-mitigating effects. Hence, detailed knowledge about the tissue-resident immune cascade, changes in the intestinal microbiota, and the stromal response prior, upon, and after intestinal GvHD onset are urgently needed to understand the events and mechanisms underlying its pathogenesis and to develop innovative therapeutic options. Murine models of GvHD are frequently employed to identify and functionally assess molecules and pathways putatively driving intestinal GvHD. However, means to specifically monitor and evaluate intestinal inflammation over time are essentially lacking since established scores to assess and grade acute GvHD are routinely comprised of various parameters which rather reflect&#160;systemic GvHD manifestations. The detailed evaluation of intestinal GvHD has been restricted to studies using euthanized mice, thereby essentially excluding longitudinal (i.e., kinetic) analyses of the colonic compartment under a given experimental condition (e.g., antibody-mediated blockade of a proinflammatory cytokine) in live mice (i.e., in vivo). The mini-endoscopic in situ assessment of the distal colon of allo-HCT-treated mice described here allows a) a detailed macroscopic evaluation of different aspects of intestinal inflammation and b) the option to collect tissue samples for downstream analyses at various time points over the course of the observation period. Overall, the mini-endoscopic approach provides a major advance in preclinical noninvasive monitoring and assessment of intestinal GvHD.

Here, we present a protocol that describes allogeneic hematopoietic stem cell transplantation and allows repetitive mini-endoscopic evaluations of the distal colon in situ for the presence, characteristics, and severity of colonic inflammation within live mice suffering from intestinal graft-versus-host disease.

장 이식-비교-호스트 질병 및 라이브 쥐에서 미니 내 시경 평가의 유도

Acute graft-versus-host disease (GvHD) represents the most severe complication that patients previously undergoing allogeneic hematopoietic stem cell ...

Quantification of Proliferating Human Antigen-specific CD4+ T Cells using Carboxyfluorescein Succinimidyl Ester

Described is a simple, in vitro, dye dilution-based method for measuring antigen-specific CD4+ T cell proliferation in human peripheral blood mononuclear cells (PBMCs). The development of stable, non-toxic, fluorescent dyes such as carboxyfluorescein succinimidyl ester (CFSE) allows for rare, antigen-specific T cells to be distinguished from bystanders by diminution in fluorescent staining, as detected by flow cytometry. This method has the following advantages over alternative approaches: (i) it is very sensitive to low-frequency T cells, (ii) no knowledge of the antigen or epitope is required, (iii) the phenotype of the responding cells can be analyzed, and (iv) viable, responding cells can be sorted and used for further analysis, such as T cell cloning.

Quantification of Proliferating Human Antigen-specific CD4+ T Cells using Carboxyfluorescein Succinimidyl Ester

Presented here is a protocol for measuring proliferating CD4+ T cells in response to antigenic proteins or peptides using dye dilution. This assay is particularly sensitive to rare antigen-specific T cells and can be modified to facilitate cloning of antigen-specific cells.

카르복시플루아세인 수치니미딜 에스테르를 이용한 증식 인간 항원 특이적 CD4+ T 세포의 정량화

Described is a simple, in vitro, dye dilution-based method for measuring antigen-specific CD4+ T cell proliferation in human peripheral blood mononuclear ...

Bone Marrow Transplantation Platform to Investigate the Role of Dendritic Cells in Graft-versus-Host Disease

Allogeneic bone marrow transplantation (BMT) is an effective therapy for hematological malignancies due to the graft-versus-leukemia (GVL) effect to eradicate tumors. However, its application is limited by the development of graft-versus-host disease (GVHD), a major complication of BMT. GVHD is evoked when T-cells in the donor grafts recognizealloantigen expressed by recipient cells and mount unwanted immunological attacks against recipient healthy tissues. Thus, traditional therapies are designed to suppress donor T-cell alloreactivity. However, these approaches substantially impair the GVL effect so that the recipient&#39;s survival is not improved. Understanding the effects of therapeutic approaches on BMT, GVL, and GVHD, is thus essential. Due to the antigen-presenting and cytokine-secreting capacities to stimulate donor T-cells, recipient dendritic cells (DCs) play a significant role in the induction of GVHD. Therefore, targeting recipient DCs becomes a potential approach for controlling GVHD. This work provides a description of a novel BMT platform to investigate how host DCs regulate GVH and GVL responses after transplantation. Also presented is an effective BMT model to study the biology of GVHD and GVL after transplantation.

Graft-versus-host disease is a major complication after allogeneic bone marrow transplantation. Dendritic cells play a critical role in the pathogenesis of graft-versus-host disease. The current article describes a novel bone marrow transplantation platform to investigate the role of dendritic cells in the development of graft-versus-host disease and the graft-versus-leukemia effect.

이식대 숙주 질환에서 수지상 세포의 역할을 조사하는 골수 이식 플랫폼

Allogeneic bone marrow transplantation (BMT) is an effective therapy for hematological malignancies due to the graft-versus-leukemia (GVL) effect to ...

In Vivo Augmentation of Gut-Homing Regulatory T Cell Induction

Inflammatory bowel disease (IBD) is an inflammatory chronic disease in the gastrointestinal tract (GUT). In the United States, there are approximately 1.4 million IBD patients. It is generally accepted that a dysregulated immune response to gut bacteria initiates the disease and disrupts the mucosal epithelial barrier. We recently show that gut-homing regulatory T (Treg) cells are a promising therapy for IBD. Accordingly, this article presents a protocol for in vivo augmentation of gut-homing Treg cell induction. In this protocol, dendritic cells are engineered to produce locally high concentrations of two molecules de novo, active vitamin D (1,25-dihydroxyvitamin D or 1,25[OH]2D) and active vitamin A (retinoic acid or RA). We chose 1,25(OH)2D and RA based on previous findings showing that 1,25(OH)2D can induce the expression of regulatory molecules (e.g., forkhead box P3 and interleukin-10) and that RA can stimulate the expression of gut-homing receptors in T cells. To generate such engineered dendritic cells, we use a lentiviral vector to transduce dendritic cells to overexpress two genes. One gene is the cytochrome P450 family 27 subfamily B member 1 that encodes 25-hydroxyvitamin D 1&#945;-hydroxylase, which physiologically catalyzes the synthesis of 1,25(OH)2D. The other gene is the aldehyde dehydrogenase 1 family member A2 that encodes retinaldehyde dehydrogenase 2, which physiologically catalyzes the synthesis of RA. This protocol can be used for future investigation of gut-homing Treg cells in vivo.

Here we present a protocol for in vivo augmentation of gut-homing regulatory T cell induction. In this protocol, dendritic cells are engineered to locally produce high concentrations of the active vitamin D (1,25-dihydroxyvitamin D or 1,25[OH]2D) and the active vitamin A (retinoic acid or RA) de novo.

내장 호밍 규제 T 세포 유도의 생체 내 확대

Inflammatory bowel disease (IBD) is an inflammatory chronic disease in the gastrointestinal tract (GUT). In the United States, there are approximately 1.4 ...