Wir danken Polan Santos und Darren Obbard für Drosophila Abbildungen in Fig. 2a, Marcelo Jacobs-Lorena für die Verwendung des JHMRI Insektarium. Diese Arbeit wurde von der Life Science Research Foundation Fellowship (HLT), University Grants Committee der Hong Kong AoE / B-07/99 (MCF) unterstützt wurde, und NIH gewährt NS096677, NS037402 und NS083373 (JMH). Ho Lam Tang ist ein Shurl und Kay Curci Foundation Fellow der Life Sciences Research Foundation.

1. Herstellung von CaspaseTracker Flies <ol><li> Zur Vorbereitung CaspaseTracker (DQVD) fliegt für Experimente, führen Sie diese Quer: UBI-CaspaseTracker x G-TRACE (UAS-RFP, UAS-FLP; Ubi&gt; Stop&gt; GFP-nls), durch die Übertragung von 7-10 jungfräulichen Weibchen (oder männlich) die Caspase Biosensor Substrat mCD8-DIAP1-Gal4 durch den Ubiquitin - Promotor 35 zusammen mit der gleichen Anzahl von männlichen (bzw. weiblichen) angetrieben G-TRACE Fliegen, die das zweite Chromosom cyo Ausgleicher haben zu vermeiden Letalität der homozygoten Kombination von G- Fliegen Trage TRACE (UAS-RFP, UAS-FLP und Ubi&gt; Stop&gt; GFP-nls) 34. Platz fliegt in einem frischen Lebensmittel Fläschchen mit frischer Hefe-Paste als Proteinquelle. </li><li> Inkubieren Dateien bei 18 ° C für 5 bis 7 Tage (maximal 2 Wochen) und entfernen Sie dann die Eltern aus dem Fläschchen fliegt mit neuen Nachkommen zu vermeiden, Überfüllung und neue Zucht Fläschchen einzurichten. </li><li> Weiter Inkubation bei 18 ° C bis Nachkommen eclose fliegt. Wählen Sie das nicht Cyo [non-curly Flügel] Nachkommen des korrekten Genotyp von CaspaseTracker, die 35 für CaspaseTracker und G-TRACE Elemente transgen sind. </li><li> Gleichzeitig erzeugen Kontrolle der Eltern nicht-transgenen W118 Fliegen und Caspase-unempfindlich (DQVA) fliegt parallel spezifischen CaspaseTracker RFP und GFP-Fluoreszenz zu überprüfen. </li><li> Führen Sie die PCR-Genotypisierung, um zu bestätigen Dateien mit CaspaseTracker unter Verwendung der Primer: 5&#39;-TCCCCCGGGCTGCAGGAATTC, 3&#39;-TGGAATTGGGGTACGTCTAGA, ein 3897-bp-Produkt zu erzeugen. Für die Genotypisierung die G-Trace-Loci, verwenden Sie die folgenden Primer, die für GFP (474 ​​bp), 5&#39;-CAC GAC TTC TTC AAG TCC GCC ATG CCC G, 3&#39;-CTT GTA CAG CTC GTC CAT GCC GAG AGT GAT C; für RFP (258 bp), 5&#39;-GGC TGC TTC ATC TAC AAG GTG AAG TTC ATC GG, 3&#39;-GAT GTC CAG CTT GGA GTC CAC GTA GTA GTA GC; und für Flpase (655 bp), 5 &#39;CCACCTAAGGTGCTTGTTCGTCAGTTTGTGG, 3&#39;-GCC TAC TAA CGC TTG TCT TTG TCT CTG TCA C. Für die Genotypisierung Gal4 im pUWR Vektor (554 bp), 5&#39;-GAA GCA CAC CTT CGC ATC GCT CAGTCA CGC, 3&#39;-TGG AAT TGG GGT ACG TCT AGA. </li></ol> 2. Gewebepräparation, Färbung und Montage <ol><li> Für Fliegen Dissektionen verhindern seziert Gewebe zu Kunststoff-Pipettenspitzen und Zentrifugenröhrchen kleben, beschichten Spitzen und Rohre mit 1% Rinderserumalbumin (BSA) in Wasser gelöst. </li><li> Dissect fliegt auf einem Silikonkissen mit einer Pinzette. <ol><li> Schäden an den Spitzen der Zange auf eine harte Oberfläche zu vermeiden, wenn das Gewebe Dissektion durchführen, führen Präparation auf einer Siliziumoberfläche. Für Silikon-Dissektion Platten machen, schmelzen das Silizium im Handel erhältlichen Kits gemäß den Anweisungen des Herstellers (Materialliste). Nach dem Silikon schmelzen, fügen Sie 3 bis 4 ml zu einem Durchmesser von 60 mm Gewebekulturschale. Silicon Geschirr kann wiederverwendet werden. </li><li> Anesthetize eine Fliege mit CO 2, und übertragen sie mit 1 ml kaltem PBS auf eine Silikonplatte. Führen Sie das CO 2 in ein Fläschchen , die Fliege mit einem Blasrohr enthält, und dann übertragen Sie die narkotisiert fly toa Pad , die eine CO 2 Versorgung. </li><li> Verwenden Sie eine Zange, die Fliege Kopf, und ein zweites Paar von Zange zu halten, den Brustkorb in die entgegengesetzte Richtung zu ziehen, die Fliege Kopf vom Körper zu trennen abdeckt, ohne dass die Verbindung zwischen dem Kopf und foregut zu beschädigen. </li><li> Verwenden Sie 2 Paar Zangen, die Flügel und Beine aus dem Thorax zu entfernen. </li><li> Verwenden Sie ein Paar Zangen des Thorax zu halten, und ein anderes Paar von Zange den Bauch ziehen Sie sie vom Thorax wieder zu trennen, ohne die Verbindung zwischen dem Vorderdarm und Mitteldarm zu beschädigen. </li><li> Präparieren inneren Organe einschließlich Gehirn, Darm, Malpighischen Gefäße und der Ovarien , wie zuvor unter Beweis gestellt. 