Name: in vivo biosensor tracks non-apoptotic caspase activity in drosophila
Uploaded: 2016-11-27T13:00:00.000+00:00
Duration: 13 min 21 s
Description: Watch this Scientific Journal Video about In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila at JoVE.com

Wir danken Polan Santos und Darren Obbard für Drosophila Abbildungen in Fig. 2a, Marcelo Jacobs-Lorena für die Verwendung des JHMRI Insektarium. Diese Arbeit wurde von der Life Science Research Foundation Fellowship (HLT), University Grants Committee der Hong Kong AoE / B-07/99 (MCF) unterstützt wurde, und NIH gewährt NS096677, NS037402 und NS083373 (JMH). Ho Lam Tang ist ein Shurl und Kay Curci Foundation Fellow der Life Sciences Research Foundation.

1. Herstellung von CaspaseTracker Flies <ol><li> Zur Vorbereitung CaspaseTracker (DQVD) fliegt für Experimente, führen Sie diese Quer: UBI-CaspaseTracker x G-TRACE (UAS-RFP, UAS-FLP; Ubi&gt; Stop&gt; GFP-nls), durch die Übertragung von 7-10 jungfräulichen Weibchen (oder männlich) die Caspase Biosensor Substrat mCD8-DIAP1-Gal4 durch den Ubiquitin - Promotor 35 zusammen mit der gleichen Anzahl von männlichen (bzw. weiblichen) angetrieben G-TRACE Fliegen, die das zweite Chromosom cyo Ausgleicher haben zu vermeiden Letalität der homozygoten Kombination von G- Fliegen Trage TRACE (UAS-RFP, UAS-FLP und Ubi&gt; Stop&gt; GFP-nls) 34. Platz fliegt in einem frischen Lebensmittel Fläschchen mit frischer Hefe-Paste als Proteinquelle. </li><li> Inkubieren Dateien bei 18 ° C für 5 bis 7 Tage (maximal 2 Wochen) und entfernen Sie dann die Eltern aus dem Fläschchen fliegt mit neuen Nachkommen zu vermeiden, Überfüllung und neue Zucht Fläschchen einzurichten. </li><li> Weiter Inkubation bei 18 ° C bis Nachkommen eclose fliegt. Wählen Sie das nicht Cyo [non-curly Flügel] Nachkommen des korrekten Genotyp von CaspaseTracker, die 35 für CaspaseTracker und G-TRACE Elemente transgen sind. </li><li> Gleichzeitig erzeugen Kontrolle der Eltern nicht-transgenen W118 Fliegen und Caspase-unempfindlich (DQVA) fliegt parallel spezifischen CaspaseTracker RFP und GFP-Fluoreszenz zu überprüfen. </li><li> Führen Sie die PCR-Genotypisierung, um zu bestätigen Dateien mit CaspaseTracker unter Verwendung der Primer: 5&#39;-TCCCCCGGGCTGCAGGAATTC, 3&#39;-TGGAATTGGGGTACGTCTAGA, ein 3897-bp-Produkt zu erzeugen. Für die Genotypisierung die G-Trace-Loci, verwenden Sie die folgenden Primer, die für GFP (474 ​​bp), 5&#39;-CAC GAC TTC TTC AAG TCC GCC ATG CCC G, 3&#39;-CTT GTA CAG CTC GTC CAT GCC GAG AGT GAT C; für RFP (258 bp), 5&#39;-GGC TGC TTC ATC TAC AAG GTG AAG TTC ATC GG, 3&#39;-GAT GTC CAG CTT GGA GTC CAC GTA GTA GTA GC; und für Flpase (655 bp), 5 &#39;CCACCTAAGGTGCTTGTTCGTCAGTTTGTGG, 3&#39;-GCC TAC TAA CGC TTG TCT TTG TCT CTG TCA C. Für die Genotypisierung Gal4 im pUWR Vektor (554 bp), 5&#39;-GAA GCA CAC CTT CGC ATC GCT CAGTCA CGC, 3&#39;-TGG AAT TGG GGT ACG TCT AGA. </li></ol> 2. Gewebepräparation, Färbung und Montage <ol><li> Für Fliegen Dissektionen verhindern seziert Gewebe zu Kunststoff-Pipettenspitzen und Zentrifugenröhrchen kleben, beschichten Spitzen und Rohre mit 1% Rinderserumalbumin (BSA) in Wasser