Name: in vivo biosensor tracks non-apoptotic caspase activity in drosophila
Uploaded: 2016-11-27T13:00:00.000+00:00
Duration: 13 min 21 s
Description: Watch this Scientific Journal Video about In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila at JoVE.com

We thank Polan Santos and Darren Obbard for Drosophila illustrations in Fig. 2a, Marcelo Jacobs-Lorena for use of the JHMRI insectary. This work was supported by the Life Science Research Foundation fellowship (H.L.T.), University Grants Committee of the Hong Kong AoE/B-07/99 (M.C.F.), and NIH grants NS096677,&#160;NS037402 and NS083373 (J.M.H.). Ho Lam Tang is a Shurl and Kay Curci Foundation Fellow of the Life Sciences Research Foundation.

1. Preparation of CaspaseTracker Flies
<ol>
	<li>To prepare CaspaseTracker (DQVD) flies for experiments, perform this cross: UBI-CaspaseTracker x G-TRACE (UAS-RFP; UAS-FLP; Ubi&#62;Stop&#62;GFP-nls), by transferring 7-10 virgin female (or male) flies carrying the caspase biosensor substrate mCD8-DIAP1-Gal4 driven by the ubiquitin promoter35 together with the same number of male (or female) G-TRACE flies, which have the second chromosome CyO balancer to avoid lethality of the homozygous combination of G-TRACE (UAS-RFP, UAS-FLP, and Ubi&#62;Stop&#62;GFP-nls)34. Place flies in a fresh food vial with fresh yeast paste as a protein source.</li>
	<li>Incubate files at 18 &#176;C for 5 to 7 days (maximum 2 weeks) and then remove the parent flies from the vial to avoid overcrowding with new progeny, and to set up new breeding vials.</li>
	<li>Continue incubation at 18 &#176;C until progeny flies eclose. Select the non-CyO [non-curly wing] progeny of the correct genotype of CaspaseTracker, which are transgenic for CaspaseTracker and G-TRACE elements35.</li>
	<li>Simultaneously, generate control parental non-transgenic w118 flies and caspase-insensitive (DQVA) flies in parallel to verify specific CaspaseTracker RFP and GFP fluorescence.</li>
	<li>Perform PCR genotyping to confirm files with CaspaseTracker using the primers: 5&#39;-TCCCCCGGGCTGCAGGAATTC, 3&#39;-TGGAATTGGGGTACGTCTAGA, producing a 3,897 bp product. For genotyping the G-Trace loci, use the following primers for GFP (474 bp), 5&#39;-CAC GAC TTC TTC AAG TCC GCC ATG CCC G, 3&#39;-CTT GTA CAG CTC GTC CAT GCC GAG AGT GAT C; for RFP (258 bp), 5&#39;-GGC TGC TTC ATC TAC AAG GTG AAG TTC ATC GG, 3&#39;-GAT GTC CAG CTT GGA GTC CAC GTA GTA GTA GC; and for Flpase (655 bp), 5&#39;- CCACCTAAGGTGCTTGTTCGTCAGTTTGTGG, 3&#39;-GCC TAC TAA CGC TTG TCT TTG TCT CTG TCA C. For genotyping Gal4 in the pUWR vector (554 bp), 5&#39;-GAA GCA CAC CTT CGC ATC GCT CAG TCA CGC, 3&#39;-TGG AAT TGG GGT ACG TCT AGA.</li>
</ol>
2. Tissue Preparation, Staining and Mounting
<ol>
	<li>For fly dissections, prevent dissected tissues from sticking to plastic pipette tips and centrifuge tubes, coat tips and tubes with 1% bovine serum albumin (BSA) dissolved in water.</li>
	<li>Dissect flies on a silicone cushion using forceps.
	<ol>
		<li>To avoid damaging the tips of forceps on a hard surface when performing the tissue dissection, perform dissection on a silicon surface. For making silicone dissection plates, melt the silicon in the commercial kit according to manufacturer instructions (Materials List). After melting the silicone, add 3 to 4 mL to a 60 mm diameter tissue culture dish. Silicon dishes can be reused.</li>
		<li>Anesthetize a fly with CO2, and transfer it to a silicone plate with 1 mL of cold PBS. Introduce the CO2 to a vial containing the fly using a blowgun, and then transfer the anesthetized fly to a Pad that has a CO2 supply.</li>
		<li>Use a pair of forceps to hold the fly head, and a second pair of forceps to pull the thorax in the opposite direction to disconnect the fly head from the body covering without damaging the connection between the head and foregut.</li>
		<li>Use 2 pairs of forceps to remove the wings and legs from the thorax.</li>
		<li>Use a pair of forceps to hold the thorax, and another pair of forceps to pull the abdomen to separate it from the thorax again without damaging the connection between the foregut and midgut.</li>
		<li>Dissect internal organs including brain, gut, malpighian tubules and ovaries as previously demonstrated.39-41</li>