39-41 </li><li> Entfernen Sie alle Stücke der Kutikula und die Fettkörper mit einer Pinzette, da diese Gewebe starke Autofluoreszenz produzieren. Geduld und Übung erforderlich, um eine vollständige Organsystem vorzubereiten, wie dargestellt. </li></ol></li><li> Übertragen Sie seziert Gewebe zu 1,5 ml Zentrifugenröhrchen und reparieren Gewebe with 0,5 ml 4% Paraformaldehyd in PBS (phosphatgepufferter Salzlösung) bei RT für 20 bis 30 min mit der Drehung in der Dunkelheit Bleich RFP und GFP in den Geweben zu vermeiden. Vermeiden Sie längere Fixierung, die nachfolgende Färbung Ergebnisse beeinträchtigen können. </li><li> Entfernen des Paraformaldehyds durch vorsichtiges Pipettieren und wäscht 3 mal mit 0,5 ml PBST (PBS + 0,1% Triton X-100) bei RT. </li><li> Permeabilisieren die Gewebe mit 0,5 ml PBST bei 4 ° C über Nacht unter leichtem Schütteln. Kürzere Inkubationszeiten unvollständige Permeabilisierung und des Kompromisses Färbung Ergebnisse verursachen. <ol><li> Wenn es notwendig ist, die Hintergrundfärbung zu reduzieren, sollten Gewebe in 0,5 ml PBST mit 1% BSA anstelle von PBS inkubiert. </li></ol></li><li> Waschen Sie die Gewebe 3-mal mit 0,5 ml PBST. </li><li> Beflecken Kerne und filamentöse Aktin (F-Aktin), gelten 0,5 ml PBST mit 10 ug / ml Hoechst 33342 blau Kern Farbstoff und 0,3 uM Alexa Fluor 633 Phalloidin F-Actin-Färbung und Inkubation gleichzeitig mit Geweben für 1 h bei RT with sanfte Rotation im Dunkeln. Vermeiden Sie längere Färbung, da dies den Hintergrund zu erhöhen. <ol><li> Für die Immunfärbung, inkubieren fixiert und permeabilisiert Gewebe mit 0,1% Triton X-100 in 0,5 ml PBS über Nacht bei 4 ° C, Fleck mit 1: 100-Verdünnung von anti-ELAV Antikörper oder mit 1: 200-Verdünnung von Anti-Caspase-3 Nacht bei 4 ° C (300 ul). Folgen durch den entsprechenden Sekundärantikörpers, verdünnt 1: 100 und Inkubation für 1 bis 3 h bei RT. Siehe Materialliste für spezifische Antikörper Informationen. </li></ol></li><li> Waschen Sie die Tücher 3 mal für jeweils 5 min in 0,5 ml PBST mit sanfter Drehung. </li><li> Mit einer Pipette, entfernen Sie alle PBST und dann 200 ul hinzufügen Antibleichbefestigungsmittel (siehe Materialien) vollständig Gewebe für 1-3 h bei RT abdecken oder 4 ° über Nacht C. Optimale Gewebe, die die Montagemittel vollständig aufgenommen haben, wird auf dem Boden des Röhrchens sinken. </li><li> Vorreinigung der Glasobjektträger mit Wasser oder 70% Ethanol und das Gewebe mit Befestigungsmittel auf die Glas übertragenRutsche. </li><li> Vorsichtig ein Deckglas über dem Gewebe. Vaseline auf dem Glasobjektträger und Deckglas zu vermeiden, um das Gewebe durch Überkompression zu zerstören. Entfernen Sie die zusätzlichen Befestigungsmittel mit Seidenpapier. </li><li> Verschließen Sie die Deckglas durch Anwendung Nagellack alle entlang der Ränder des Deckglases zu vermeiden Leckage von Mitteln aus den Geweben Montage. </li></ol> 3. konfokale Mikroskopie <ol><li> Verwenden eines invertierten konfokalen Epi-Fluoreszenzmikroskop. Jedoch oben rechts Mikroskope verwendet werden kann. Um das Bild zu Geweben tiling Verwendung aufrechtzuerhalten stabile Raumtemperaturdrift des Fokus und der Verschiebung der xy-Ebene zu vermeiden, aufgrund der thermischen Expansion und Kontraktion der Komponenten. Umweltkontrollsysteme und Fokusdrift-Kompensationssysteme helfen, dieses Problem durch den Verlust von thermo-Gleichgewicht des Mikroskopsystems zu vermeiden. </li><li> Platzieren Sie den Schieber auf der Bühne des Mikroskops. Nehmen Sie ein paar Testbilder mit geringer Auflösung (125 x 125 Pixel) eind die entsprechende Anzahl der Kacheln bestimmen erforderlich, um die gesamte Region von Interesse (ROI) zu decken. </li><li> Stellen Sie das Mikroskop Scansystem zum Erfassen von Bildern mit Scan-Auflösung wie 500 x 500 Pixel. Wählen Sie das Ziel wie ein 20X NA 0,8 oder einem 63X NA 1.4 Plan-Apochromat Ziel für Gewebe durch Glasplättchen zu analysieren, so dass jedes der Bilder (Fliesen) überlappt um 20% auf allen Seiten. </li><li> Stellen Sie die Bildsequenz von längste bis Anregungswellenlängen kürzesten, als die langwellige Licht niedriger Photobleaching verursacht. Die Sequenz von längste Anregungswellenlänge kürzeste: (i) 633 nm für Phalloidin F-Actin und auf Antikörper gegen aktivierte Caspasen, (ii) 561 nm für RFP, (iii) 488 nm für GFP und (iv) 405 nm Hoechst Kernfärbung. </li><li> Während der Bilderzeugung minimieren Exposition von Zellen mit Fluoreszenzlaseranregung während des Prozesses Bildgebung Photobleaching zu vermeiden, indem die Laserintensität zu reduzieren qualitativ hochwertige Bilder von Gewebe zu erhalten. </li><li> Nachdem ichMagiern werden gesammelt, die Bilder mit Mikroskop-Software zusammenführen. </li></ol>