gelöst. </li><li> Dissect fliegt auf einem Silikonkissen mit einer Pinzette. <ol><li> Schäden an den Spitzen der Zange auf eine harte Oberfläche zu vermeiden, wenn das Gewebe Dissektion durchführen, führen Präparation auf einer Siliziumoberfläche. Für Silikon-Dissektion Platten machen, schmelzen das Silizium im Handel erhältlichen Kits gemäß den Anweisungen des Herstellers (Materialliste). Nach dem Silikon schmelzen, fügen Sie 3 bis 4 ml zu einem Durchmesser von 60 mm Gewebekulturschale. Silicon Geschirr kann wiederverwendet werden. </li><li> Anesthetize eine Fliege mit CO 2, und übertragen sie mit 1 ml kaltem PBS auf eine Silikonplatte. Führen Sie das CO 2 in ein Fläschchen , die Fliege mit einem Blasrohr enthält, und dann übertragen Sie die narkotisiert fly toa Pad , die eine CO 2 Versorgung. </li><li> Verwenden Sie eine Zange, die Fliege Kopf, und ein zweites Paar von Zange zu halten, den Brustkorb in die entgegengesetzte Richtung zu ziehen, die Fliege Kopf vom Körper zu trennen abdeckt, ohne dass die Verbindung zwischen dem Kopf und foregut zu beschädigen. </li><li> Verwenden Sie 2 Paar Zangen, die Flügel und Beine aus dem Thorax zu entfernen. </li><li> Verwenden Sie ein Paar Zangen des Thorax zu halten, und ein anderes Paar von Zange den Bauch ziehen Sie sie vom Thorax wieder zu trennen, ohne die Verbindung zwischen dem Vorderdarm und Mitteldarm zu beschädigen. </li><li> Präparieren inneren Organe einschließlich Gehirn, Darm, Malpighischen Gefäße und der Ovarien , wie zuvor unter Beweis gestellt. 39-41 </li><li> Entfernen Sie alle Stücke der Kutikula und die Fettkörper mit einer Pinzette, da diese Gewebe starke Autofluoreszenz produzieren. Geduld und Übung erforderlich, um eine vollständige Organsystem vorzubereiten, wie dargestellt. </li></ol></li><li> Übertragen Sie seziert Gewebe zu 1,5 ml Zentrifugenröhrchen und reparieren Gewebe with 0,5 ml 4% Paraformaldehyd in PBS (phosphatgepufferter Salzlösung) bei RT für 20 bis 30 min mit der Drehung in der Dunkelheit Bleich RFP und GFP in den Geweben zu vermeiden. Vermeiden Sie längere Fixierung, die nachfolgende Färbung Ergebnisse beeinträchtigen können. </li><li> Entfernen des Paraformaldehyds durch vorsichtiges Pipettieren und wäscht 3 mal mit 0,5 ml PBST (PBS + 0,1% Triton X-100) bei RT. </li><li> Permeabilisieren die Gewebe mit 0,5 ml PBST bei 4 ° C über Nacht unter leichtem Schütteln. Kürzere Inkubationszeiten unvollständige Permeabilisierung und des Kompromisses Färbung Ergebnisse verursachen. <ol><li> Wenn es notwendig ist, die Hintergrundfärbung zu reduzieren, sollten Gewebe in 0,5 ml PBST mit 1% BSA anstelle von PBS inkubiert. </li></ol></li><li> Waschen Sie die Gewebe 3-mal mit 0,5 ml PBST. </li><li> Beflecken Kerne und filamentöse Aktin (F-Aktin), gelten 0,5 ml PBST mit 10 ug / ml Hoechst 33342 blau Kern Farbstoff und 0,3 uM Alexa Fluor 633 Phalloidin F-Actin-Färbung und Inkubation gleichzeitig mit Geweben für 1 h bei RT with sanfte Rotation im Dunkeln. Vermeiden Sie längere Färbung, da dies den Hintergrund zu erhöhen. <ol><li> Für die Immunfärbung, inkubieren fixiert und permeabilisiert Gewebe mit 0,1% Triton X-100 in 0,5 ml