		<li>Remove all pieces of the cuticle and the fat bodies with forceps as these tissues produce strong autofluorescence. Patience and practice are required to prepare a complete organ system as shown.</li>
	</ol>
	</li>
	<li>Transfer dissected tissues to 1.5 mL centrifuge tubes, and fix tissues with 0.5 mL of 4% paraformaldehyde in PBS (phosphate-buffered saline) at RT for 20 to 30 min with rotation in the dark to avoid bleaching RFP and GFP in the tissues. Avoid prolonged fixation that can compromise subsequent staining results.</li>
	<li>Remove the paraformaldehyde by gentle pipetting and wash 3 times with 0.5 mL PBST (PBS + 0.1% Triton X-100) at RT.</li>
	<li>Permeabilize the tissues with 0.5 mL PBST at 4 &#176;C overnight with gentle shaking. Shorter incubations may cause incomplete permeabilization and compromise staining results.
	<ol>
		<li>If it is necessary to reduce background staining, consider incubating tissues in 0.5 mL PBST with 1% BSA, instead of PBS.</li>
	</ol>
	</li>
	<li>Wash the tissues 3 times with 0.5 mL PBST.</li>
	<li>To stain nuclei and filamentous actin (F-actin), apply 0.5 mL PBST with 10 &#181;g/mL of Hoechst 33342 blue nuclear dye and 0.3&#8197;&#181;M Alexa Fluor 633 Phalloidin F-actin stain and incubate simultaneously with tissues for 1 h at RT with gentle rotation in the dark. Avoid prolonged staining as this will increase the background.
	<ol>
		<li>For immunostaining, incubate fixed and permeabilized tissues with 0.1% Triton X-100 in 0.5 mL PBS overnight at 4 &#176;C, stain with 1:100 dilution of anti-ELAV antibody or with 1:200 dilution of anti-caspase-3 overnight at 4 &#176;C (300 &#181;L). Follow by the corresponding secondary antibody diluted 1:100 and incubate for 1 to 3 h at RT. See Materials List for specific antibody information.</li>
	</ol>
	</li>
	<li>Wash the tissues 3 times, each for 5 min in 0.5 mL PBST with gentle rotation.</li>
	<li>With a pipet, remove all PBST, and then add 200 &#181;L anti-bleach mounting agent (see materials) to completely cover tissues for 1-3 h at RT, or 4 &#176;C overnight. Optimal tissues that have fully absorbed the mounting agent will sink to the bottom of the tube.</li>
	<li>Pre-clean the glass slide with water or 70% ethanol and transfer the tissues with mounting agent to the glass slide.</li>
	<li>Carefully place a glass cover slip over the tissues. Apply petroleum jelly to the glass slide and the cover slip to avoid destroying the tissue by overcompression. Remove extra mounting agent with tissue paper.</li>
	<li>Seal the cover slip by applying nail polish all along the edges of the cover slip to avoid leakage of mounting agents from the tissues.</li>
</ol>
3. Confocal Microscopy
<ol>
	<li>Use an inverted confocal epi-fluorescence microscope. However, up-right microscopes can be also used. To image tissues using tiling, maintain stable room temperature to avoid drift of focus and shift of x-y plane due to the thermal expansion and contraction of the components. Environmental control systems and focus drift compensation systems help to avoid this problem due to loss of thermo-equilibrium of the microscope system.</li>
	<li>Place the slide on the stage of the microscope. Take a few test images using low resolution (125 x 125 pixels) and determine the appropriate number of tiles needed to cover the entire region of interest (ROI).</li>
	<li>Set the microscope scanning system to capture images with scanning resolution such as 500 x 500 pixels. Select the objective such as a 20X NA 0.8 or a 63X NA 1.4 Plan-Apochromat objective for analyzing tissues through glass coverslips, so that each of the images (tiles) overlaps by 20% on all sides.</li>
	<li>Set up the image sequence from longest to shortest excitation wavelengths, as the long wavelength light causes lower photo-bleaching. The sequence from longest to shortest excitation wavelength is: (i) 633 nm for Phalloidin F-actin and for antibody to activated caspases, (ii) 561 nm for RFP, (iii) 488 nm for GFP, and (iv) 405 nm for Hoechst nuclear stain.</li>
	<li>During imaging, minimize exposure of cells to fluorescent laser excitation during imaging process to avoid photo-bleaching by reducing the laser intensity to obtain high quality images of tissues.</li>
	<li>After images are collected, merge the images using microscope software.</li>
</ol>

The authors have nothing to disclose.