The authors have nothing to disclose.

Hier zeigen wir die Konstruktion und Funktionsweise von CaspaseTracker, die Erkennung von weit verbreiteten basalen Caspase-Aktivität in gesunden Geweben erleichtern. Die kritischen Schritte zum Detektieren nicht-apoptotischen Caspase - Aktivität in vivo sind: 1) Fliegen mit dem Biosensor - Transgen zu erzeugen, 2) Caspase-spezifische Reporterfunktion mit geeigneten Kontrollen Verifizieren, 3) Praktizieren Techniken dissection alle inneren Organsysteme adulter Drosophila zu beobachten, und 4) Scheidu...

Caspasen sind Cystein-Proteasen, die durch Spaltung von vielen intrazellulären Proteinen nach Schlüssel Aspartatresten apoptotischen Zelltod vermitteln. Zum Beispiel aktivieren Initiator Caspasen Effektorcaspasen, dereprimieren DNA Nukleasen spalten Zytoskelett - Komponenten und die Lipidzusammensetzung von Zellmembranen verändern , um schnell Zellen abzubauen und ihre Anerkennung und engulfment stimulieren durch benachbarte Zellen , die der Zelle Leichen zu entsorgen. 1-4 Es wird geschätzt, dass Milliarden Zellen pro Tag in den menschlichen Körper sterben und Apoptose ist ein wichtiger Mechanismus der chemotherapieinduzierter Tumorzelltodes. 5 Eine andere Gruppe von Caspasen Zelltod durch verschiedene nicht-apoptotischen Prozesse führen können angeborene Immunität zu stimulieren. 6 Deshalb die meisten Untersuchungen auf Caspasen hat auf ihrer pro-Tod Funktionen konzentriert. Interessanterweise ergab erste Hinweise auf dem Gebiet, dass die gleichen Caspasen verantwortlich für die Förderung der Zelltod auch nicht den Tod f habenSalbungen. Pionierstudien haben gezeigt , daß Caspasen in diverse zelluläre Funktionen in gesunden Zellen beteiligt sind, einschließlich der Regulation der Zellproliferation und Migration während der Embryogenese. 7-9 Caspasen erforderlich sind für spermatid Individualisierung in Drosophila 10,11, für eine alternative necroptotic Zelltod blockiert bei Mäusen 12,13 und für microRNA Verarbeitung in C. elegans. 14,15 In vielleicht die langlebigste Zellen, Neuronen, Caspasen und andere apoptotische Maschinen sind an der Regulation neuronaler Aktivität verwickelt durch synaptischen Endungen Beschneidung, ein Prozess vermutlich wesentlich sein , andere Synapsen für Lernen und Gedächtnis zu stärken. 16- 18 Es ist möglich , dass Caspasen synaptic pruning durch eine Art Mini-Apoptose von neuronalen winzigen Vorsprünge ohne ganze Zelltod erleichtern. 19 jedoch Caspasen alternative Funktionen haben in keinem Zusammenhang mit der Apoptose-ähnlichen Ereignissen. 20,21 Dual - Rolles im Leben und Tod sind nicht einzigartig für Caspasen; BCL-2 - Familie Proteine und Cytochrom c haben Rollen in zelluläre Energetik in gesunden Zellen , sondern sind auch Teil des Kerns apoptotischen Weg, der von vielen Arten von Zellstress aktiviert. 22-25 Obwohl nicht bewiesen ist , scheint es logisch , dass die Evolution Tag verknüpft hat -Jobs zu Tode-Arbeitsplätze innerhalb der gleichen Moleküle rechtzeitige Beseitigung von untauglich oder unerwünschte Zellen zu gewährleisten. Gegenwärtig sind die molekularen Mechanismen von nicht-apoptotischen Caspase-Aktivität nicht verstanden, und das Ausmaß der nicht-apoptotischen Caspase-Aktivität während der embryonalen Entwicklung und in erwachsenen Geweben ist auch nicht bekannt. Eine große Herausforderung ist die Schwierigkeit, Tag-Jobs aus dem Tod Jobs von Caspasen zu unterscheiden. Im Gegensatz zur Apoptose und pyroptosis, als Caspase-Aktivität durch eine proteolytische Kaskade verstärkt wird, werden die Tag-Jobs von Caspasen erwartet bei wesentlich geringeren Mengen an enzymatischer Aktivität auftreten, wahrscheinlich unter der Nachweis von vielen verfügbaren technologien. Vor der vorliegenden Arbeit entwickelt andere eine Vielzahl von Caspase Biosensoren für verschiedene Zwecke. Die SCAT Biosensoren (zB ECFP-DEVD-Venus) schnell in Echtzeit Caspase - Aktivität in kultivierten Zellen und tierischen Geweben erkennen FRET verwenden. 26,27 Nach Caspase - Spaltung, die Kern gezielte GFP - Einheit von Apoliner (mCD8-RFP-DQVD- nucGFP) erfährt subzellulärer Relokalisation innerhalb von Minuten , wenn seine Plasmamembran-Haltegurt durch Caspasen gespalten wird. 28 in ähnlicher Weise ApoAlert-pCaspase3-Sensor (NES-DEVD-YFP-NLS) relokalisiert aus dem Cytosol in den Zellkern auf Caspase - Spaltung. 29,30 Mehr Vor kurzem wurde das Chromophor in iCasper geschickt entwickelt , wenn sie von Caspasen gespalten zu fluoreszieren, ermöglicht Detektion von Biosensor - Aktivität in Echtzeit in Neuronen von Drosophila - Embryonen, sondern in erster Linie in Verbindung mit Entwicklungs Zelltod. 31 Caspase-abhängigen Tod von olfaktorischen Neuronen während alterte demonstbewertet durch Immundetektion der Caspase-gespaltenen Form von CPV Biosensoren (beispielsweise mCD8-PARP-Venus). 32,33 Wichtig ist , dass die aktivierte Form von Caspase-3 in Abwesenheit von Zelltod durch sensitive immunostain in Stacheln detektierter kultivierten Neuronen und im Soma die Caspase-abhängigen Fluoreszenz des Kern CellEvent Reporterfarbstoff verwenden, aber Schwierigkeiten aufgrund Phototoxizität angetroffen wurden, obwohl Zelltod erst nach spine Eliminierung verzögert. 19 Somit werden neue Caspase Biosensoren erforderlich nachzuweisen und verfolgen Zellen mit basalen Caspase - Aktivität in vivo. Um diese Schwierigkeiten zu überwinden, haben wir einen einen neuen Dual Farbe Caspase Biosensor bezeichnet CaspaseTracker. Diese Strategie kombiniert eine modifizierte Version der Drosophila Caspase-sensitive Apoliner Biosensors 28 mit dem Drosophila G-TRACE FRT - Rekombinase - System 34 permanent zu markieren und die Zellen in vivo zu verfolgen. &lt;sup&gt; 35 Die Gal4-aktivierte G-TRACE - System ermöglicht ein sehr niedriges Niveau von Caspasen CaspaseTracker zu aktivieren, was zu RFP Expression im Zytoplasma und permanent kern gezielte GFP - Expression in einer beliebigen Zelle , die je Caspase - Aktivität erfahren hat. 35 Dieses System kann etikettieren Zellen im Laufe des Lebens in ganzen Tieren unter Verwendung von Drosophila melanogaster, ein lenkbar und am weitesten verbreiteten Modellsystem für die Untersuchung von Caspasen und Zelltod. 36-38