PBS über Nacht bei 4 ° C, Fleck mit 1: 100-Verdünnung von anti-ELAV Antikörper oder mit 1: 200-Verdünnung von Anti-Caspase-3 Nacht bei 4 ° C (300 ul). Folgen durch den entsprechenden Sekundärantikörpers, verdünnt 1: 100 und Inkubation für 1 bis 3 h bei RT. Siehe Materialliste für spezifische Antikörper Informationen. </li></ol></li><li> Waschen Sie die Tücher 3 mal für jeweils 5 min in 0,5 ml PBST mit sanfter Drehung. </li><li> Mit einer Pipette, entfernen Sie alle PBST und dann 200 ul hinzufügen Antibleichbefestigungsmittel (siehe Materialien) vollständig Gewebe für 1-3 h bei RT abdecken oder 4 ° über Nacht C. Optimale Gewebe, die die Montagemittel vollständig aufgenommen haben, wird auf dem Boden des Röhrchens sinken. </li><li> Vorreinigung der Glasobjektträger mit Wasser oder 70% Ethanol und das Gewebe mit Befestigungsmittel auf die Glas übertragenRutsche. </li><li> Vorsichtig ein Deckglas über dem Gewebe. Vaseline auf dem Glasobjektträger und Deckglas zu vermeiden, um das Gewebe durch Überkompression zu zerstören. Entfernen Sie die zusätzlichen Befestigungsmittel mit Seidenpapier. </li><li> Verschließen Sie die Deckglas durch Anwendung Nagellack alle entlang der Ränder des Deckglases zu vermeiden Leckage von Mitteln aus den Geweben Montage. </li></ol> 3. konfokale Mikroskopie <ol><li> Verwenden eines invertierten konfokalen Epi-Fluoreszenzmikroskop. Jedoch oben rechts Mikroskope verwendet werden kann. Um das Bild zu Geweben tiling Verwendung aufrechtzuerhalten stabile Raumtemperaturdrift des Fokus und der Verschiebung der xy-Ebene zu vermeiden, aufgrund der thermischen Expansion und Kontraktion der Komponenten. Umweltkontrollsysteme und Fokusdrift-Kompensationssysteme helfen, dieses Problem durch den Verlust von thermo-Gleichgewicht des Mikroskopsystems zu vermeiden. </li><li> Platzieren Sie den Schieber auf der Bühne des Mikroskops. Nehmen Sie ein paar Testbilder mit geringer Auflösung (125 x 125 Pixel) eind die entsprechende Anzahl der Kacheln bestimmen erforderlich, um die gesamte Region von Interesse (ROI) zu decken. </li><li> Stellen Sie das Mikroskop Scansystem zum Erfassen von Bildern mit Scan-Auflösung wie 500 x 500 Pixel. Wählen Sie das Ziel wie ein 20X NA 0,8 oder einem 63X NA 1.4 Plan-Apochromat Ziel für Gewebe durch Glasplättchen zu analysieren, so dass jedes der Bilder (Fliesen) überlappt um 20% auf allen Seiten. </li><li> Stellen Sie die Bildsequenz von längste bis Anregungswellenlängen kürzesten, als die langwellige Licht niedriger Photobleaching verursacht. Die Sequenz von längste Anregungswellenlänge kürzeste: (i) 633 nm für Phalloidin F-Actin und auf Antikörper gegen aktivierte Caspasen, (ii) 561 nm für RFP, (iii) 488 nm für GFP und (iv) 405 nm Hoechst Kernfärbung. </li><li> Während der Bilderzeugung minimieren Exposition von Zellen mit Fluoreszenzlaseranregung während des Prozesses Bildgebung Photobleaching zu vermeiden, indem die Laserintensität zu reduzieren qualitativ hochwertige Bilder von Gewebe zu erhalten. </li><li> Nachdem ichMagiern werden gesammelt, die Bilder mit Mikroskop-Software zusammenführen. </li></ol>

The authors have nothing to disclose.