Here we illustrate the construction and inner workings of CaspaseTracker that facilitate detection of widespread basal caspase activity in healthy tissues. The critical steps for detecting non-apoptotic caspase activity in vivo are: 1) generating flies with the biosensor transgene, 2) verifying caspase-specific reporter function with appropriate controls, 3) practicing dissection techniques to observe all internal organ systems of adult Drosophila, and 4) distinguishing biosensor activity from autofluor...

Caspases are cysteine proteases that mediate apoptotic cell death by cleaving many intracellular proteins after key aspartate residues. For example, initiator caspases activate effector caspases, derepress DNA nucleases, cleave cytoskeletal components and alter the lipid composition of cell membranes to rapidly dismantle cells and stimulate their recognition and engulfment by neighboring cells that dispose of the cell corpses.1-4 It is estimated that billions of cells die per day in the human body, and apoptosis is an important mechanism of chemotherapy-induced tumor cell death.5 A different set of caspases can cause cell death by distinct non-apoptotic processes to stimulate innate immunity.6 Therefore, most research on caspases has focused on their pro-death functions.
Interestingly, early evidence in the field revealed that the same caspases responsible for promoting cell death also have non-death functions. Pioneering studies have demonstrated that caspases are involved in diverse cellular functions in healthy cells, including the regulation of cell proliferation and migration during embryogenesis.7-9 Caspases are required for spermatid individualization in Drosophila10,11, for blocking an alternative necroptotic cell death pathway in mice12,13, and for microRNA processing in C. elegans.14,15 In perhaps the longest-lived cells, neurons, caspases and other apoptotic machinery are implicated in the regulation of neuronal activity by pruning synaptic endings, a process believed to be essential to strengthen other synapses for learning and memory.16-18 It is possible that caspases facilitate synaptic pruning by a type of mini-apoptosis of tiny neuronal projections without whole cell death.19 However, caspases may have alternative functions unrelated to apoptosis-like events.20,21 Dual roles in life and death are not unique to caspases; BCL-2 family proteins and cytochrome c have roles in cellular energetics in healthy cells but are also part of the core apoptotic pathway that is activated by many types of cell stress.22-25 Although not proven, it seems logical that evolution has linked day-jobs to death-jobs within the same molecules to ensure timely elimination of unfit or undesirable cells.
At present, the molecular mechanisms of non-apoptotic caspase activity are not understood, and the extent of non-apoptotic caspase activity during embryonic development and in adult tissues is also not known. A major challenge is the difficulty in distinguishing day-jobs from death-jobs of caspases. In contrast to apoptosis and pyroptosis, when caspase activity is amplified by a proteolytic cascade, the day-jobs of caspases are expected to occur at much lower levels of enzymatic activity, likely below detection by many available technologies.
Prior to the work presented here, others developed a variety of caspase biosensors for different purposes. The SCAT biosensors (e.g., ECFP-DEVD-Venus) rapidly detect real-time caspase activity in cultured cells and animal tissues using FRET.26,27 Upon caspase cleavage, the nuclear-targeted GFP moiety of Apoliner (mCD8-RFP-DQVD-nucGFP) undergoes subcellular relocalization within minutes when its plasma membrane-tether is cleaved by caspases.28 Similarly, ApoAlert-pCaspase3-Sensor (NES-DEVD-YFP-NLS) relocalizes from the cytosol to the nucleus upon caspase cleavage.29,30 More recently, the chromophore in iCasper was cleverly engineered to fluoresce when cleaved by caspases, permitting detection of biosensor activity in real time in neurons of Drosophila embryos, but primarily in association with developmental cell death.31 Caspase-dependent death of olfactory neurons during aging was demonstrated by immuno-detection of the caspase-cleaved form of CPV biosensors (e.g., mCD8-PARP-Venus).32,33 Importantly, the activated form of caspase-3 was detected in the absence of cell death by sensitive immunostain in spines of cultured neurons, and in the soma using the caspase-dependent fluorescence of the nuclear CellEvent reporter dye, but difficulties were encountered due to photo-toxicity, although cell death was delayed until after spine elimination.19 Thus, new caspase biosensors are needed to detect and track cells with basal caspase activity in vivo.
To overcome these difficulties, we generated a novel dual color caspase biosensor, designated CaspaseTracker. This strategy combines a modified version of the Drosophila caspase-sensitive Apoliner biosensor28 with the Drosophila G-TRACE FRT recombinase system34 to permanently label and track cells in vivo.35 The Gal4-activated G-TRACE system allows very low levels of caspases to activate CaspaseTracker, resulting in RFP expression in the cytoplasm and permanent nuclear-targeted GFP expression in any cell that has ever experienced caspase activity.35 This system can label cells throughout life in whole animals using Drosophila melanogaster, a tractable and widely used model system for the study of caspases and cell death.36-38