<table border="0" cellpadding="0" cellspacing="0" width="949">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:273px;">CONSUMABLES AND REAGENTS</td>
			<td style="width:229px;"></td>
			<td style="width:225px;"></td>
			<td style="width:223px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vectashield</td>
			<td style="width:229px;">Vector Products</td>
			<td style="width:225px;">H-1000</td>
			<td>Mounting medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Forceps</td>
			<td style="width:229px;">Ted Pella</td>
			<td style="width:225px;">#505 (110mm, #5)</td>
			<td>Dumont tweezer biology grade, stainless steel</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hanging Drop Slides</td>
			<td style="width:229px;">Fisher Scientific</td>
			<td style="width:225px;">12-565B</td>
			<td>Glass slides</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hoechst 33342</td>
			<td style="width:229px;">Molecular Probes</td>
			<td style="width:225px;">H1399</td>
			<td>DNA stain</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Alexa Fluor 633 Phalloidin</td>
			<td style="width:229px;">Molecular Probes</td>
			<td style="width:225px;">A22284</td>
			<td>Actin stain</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:273px;">Rat-Elav-7E8A10 anti-elav antibody</td>
			<td style="width:229px;">&#160;Developmental Studies Hybridoma Bank (DSHB)</td>
			<td style="width:225px;">Antibody Registry ID:&#160; AB_528218&#160;</td>
			<td>Stain for Drosophla pan-neuronal ELAV</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:273px;">Cleaved caspase-3 (Asp175) antibody</td>
			<td style="width:229px;">Cell Signaling Technology</td>
			<td style="width:225px;">#9661</td>
			<td>Stain for active fragment of caspase-3</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ProLong Gold antifade reagent</td>
			<td style="width:229px;">Life Technologies</td>
			<td style="width:225px;">P36934</td>
			<td>to preserve fluorophores&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:273px;">ProLong Diamond Antifade Mountant</td>
			<td style="width:229px;">Life Technologies</td>
			<td style="width:225px;">P36961</td>
			<td>to preserve fluorophores&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:273px;">SylGard 182 Silicone Elastomer Kit</td>
			<td style="width:229px;">Dow Corning&#160;</td>
			<td style="width:225px;">Product code: 0001023934</td>
			<td>for dissection plates</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:273px;">EQUIPMENT</td>
			<td style="width:229px;"></td>
			<td style="width:225px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LSM780 confocal microscope</td>
			<td style="width:229px;">Carl Zeiss</td>
			<td style="width:225px;">N/A</td>
			<td>Imaging</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:273px;">Carl Zeiss Stereomicroscope Stemi 2000&#160;</td>
			<td style="width:229px;">Carl Zeiss</td>
			<td style="width:225px;">N/A</td>
			<td>Drosophila dissection</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:273px;">AmScope Fiber Optic Dual Gooseneck Microscope Illuminator, 150W</td>
			<td style="width:229px;">AmScope</td>
			<td style="width:225px;">WBM99316&#160;</td>
			<td>Light source</td>
		</tr>
	</tbody>
</table>

in vivo biosensor tracks non-apoptotic caspase activity in drosophila

Caspases are the key mediators of apoptotic cell death via their proteolytic activity. When caspases are activated in cells to levels detectable by available technologies, apoptosis is generally assumed to occur shortly thereafter. Caspases can cleave many functional and structural components to cause rapid and complete cell destruction within a few minutes. However, accumulating evidence indicates that in normal healthy cells the same caspases have other functions, presumably at lower enzymatic levels. Studies of non-apoptotic caspase activity have been hampered by difficulties with detecting low levels of caspase activity and with tracking ultimate cell fate in vivo. Here, we illustrate the use of an ultrasensitive caspase reporter, CaspaseTracker, which permanently labels cells that have experienced caspase activity in whole animals. This in vivo dual color CaspaseTracker biosensor for Drosophila melanogaster transiently expresses red fluorescent protein (RFP) to indicate recent or on-going caspase activity, and permanently expresses green fluorescent protein (GFP) in cells that have experienced caspase activity at any time in the past yet did not die. Importantly, this caspase-dependent in vivo biosensor readily reveals the presence of non-apoptotic caspase activity in the tissues of organ systems throughout the adult fly. This is demonstrated using whole mount dissections of individual flies to detect biosensor activity in healthy cells throughout the brain, gut, malpighian tubules, cardia, ovary ducts and other tissues. CaspaseTracker detects non-apoptotic caspase activity in long-lived cells, as biosensor activity is detected in adult neurons and in other tissues at least 10 days after caspase activation. This biosensor serves as an important tool to uncover the roles and molecular mechanisms of non-apoptotic caspase activity in live animals.

Es gibt zwei wichtige Komponenten , die CaspaseTracker erlauben, Caspase - Aktivität in normalen , gesunden Zellen (Abbildung 1a) zu erkennen. Die erste davon ist ein 146 Aminosäure-Caspase-spaltbare Polypeptid nach der Caspase modellierten Biosensor Apoliner (Abbildung 1b). 28 Das Polypeptid aus DIAP1 (Drosophila Inhibitor der Apoptose) abgeleitet ist , eine einzelne natürlich vorkommenden Caspase - Stelle enthält , die typischer...

Watch this Scientific Journal Video about In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila at JoVE.com

In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

Um gesunde Zellen in ganzen Tieren erkennen , die geringe Mengen an Caspase - Aktivität enthalten, die hochempfindliche Biosensor bezeichnet CaspaseTracker wurde für Drosophila erzeugt. Caspase-abhängigen Biosensor-Aktivität wird in langlebigen gesunden Zellen in den inneren Organen der erwachsenen Tiere aufgezogen unter optimierten Bedingungen in Abwesenheit von Tod Stimuli detektiert.

In - vivo - Biosensor - Spuren Non-apoptotischen Caspase - Aktivität in Drosophila

Caspases are the key mediators of apoptotic cell death via their proteolytic activity. When caspases are activated in cells to levels detectable by ...

in-vivo-biosensor-tracks-non-apoptotic-caspase-activity-in-drosophila

Research

JoVE Journal

Biology

In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

9.0K Aufrufe.  Johns Hopkins University Bloomberg School of Public Health.  Um gesunde Zellen in ganzen Tieren erkennen , die geringe Mengen an Caspase - Aktivität enthalten, die hochempfindliche Biosensor bezeichnet CaspaseTracker wurde für Drosophila erzeugt. Caspase-abhängigen Biosensor-Aktivität wird in langlebigen gesunden Zellen in den inneren Organen der erwachsenen Tiere aufgezogen unter optimierten Bedingungen in Abwesenheit von Tod Stimuli detektiert. 

Serie: In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

Mesoscopic Fluorescence Tomography for In-vivo Imaging of Developing Drosophila

Visualizing developing organ formation as well as progession and treatment of disease often heavily relies on the ability to optically interrogate molecular and functional changes in intact living organisms. Most existing optical imaging methods are inadequate for imaging at dimensions that lie between the penetration limits of modern optical microscopy (0.5-1mm) and the diffusion-imposed limits of optical macroscopy (&gt;1cm) [1]. Thus, many important model organisms, e.g. insects, animal embryos or small animal extremities, remain inaccessible for in-vivo optical imaging. 
Although there is increasing interest towards the development of nanometer-resolution optical imaging methods, there have not been many successful efforts in improving the imaging penetration depth. The ability to perform in-vivo imaging beyond microscopy limits is in fact met with the difficulties associated with photon scattering present in tissues. Recent efforts to image entire embryos for example [2,3] require special chemical treatment of the specimen, to clear them from scattering, a procedure that makes them suitable only for post-mortem imaging. These methods however evidence the need for imaging larger specimens than the ones usually allowed by two-photon or confocal microscopy, especially in developmental biology and in drug discovery.
We have developed a new optical imaging technique named Mesoscopic Fluorescence Tomography [4], which appropriate for non-invasive in-vivo imaging at dimensions of 1mm-5mm. The method exchanges resolution for penetration depth, but offers unprecedented tomographic imaging performance and it has been developed to add time as a new dimension in developmental biology observations (and possibly other areas of biological research) by imparting the ability to image the evolution of fluorescence-tagged responses over time. As such it can accelerate studies of morphological or functional dependencies on gene mutations or external stimuli, and can importantly, capture the complete picture of development or tissue function by allowing longitudinal time-lapse visualization of the same, developing organism.
The technique utilizes a modified laboratory microscope and multi-projection illumination to collect data at 360-degree projections. It applies the Fermi simplification to Fokker-Plank solution of the photon transport equation, combined with geometrical optics principles in order to build a realistic inversion scheme suitable for mesoscopic range. This allows in-vivo whole-body visualization of non-transparent three-dimensional structures in samples up to several millimeters in size.
We have demonstrated the in-vivo performance of the technique by imaging three-dimensional structures of developing Drosophila tissues in-vivo and by following the morphogenesis of the wings in the opaque Drosophila pupae in real time over six consecutive hours.