<table><tbody><tr><td colspan="4">&lt;strong&gt;Consumables and Reagents&lt;/strong&gt;</td></tr><tr><td>Vectashield</td><td>Vector Products</td><td>H-1000</td><td>Mounting medium</td></tr><tr><td>Forceps</td><td>Ted Pella</td><td>#505 (110mm, #5)</td><td>Dumont tweezer biology grade, stainless steel</td></tr><tr><td>Hanging Drop Slides</td><td>Fisher Scientific</td><td>12-565B</td><td>Glass slides</td></tr><tr><td>Hoechst 33342</td><td>Molecular Probes</td><td>H1399</td><td>DNA stain</td></tr><tr><td>Alexa Fluor 633 Phalloidin</td><td>Molecular Probes</td><td>A22284</td><td>Actin stain</td></tr><tr><td>Rat-Elav-7E8A10 anti-elav antibody</td><td>Developmental Studies Hybridoma Bank (DSHB)</td><td>Antibody Registry ID:&amp;nbsp; AB_528218&amp;nbsp;</td><td>Stain for Drosophla pan-neuronal ELAV</td></tr><tr><td>Cleaved caspase-3 (Asp175) antibody</td><td>Cell Signaling Technology</td><td>#9661</td><td>Stain for active fragment of caspase-3</td></tr><tr><td>ProLong Gold antifade reagent</td><td>Life Technologies</td><td>P36934</td><td>to preserve fluorophores&amp;nbsp;</td></tr><tr><td>ProLong Diamond Antifade Mountant</td><td>Life Technologies</td><td>P36961</td><td>to preserve fluorophores&amp;nbsp;</td></tr><tr><td>SylGard 182 Silicone Elastomer Kit</td><td>Dow Corning&amp;nbsp;</td><td>Product code: 0001023934</td><td>for dissection plates</td></tr><tr><td colspan="4">&lt;strong&gt;Equipment&lt;/strong&gt;</td></tr><tr><td>LSM780 confocal microscope</td><td>Carl Zeiss</td><td>N/A</td><td>Imaging</td></tr><tr><td>Carl Zeiss Stereomicroscope Stemi 2000</td><td>Carl Zeiss</td><td>N/A</td><td>&lt;em&gt;Drosophila&lt;/em&gt; dissection</td></tr><tr><td>AmScope Fiber Optic Dual Gooseneck Microscope Illuminator, 150&amp;nbsp;W</td><td>AmScope</td><td>WBM99316</td><td>Light source</td></tr></tbody></table>

in vivo biosensor tracks non-apoptotic caspase activity in drosophila

Caspases are the key mediators of apoptotic cell death via their proteolytic activity. When caspases are activated in cells to levels detectable by available technologies, apoptosis is generally assumed to occur shortly thereafter. Caspases can cleave many functional and structural components to cause rapid and complete cell destruction within a few minutes. However, accumulating evidence indicates that in normal healthy cells the same caspases have other functions, presumably at lower enzymatic levels. Studies of non-apoptotic caspase activity have been hampered by difficulties with detecting low levels of caspase activity and with tracking ultimate cell fate in vivo. Here, we illustrate the use of an ultrasensitive caspase reporter, CaspaseTracker, which permanently labels cells that have experienced caspase activity in whole animals. This in vivo dual color CaspaseTracker biosensor for Drosophila melanogaster transiently expresses red fluorescent protein (RFP) to indicate recent or on-going caspase activity, and permanently expresses green fluorescent protein (GFP) in cells that have experienced caspase activity at any time in the past yet did not die. Importantly, this caspase-dependent in vivo biosensor readily reveals the presence of non-apoptotic caspase activity in the tissues of organ systems throughout the adult fly. This is demonstrated using whole mount dissections of individual flies to detect biosensor activity in healthy cells throughout the brain, gut, malpighian tubules, cardia, ovary ducts and other tissues. CaspaseTracker detects non-apoptotic caspase activity in long-lived cells, as biosensor activity is detected in adult neurons and in other tissues at least 10 days after caspase activation. This biosensor serves as an important tool to uncover the roles and molecular mechanisms of non-apoptotic caspase activity in live animals.