Mesoscopic Fluorescence Tomography for In-vivo Imaging of Developing Drosophila

Mesoscopic fluorescence tomography operates beyond the penetration limits of tissue-sectioning fluorescence microscopy. The technique is based on multi-projection illumination and a photon transport description. We demonstrate in-vivo whole-body 3D visualization of the morphogenesis of GFP-expressing wing imaginal discs in Drosophila melanogaster.

Mesoscopic Fluoreszenz-Tomographie für In-vivo Imaging der Entwicklungsländer Drosophila</em

Visualizing  developing organ formation as well as progession and treatment of disease often  heavily relies on the ability to optically interrogate ...

Forschung

Biologie

Preparation of embryos for Electron Microscopy of the Drosophila embryonic heart tube

The morphogenesis of the Drosophila embryonic heart tube has emerged as a valuable model system for studying cell migration, cell-cell adhesion and cell shape changes during embryonic development. One of the challenges faced in studying this structure is that the lumen of the heart tube, as well as the membrane features that are crucial to heart tube formation, are difficult to visualize in whole mount embryos, due to the small size of the heart tube and intra-lumenal space relative to the embryo. The use of transmission electron microscopy allows for higher magnification of these structures and gives the advantage of examining the embryos in cross section, which easily reveals the size and shape of the lumen. In this video, we detail the process for reliable fixation, embedding, and sectioning of late stage Drosophila embryos in order to visualize the heart tube lumen as well as important cellular structures including cell-cell junctions and the basement membrane.

Preparation of embryos for Electron Microscopy of the Drosophila embryonic heart tube

We describe a process for fixation, embedding, sectioning, and imaging of late stage Drosophila embryos for Trasmission Electron Microscopy of the embryonic heart tube. This technique allows for the visualization of the heart tube lumen as well as the basement membrane, which lines the lumen of the heart.

Vorbereitung der Embryonen für Elektronenmikroskopie der Drosophila Embryonale Herz Rohr

The morphogenesis of the Drosophila  embryonic heart tube has emerged as a valuable model system for studying cell migration, cell-cell adhesion and cell ...

In-vivo Centrifugation of Drosophila Embryos

A major strategy for purifying and isolating different types of intracellular organelles is to separate them from each other based on differences in buoyant density. However, when cells are disrupted prior to centrifugation, proteins and organelles in this non-native environment often inappropriately stick to each other. Here we describe a method to separate organelles by density in intact, living Drosophila embryos. Early embryos before cellularization are harvested from population cages, and their outer egg shells are removed by treatment with 50% bleach. Embryos are then transferred to a small agar plate and inserted, posterior end first, into small vertical holes in the agar. The plates containing embedded embryos are centrifuged for 30 min at 3000g. The agar supports the embryos and keeps them in a defined orientation. Afterwards, the embryos are dug out of the agar with a blunt needle. Centrifugation separates major organelles into distinct layers, a stratification easily visible by bright-field microscopy. A number of fluorescent markers are available to confirm successful stratification in living embryos. Proteins associated with certain organelles will be enriched in a particular layer, demonstrating colocalization. Individual layers can be recovered for biochemical analysis or transplantation into donor eggs. This technique is applicable for organelle separation in other large cells, including the eggs and oocytes of diverse species.

In-vivo Centrifugation of Drosophila Embryos

We describe a method to separate organelles by density in living Drosophila embryos. Embryos are embedded in agar and centrifuged. This technique yields reproducible separation of major organelles along the anterior-posterior embryo axis. This method facilitates colocalization experiments and yields organelle fractions for biochemical analysis and transplantation experiments.

In-vivo-Zentrifugation von Drosophila Embryonen

A major strategy for purifying and isolating different types of intracellular organelles is to separate them from each other based on differences in ...

In vivo Imaging of Intact Drosophila Larvae at Sub-cellular Resolution

Recent improvements in optical imaging, genetically encoded fluorophores and genetic tools allowing efficient establishment of desired transgenic animal lines have enabled biological processes to be studied in the context of a living, and in some instances even behaving, organism. In this protocol we will describe how to anesthetize intact Drosophila larvae, using the volatile anesthetic desflurane, to follow the development and plasticity of synaptic populations at sub-cellular resolution1-3. While other useful methods to anesthetize Drosophila melanogaster larvae have been previously described4,5,6,7,8, the protocol presented herein demonstrates significant improvements due to the following combined key features: (1) A very high degree of anesthetization; even the heart beat is arrested allowing for lateral resolution of up to 150 nm1, (2) a high survival rate of &gt; 90% per anesthetization cycle, permitting the recording of more than five time-points over a period of hours to days2 and (3) a high sensitivity enabling us in 2 instances to study the dynamics of proteins expressed at physiological levels. In detail, we were able to visualize the postsynaptic glutamate receptor subunit GluR-IIA expressed via the endogenous promoter1 in stable transgenic lines and the exon trap line FasII-GFP1. (4) In contrast to other methods4,7 the larvae can be imaged not only alive, but also intact (i.e. non-dissected) allowing observation to occur over a number of days1. The accompanying video details the function of individual parts of the in vivo imaging chamber2,3, the correct mounting of the larvae, the anesthetization procedure, how to re-identify specific positions within a larva and the safe removal of the larvae from the imaging chamber.