There are two key components that allow CaspaseTracker to detect caspase activity in normal healthy cells (Figure 1a). The first of these is a 146 amino acid caspase-cleavable polypeptide modeled after the caspase biosensor Apoliner (Figure 1b).28 This polypeptide is derived from DIAP1 (Drosophila inhibitor of apoptosis) containing a single naturally occurring caspase site that is cleaved during apoptosis typically by the caspase DrICE...

Watch this Scientific Journal Video about In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila at JoVE.com

In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

To detect healthy cells in whole animals that contain low levels of caspase activity, the highly sensitive biosensor designated CaspaseTracker was generated for Drosophila. Caspase-dependent biosensor activity is detected in long-lived healthy cells throughout the internal organs of adult animals reared under optimized conditions in the absence of death stimuli.

In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

Caspases are the key mediators of apoptotic cell death via their proteolytic activity. When caspases are activated in cells to levels detectable by ...

in-vivo-biosensor-tracks-non-apoptotic-caspase-activity-in-drosophila

Research

JoVE Journal

Biology

9.0K Views.  Johns Hopkins University Bloomberg School of Public Health.  Gezonde cellen in gehele dieren die lage niveaus van caspase activiteit bevatten detecteren, de aangewezen CaspaseTracker gevoelige biosensor werd gegenereerd voor Drosophila. Caspase-afhankelijke biosensor activiteit gedetecteerd in langlevende gezonde cellen in de inwendige organen van volwassen dieren onder geoptimaliseerde omstandigheden gekweekt bij afwezigheid van dood stimuli. 

Video: In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

Lighting Up the Pathways to Caspase Activation Using Bimolecular Fluorescence Complementation

The caspase family of proteases play essential roles in apoptosis and innate immunity. Among these, a subgroup known as initiator caspases are the first to be activated in these pathways. This group includes caspase-2, -8, and -9, as well as the inflammatory caspases, caspase-1, -4, and -5. The initiator caspases are all activated by dimerization following recruitment to specific multiprotein complexes called activation platforms. Caspase Bimolecular Fluorescence Complementation (BiFC) is an imaging-based approach where split fluorescent proteins fused to initiator caspases are used to visualize the recruitment of initiator caspases to their activation platforms and the resulting induced proximity. This fluorescence provides a readout of one of the earliest steps required for initiator caspase activation. Using a number of different microscopy-based approaches, this technique can provide quantitative data on the efficiency of caspase activation on a population level as well as the kinetics of caspase activation and the size and number of caspase activating complexes on a per cell basis.

This protocol describes caspase Bimolecular Fluorescence Complementation (BiFC); an imaging-based method that can be used to visualize induced proximity of initiator caspases, which is the first step in their activation.

The caspase family of proteases play essential roles in apoptosis and innate immunity. Among these, a subgroup known as initiator caspases are the first ...

Biochemistry

Measuring Caspase Activity Using a Fluorometric Assay or Flow Cytometry

The activation of cysteine proteases, known as caspases, remains an important process in multiple forms of cell death. Caspases are critical initiators and executioners of apoptosis, the most studied form of programmed cell death. Apoptosis occurs during developmental processes and is a necessary event in tissue homeostasis. Pyroptosis is another form of cell death that utilizes caspases and is a critical process in activating the immune system through the activation of the inflammasome, which results in the release of members of the interleukin-1 (IL-1) family. To assess caspase activity, target substrates can be assessed. However, sensitivity can be an issue when examining single cells or low-level activity. We demonstrate how a fluorogenic substrate can be used with a population-based assay or single-cell assay by flow cytometry. With proper controls, different amino acid sequences can be used to identify which caspases are active. Using these assays, the simultaneous loss of the inhibitors of apoptosis proteins upon tumor necrosis factor (TNF) stimulation has been identified, which primarily induces apoptosis in macrophages rather than other forms of cell death.

The present protocol describes two methods to measure caspase activity through a fluorogenic substrate using flow cytometry or a spectrofluorometer.

The activation of cysteine proteases, known as caspases, remains an important process in multiple forms of cell death. Caspases are critical initiators ...