In vivo Imaging of Intact Drosophila Larvae at Sub-cellular Resolution

This protocol describes a reliable method for anesthetization and imaging of intact Drosophila melanogaster larvae. We have utilized the volatile anesthetic desflurane to allow for repetitive imaging at sub-cellular resolution and re-identification of structures for up to a few days1.

In-vivo-Imaging von Intact Drosophila-Larven auf subzellulärer Auflösung

Recent improvements in optical imaging, genetically encoded fluorophores and genetic tools allowing efficient establishment of desired transgenic animal ...

Patch Clamp and Perfusion Techniques for Studying Ion Channels Expressed in Xenopus oocytes

The protocol presented here is designed to study the activation of the large conductance, voltage- and Ca2+-activated K+ (BK) channels. The protocol may also be used to study the structure-function relationship for other ion channels and neurotransmitter receptors1. BK channels are widely expressed in different tissues and have been implicated in many physiological functions, including regulation of smooth muscle contraction, frequency tuning of inner hair cells and regulation of neurotransmitter release2-6. BK channels are activated by membrane depolarization and by intracellular Ca2+ and Mg2+ 6-9. Therefore, the protocol is designed to control both the membrane voltage and the intracellular solution. In this protocol, messenger RNA of BK channels is injected into Xenopus laevis oocytes (stage V-VI) followed by 2-5 days of incubation at 18&deg;C10-13. Membrane patches that contain single or multiple BK channels are excised with the inside-out configuration using patch clamp techniques10-13. The intracellular side of the patch is perfused with desired solutions during recording so that the channel activation under different conditions can be examined. To summarize, the mRNA of BK channels is injected into Xenopus laevis oocytes to express channel proteins on the oocyte membrane; patch clamp techniques are used to record currents flowing through the channels under controlled voltage and intracellular solutions.

Patch Clamp and Perfusion Techniques for Studying Ion Channels Expressed in Xenopus oocytes

Ionic current of BK channels is recorded using patch clamp techniques. BK channels are expressed in Xenopus oocytes by injecting messenger RNA. The intracellular solution during patch clamp recordings is controlled by a perfusion system.

Patch-Clamp-und Perfusion Techniken zur Untersuchung von Ionenkanälen ausgedrückt in Xenopus Oozyten

The protocol presented here is designed to study the activation of the large conductance, voltage- and Ca2+-activated K+ (BK) channels. The protocol may ...

Imaging Cell Shape Change in Living Drosophila Embryos

The developing Drosophila melanogaster embryo undergoes a number of cell shape changes that are highly amenable to live confocal imaging. Cell shape changes in the fly are analogous to those in higher organisms, and they drive tissue morphogenesis. So, in many cases, their study has direct implications for understanding human disease (Table 1)1-5. On the sub-cellular scale, these cell shape changes are the product of activities ranging from gene expression to signal transduction, cell polarity, cytoskeletal remodeling and membrane trafficking. Thus, the Drosophila embryo provides not only the context to evaluate cell shape changes as they relate to tissue morphogenesis, but also offers a completely physiological environment to study the sub-cellular activities that shape cells.
The protocol described here is designed to image a specific cell shape change called cellularization. Cellularization is a process of dramatic plasma membrane growth, and it ultimately converts the syncytial embryo into the cellular blastoderm. That is, at interphase of mitotic cycle 14, the plasma membrane simultaneously invaginates around each of ~6000 cortically anchored nuclei to generate a sheet of primary epithelial cells. Counter to previous suggestions, cellularization is not driven by Myosin-2 contractility6, but is instead fueled largely by exocytosis of membrane from internal stores7. Thus, cellularization is an excellent system for studying membrane trafficking during cell shape changes that require plasma membrane invagination or expansion, such as cytokinesis or transverse-tubule (T-tubule) morphogenesis in muscle.
Note that this protocol is easily applied to the imaging of other cell shape changes in the fly embryo, and only requires slight adaptations such as changing the stage of embryo collection, or using "embryo glue" to mount the embryo in a specific orientation (Table 1)8-19. In all cases, the workflow is basically the same (Figure 1). Standard methods for cloning and Drosophila transgenesis are used to prepare stable fly stocks that express a protein of interest, fused to Green Fluorescent Protein (GFP) or its variants, and these flies provide a renewable source of embryos. Alternatively, fluorescent proteins/probes are directly introduced into fly embryos via straightforward micro-injection techniques9-10. Then, depending on the developmental event and cell shape change to be imaged, embryos are collected and staged by morphology on a dissecting microscope, and finally positioned and mounted for time-lapse imaging on a confocal microscope.

Imaging Cell Shape Change in Living Drosophila Embryos

Early development of the fruit fly, Drosophila melanogaster, is characterized by a number of cell shape changes that are well suited for imaging approaches. This article will describe basic tools and methods required for live confocal imaging of Drosophila embryos, and will focus on a cell shape change called cellularization.

Imaging Zellgröße Veränderung der Lebens- Drosophila Embryos

The developing Drosophila melanogaster embryo undergoes a number of cell shape changes that are highly amenable to live confocal imaging.  Cell shape ...