Phagocytosis Assay for Apoptotic Cells in Drosophila Embryos

The molecular mechanisms underlying the phagocytosis of apoptotic cells need to be elucidated in more detail because of its role in immune and inflammatory intractable diseases. We herein developed an experimental method to investigate phagocytosis quantitatively using the fruit fly Drosophila, in which the gene network controlling engulfment reactions is evolutionally conserved from mammals. In order to accurately detect and count engulfing and un-engulfing phagocytes using whole animals, Drosophila embryos were homogenized to obtain dispersed cells including phagocytes and apoptotic cells. The use of dispersed embryonic cells enables us to measure in vivo phagocytosis levels as if we performed an in vitro phagocytosis assay in which it is possible to observe all phagocytes and apoptotic cells in whole embryos and precisely quantify the level of phagocytosis. We confirmed that this method reproduces those of previous studies that identified the genes required for the phagocytosis of apoptotic cells. This method allows the engulfment of dead cells to be analyzed, and when combined with the powerful genetics of Drosophila, will reveal the complex phagocytic reactions comprised of the migration, recognition, engulfment, and degradation of apoptotic cells by phagocytes.

Phagocytosis Assay for Apoptotic Cells in Drosophila Embryos

We herein describe a phagocytosis assay using the dispersed embryonic cells of Drosophila. It enables us to easily and precisely quantify in vivo phagocytosis levels, and to identify new molecules required for the phagocytosis of apoptotic cells.

The molecular mechanisms underlying the phagocytosis of apoptotic cells need to be elucidated in more detail because of its role in immune and ...

Immunology and Infection

Detecting Anastasis In Vivo by CaspaseTracker Biosensor

Anastasis (Greek for &#8220;rising to life&#8221;) is a recently discovered cell recovery phenomenon whereby dying cells can reverse late-stage cell death processes that are generally assumed to be intrinsically irreversible. Promoting anastasis could in principle rescue or preserve injured cells that are difficult to replace such as cardiomyocytes or neurons, thereby facilitating tissue recovery. Conversely, suppressing anastasis in cancer cells, undergoing apoptosis after anti-cancer therapies, may ensure cancer cell death and reduce the chances of recurrence. However, these studies have been hampered by the lack of tools for tracking the fate of cells that undergo anastasis in live animals. The challenge is to identify the cells that have reversed the cell death process despite their morphologically normal appearance after recovery. To overcome this difficulty, we have developed Drosophila and mammalian CaspaseTracker biosensor systems that can identify and permanently track the anastatic cells in vitro or in vivo. Here, we present in vivo protocols for the generation and use of the CaspaseTracker dual biosensor system to detect and track anastasis in Drosophila melanogaster after transient exposure to cell death stimuli. While conventional biosensors and protocols can label cells actively undergoing apoptotic cell death, the CaspaseTracker biosensor can permanently label cells that have recovered after caspase activation - a hallmark of late-stage apoptosis, and simultaneously identify active apoptotic processes. This biosensor can also track the recovery of the cells that attempted other forms of cell death that directly or indirectly involved caspase activity. Therefore, this protocol enables us to continuously track the fate of these cells and their progeny, facilitating future studies of the biological functions, molecular mechanisms, physiological and pathological consequences, and therapeutic implications of anastasis. We also discuss the appropriate controls to distinguish cells that undergo anastasis from those that display non-apoptotic caspase activity in vivo.

Detecting Anastasis In Vivo by CaspaseTracker Biosensor

Anastasis is technically challenging to detect in vivo because the cells that have reversed the cell death process can be morphologically indistinguishable from normal healthy cells. Here we describe protocols for detecting and tracking cells that undergo anastasis in live animals by using our newly developed in vivo CaspaseTracker biosensor system.

Anastasis (Greek for &#8220;rising to life&#8221;) is a recently discovered cell recovery phenomenon whereby dying cells can reverse late-stage cell death ...

Medicine

Long-term In Vivo Tracking of Inflammatory Cell Dynamics Within Drosophila Pupae

During the rapid inflammatory response to tissue damage, cells of the innate immune system are quickly recruited to the injury site. Once at the wound, innate immune cells perform a number of essential functions, such as fighting infection, clearing necrotic debris, and stimulating matrix deposition. In order to fully understand the diverse signaling events that regulate this immune response, it is crucial to observe the complex behaviors of (and interactions that occur between) multiple cell lineages in vivo, and in real-time, with the high spatio-temporal resolution. The optical translucency and the genetic tractability of Drosophila embryos have established Drosophila as an invaluable model to live-image and dissect fundamental aspects of inflammatory cell behavior, including mechanisms of developmental dispersal, clearance of apoptotic corpses&#160;and/or microbial pathogens, and recruitment to wounds. However, more recent work has now demonstrated that employing a much later stage in the Drosophila lifecycle &#8211; the Drosophila pupa &#8211; offers a number of distinct advantages, including improved RNAi efficiency, longer imaging periods, and significantly greater immune cell numbers. Here we describe a protocol for imaging wound repair and the associated inflammatory response at the high spatio-temporal resolution in live Drosophila pupae. To follow the dynamics of both re-epithelialization and inflammation, we use a number of specific in vivo fluorescent markers for both the epithelium and innate immune cells. We also demonstrate the effectiveness of photo-convertible fluorophores, such as Kaede, for following the specific immune cell subsets, to track their behavior as they migrate to, and resolve from, the injury site.

Long-term In Vivo Tracking of Inflammatory Cell Dynamics Within Drosophila Pupae

Here we present a protocol for live-imaging wound repair and the associated inflammatory response at high spatio-temporal resolution in vivo. This method utilizes the pupal stage of Drosophila development to enable long-term imaging and tracking of specific cell populations over time and is compatible with efficient RNAi-mediated gene inactivation.

During the rapid inflammatory response to tissue damage, cells of the innate immune system are quickly recruited to the injury site. Once at the wound, ...

In Vivo Single-Molecule Tracking at the Drosophila Presynaptic Motor Nerve Terminal

An increasing number of super-resolution microscopy techniques are helping to uncover the mechanisms that govern the nanoscale cellular world. Single-molecule imaging is gaining momentum as it provides exceptional access to the visualization of individual molecules in living cells. Here, we describe a technique that we developed to perform single-particle tracking photo-activated localization microscopy (sptPALM) in Drosophila larvae. Synaptic communication relies on key presynaptic proteins that act by docking, priming, and promoting the fusion of neurotransmitter-containing vesicles with the plasma membrane. A range of protein-protein and protein-lipid interactions tightly regulates these processes and the presynaptic proteins therefore exhibit changes in mobility associated with each of these key events. Investigating how mobility of these proteins correlates with their physiological function in an intact live animal is essential to understanding their precise mechanism of action. Extracting protein mobility with high resolution in vivo requires overcoming limitations such as optical transparency, accessibility, and penetration depth. We describe how photoconvertible fluorescent proteins tagged to the presynaptic protein Syntaxin-1A can be visualized via slight oblique illumination and tracked at the motor nerve terminal or along the motor neuron axon of the third instar Drosophila larva.

In Vivo Single-Molecule Tracking at the Drosophila Presynaptic Motor Nerve Terminal

Here we illustrate how single molecule photo-activated localization microscopy can be carried out on the motor nerve terminal of a live Drosophila melanogaster third instar larva.

An increasing number of super-resolution microscopy techniques are helping to uncover the mechanisms that govern the nanoscale cellular world. ...

Neuroscience

Live Imaging of Apoptotic Cell Clearance during Drosophila Embryogenesis

The proper elimination of unwanted or aberrant cells through apoptosis and subsequent phagocytosis (apoptotic cell clearance) is crucial for normal development in all metazoan organisms. Apoptotic cell clearance is a highly dynamic process intimately associated with cell death; unengulfed apoptotic cells are barely seen in vivo under normal conditions. In order to understand the different steps of apoptotic cell clearance and to compare 'professional' phagocytes - macrophages and dendritic cells to 'non-professional' - tissue-resident neighboring cells, in vivo live imaging of the process is extremely valuable. Here we describe a protocol for studying apoptotic cell clearance in live Drosophila embryos. To follow the dynamics of different steps in phagocytosis we use specific markers for apoptotic cells and phagocytes. In addition, we can monitor two phagocyte systems in parallel: 'professional' macrophages and 'semi-professional' glia in the developing central nervous system (CNS). The method described here employs the Drosophila embryo as an excellent model for real time studies of apoptotic cell clearance.

Live Imaging of Apoptotic Cell Clearance during Drosophila Embryogenesis

Here we describe an effective method for studying dynamics of apoptotic cell clearance in vivo. This method employs live Drosophila embryos as a powerful model for monitoring phagocytosis of apoptotic cells using specific labeling of apoptotic cells and phagocytes.

The  proper elimination of unwanted or aberrant cells through apoptosis and  subsequent phagocytosis (apoptotic cell clearance) is crucial for normal  ...

In Vitro Cleavage Assays using Purified Recombinant Drosophila Caspases for Substrate Screening

Caspases are very specific cell death proteases that are involved in apoptotic and non-apoptotic processes. While the role of caspases during apoptosis has been very well defined and many apoptotic proteolytic substrates of caspases have been identified and characterized, the role of caspases for non-apoptotic processes is not well understood. In particular, few non-apoptotic substrates of caspases have been identified thus far. Here, in order to facilitate the identification and characterization of potential caspase substrates, a protocol that allows the testing of candidate substrates in caspase cleavage assays in vitro is described. This protocol includes the production and purification of recombinant caspase proteins, the production of the candidate substrates either recombinantly or in a cell-free expression system, and the actual in vitro cleavage reaction followed by SDS-PAGE and immunoblotting. This protocol is tailored for the Drosophila caspases Dronc and Drice but can easily be adapted for caspases from other organisms, including mammals.