Live Imaging of Apoptotic Cell Clearance during Drosophila Embryogenesis

The proper elimination of unwanted or aberrant cells through apoptosis and subsequent phagocytosis (apoptotic cell clearance) is crucial for normal development in all metazoan organisms. Apoptotic cell clearance is a highly dynamic process intimately associated with cell death; unengulfed apoptotic cells are barely seen in vivo under normal conditions. In order to understand the different steps of apoptotic cell clearance and to compare 'professional' phagocytes - macrophages and dendritic cells to 'non-professional' - tissue-resident neighboring cells, in vivo live imaging of the process is extremely valuable. Here we describe a protocol for studying apoptotic cell clearance in live Drosophila embryos. To follow the dynamics of different steps in phagocytosis we use specific markers for apoptotic cells and phagocytes. In addition, we can monitor two phagocyte systems in parallel: 'professional' macrophages and 'semi-professional' glia in the developing central nervous system (CNS). The method described here employs the Drosophila embryo as an excellent model for real time studies of apoptotic cell clearance.

Live Imaging of Apoptotic Cell Clearance during Drosophila Embryogenesis

Here we describe an effective method for studying dynamics of apoptotic cell clearance in vivo. This method employs live Drosophila embryos as a powerful model for monitoring phagocytosis of apoptotic cells using specific labeling of apoptotic cells and phagocytes.

Live-Imaging von apoptotischen Ausverkauf während<em&gt; Drosophila</em&gt; Embryogenese

The  proper elimination of unwanted or aberrant cells through apoptosis and  subsequent phagocytosis (apoptotic cell clearance) is crucial for normal  ...

An in vivo Crosslinking Approach to Isolate Protein Complexes From Drosophila Embryos

Many cellular processes are controlled by multisubunit protein complexes. Frequently these complexes form transiently and require native environment to assemble. Therefore, to identify these functional protein complexes, it is important to stabilize them in vivo before cell lysis and subsequent purification. Here we describe a method used to isolate large bona fide protein complexes from Drosophila embryos. This method is based on embryo permeabilization and stabilization of the complexes inside the embryos by in vivo crosslinking using a low concentration of formaldehyde, which can easily cross the cell membrane. Subsequently, the protein complex of interest is immunopurified followed by gel purification and analyzed by mass spectrometry. We illustrate this method using purification of a Tudor protein complex, which is essential for germline development. Tudor is a large protein, which contains multiple Tudor domains - small modules that interact with methylated arginines or lysines of target proteins. This method can be adapted for isolation of native protein complexes from different organisms and tissues.

An in vivo Crosslinking Approach to Isolate Protein Complexes From Drosophila Embryos

Multi-component protein complexes play crucial roles during cellular function and development. Here we describe a method used to isolate native protein complexes from Drosophila embryos after in vivo crosslinking followed by purification of the crosslinked complexes for subsequent structure-function analysis.

Ein In vivo Vernetzung Ansatz zur Proteinkomplexe Von Isolieren Drosophila Embryonen

Many cellular processes are controlled by multisubunit protein complexes. Frequently these complexes form transiently and require native environment to ...

Functional Reconstitution and Channel Activity Measurements of Purified Wildtype and Mutant CFTR Protein

The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a unique channel-forming member of the ATP Binding Cassette (ABC) superfamily of transporters. The phosphorylation and nucleotide dependent chloride channel activity of CFTR has been frequently studied in whole cell systems and as single channels in excised membrane patches. Many Cystic Fibrosis-causing mutations have been shown to alter this activity. While a small number of purification protocols have been published, a fast reconstitution method that retains channel activity and a suitable method for studying population channel activity in a purified system have been lacking. Here rapid methods are described for purification and functional reconstitution of the full-length CFTR protein into proteoliposomes of defined lipid composition that retains activity as a regulated halide channel. This reconstitution method together with a novel flux-based assay of channel activity is a suitable system for studying the population channel properties of wild type CFTR and the disease-causing mutants F508del- and G551D-CFTR. Specifically, the method has utility in studying the direct effects of phosphorylation, nucleotides and small molecules such as potentiators and inhibitors on CFTR channel activity. The methods are also amenable to the study of other membrane channels/transporters for anionic substrates.

Described here is a rapid and effective procedure for functional reconstitution of purified wild-type and mutant CFTR protein that preserves activity for this chloride channel, which is defective in Cystic Fibrosis. Iodide efflux from reconstituted proteoliposomes mediated by CFTR allows studies of channel activity and the effects of small molecules.

Funktionelle Rekonstitution und Kanalaktivitätsmessungen von gereinigtem Wildtyp und mutierten CFTR-Protein

The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a unique channel-forming member of the ATP Binding Cassette (ABC) superfamily of ...

Measurement of Larval Activity in the Drosophila Activity Monitor

Drosophila larvae are used in many behavioral studies, yet a simple device for measuring basic parameters of larval activity has not been available. This protocol repurposes an instrument often used to measure adult activity, the TriKinetics Drosophila activity monitor (MB5 Multi-Beam Activity Monitor) to study larval activity. The instrument can monitor the movements of animals in 16 individual 8 cm glass assay tubes, using 17 infrared detection beams per tube. Logging software automatically saves data to a computer, recording parameters such as number of moves, times sensors were triggered, and animals&#8217; positions within the tubes. The data can then be analyzed to represent overall locomotion and/or position preference as well as other measurements. All data are easily accessible and compatible with basic graphing and data manipulation software. This protocol will discuss how to use the apparatus, how to operate the software and how to run a larval activity assay from start to finish.

Measurement of Larval Activity in the Drosophila Activity Monitor

This report describes a method for measuring Drosophila larval activity using the TriKinetics Drosophila Activity Monitor. The device employs infrared beams to detect movements of up to 16 individual animals. Data can be analyzed to represent motion parameters including rates and the positions of the animals within the assay chambers.

Die Messung der Aktivität in der Larven<em&gt; Drosophila</em&gt; Activity Monitor

Drosophila larvae are used in many behavioral studies, yet a simple device for measuring basic parameters of larval activity has not been available. This ...