In Vitro Cleavage Assays using Purified Recombinant Drosophila Caspases for Substrate Screening

Here we present a protocol to express and purify recombinant Drosophila caspases Dronc and Drice, and their use in in vitro cleavage assays.

Caspases are very specific cell death proteases that are involved in apoptotic and non-apoptotic processes. While the role of caspases during apoptosis ...

Bioengineering

Visualization of Inflammatory Caspases Induced Proximity in Human Monocyte-Derived Macrophages

Inflammatory caspases include caspase-1, -4, -5, -11, and -12 and belong to the subgroup of initiator caspases. Caspase-1 is required to ensure correct regulation of inflammatory signaling and is activated by proximity-induced dimerization following recruitment to inflammasomes. Caspase-1 is abundant in the monocytic cell lineage and induces maturation of the pro-inflammatory cytokines interleukin (IL)-1&#946; and IL-18 to active secreted molecules. The other inflammatory caspases, caspase-4 and -5 (and their murine homolog caspase-11) promote IL-1&#946; release by inducing pyroptosis. Caspase Bimolecular Fluorescence Complementation (BiFC) is a tool used to measure inflammatory caspase induced proximity as a readout of caspase activation. The caspase-1, -4, or -5 prodomain, which contains the region that binds to the inflammasome, is fused to non-fluorescent fragments of the yellow fluorescent protein Venus (Venus-N [VN] or Venus-C [VC]) that associate to reform the fluorescent Venus complex when the caspases undergo induced proximity. This protocol describes how to introduce these reporters into primary human monocyte-derived macrophages (MDM) using nucleofection, treat the cells to induce inflammatory caspase activation, and measure caspase activation using fluorescence and confocal microscopy. The advantage of this approach is that it can be used to identify the components, requirements, and localization of the inflammatory caspase activation complex in living cells. However, careful controls need to be considered to avoid compromising cell viability and behavior. This technique is a powerful tool for the analysis of dynamic caspase interactions at the inflammasome level as well as for the interrogation of the inflammatory signaling cascades in living MDM and monocytes derived from human blood samples.

This protocol describes the workflow to obtain monocytes-derived macrophages (MDM) from human blood samples, a simple method to efficiently introduce inflammatory caspase Bimolecular Fluorescence Complementation (BiFC) reporters into human MDM without compromising cell viability and behavior, and an imaging-based approach to measure inflammatory caspase activation in living cells.

Inflammatory caspases include caspase-1, -4, -5, -11, and -12 and belong to the subgroup of initiator caspases. Caspase-1 is required to ensure correct ...

Strategies for Tracking Anastasis, A Cell Survival Phenomenon that Reverses Apoptosis

Anastasis (Greek for &#8220;rising to life&#8221;) refers to the recovery of dying cells. Before these cells recover, they have passed through important checkpoints of apoptosis, including mitochondrial fragmentation, release of mitochondrial cytochrome c into the cytosol, activation of caspases, chromatin condensation, DNA damage, nuclear fragmentation, plasma membrane blebbing, cell shrinkage, cell surface exposure of phosphatidylserine, and formation of apoptotic bodies. Anastasis can occur when apoptotic stimuli are removed prior to death, thereby allowing dying cells to reverse apoptosis and potentially other death mechanisms. Therefore, anastasis appears to involve physiological healing processes that could also sustain damaged cells inappropriately. The functions and mechanisms of anastasis are still unclear, hampered in part by the limited tools for detecting past events after the recovery of apparently healthy cells. Strategies to detect anastasis will enable studies of the physiological mechanisms, the hazards of undead cells in disease pathology, and potential therapeutics to modulate anastasis. Here, we describe effective strategies using live cell microscopy and a mammalian caspase biosensor&#160;for identifying and tracking anastasis in mammalian cells.

The term anastasis refers to the phenomenon in which dying cells reverse a cell suicide process at a late stage, repair themselves, and ultimately survive. Here we demonstrate protocols for detecting and tracking cells that undergo anastasis.

Anastasis (Greek for &#8220;rising to life&#8221;) refers to the recovery of dying cells. Before these cells recover, they have passed through important ...

In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video