Hier zeigen wir die Konstruktion und Funktionsweise von CaspaseTracker, die Erkennung von weit verbreiteten basalen Caspase-Aktivität in gesunden Geweben erleichtern. Die kritischen Schritte zum Detektieren nicht-apoptotischen Caspase - Aktivität in vivo sind: 1) Fliegen mit dem Biosensor - Transgen zu erzeugen, 2) Caspase-spezifische Reporterfunktion mit geeigneten Kontrollen Verifizieren, 3) Praktizieren Techniken dissection alle inneren Organsysteme adulter Drosophila zu beobachten, und 4) Scheidu...

Caspasen sind Cystein-Proteasen, die durch Spaltung von vielen intrazellulären Proteinen nach Schlüssel Aspartatresten apoptotischen Zelltod vermitteln. Zum Beispiel aktivieren Initiator Caspasen Effektorcaspasen, dereprimieren DNA Nukleasen spalten Zytoskelett - Komponenten und die Lipidzusammensetzung von Zellmembranen verändern , um schnell Zellen abzubauen und ihre Anerkennung und engulfment stimulieren durch benachbarte Zellen , die der Zelle Leichen zu entsorgen. 1-4 Es wird geschätzt, dass Milliarden Zellen pro Tag in den menschlichen Körper sterben und Apoptose ist ein wichtiger Mechanismus der chemotherapieinduzierter Tumorzelltodes. 5 Eine andere Gruppe von Caspasen Zelltod durch verschiedene nicht-apoptotischen Prozesse führen können angeborene Immunität zu stimulieren. 6 Deshalb die meisten Untersuchungen auf Caspasen hat auf ihrer pro-Tod Funktionen konzentriert. Interessanterweise ergab erste Hinweise auf dem Gebiet, dass die gleichen Caspasen verantwortlich für die Förderung der Zelltod auch nicht den Tod f habenSalbungen. Pionierstudien haben gezeigt , daß Caspasen in diverse zelluläre Funktionen in gesunden Zellen beteiligt sind, einschließlich der Regulation der Zellproliferation und Migration während der Embryogenese. 7-9 Caspasen erforderlich sind für spermatid Individualisierung in Drosophila 10,11, für eine alternative necroptotic Zelltod blockiert bei Mäusen 12,13 und für microRNA Verarbeitung in C. elegans. 14,15 In vielleicht die langlebigste Zellen, Neuronen, Caspasen und andere apoptotische Maschinen sind an der Regulation neuronaler Aktivität verwickelt durch synaptischen Endungen Beschneidung, ein Prozess vermutlich wesentlich sein , andere Synapsen für Lernen und Gedächtnis zu stärken. 16- 18 Es ist möglich , dass Caspasen synaptic pruning durch eine Art Mini-Apoptose von neuronalen winzigen Vorsprünge ohne ganze Zelltod erleichtern. 19 jedoch Caspasen alternative Funktionen haben in keinem Zusammenhang mit der Apoptose-ähnlichen Ereignissen. 20,21 Dual - Rolles im Leben und Tod sind nicht einzigartig für Caspasen; BCL-2 - Familie Proteine und Cytochrom c haben Rollen in zelluläre Energetik in gesunden Zellen , sondern sind auch Teil des Kerns apoptotischen Weg, der von vielen Arten von Zellstress aktiviert. 22-25 Obwohl nicht bewiesen ist , scheint es logisch , dass die Evolution Tag verknüpft hat -Jobs zu Tode-Arbeitsplätze innerhalb der gleichen Moleküle rechtzeitige Beseitigung von untauglich oder unerwünschte Zellen zu gewährleisten. Gegenwärtig sind die molekularen Mechanismen von nicht-apoptotischen Caspase-Aktivität nicht verstanden, und das Ausmaß der nicht-apoptotischen Caspase-Aktivität während der embryonalen Entwicklung und in erwachsenen Geweben ist auch nicht bekannt. Eine große Herausforderung ist die Schwierigkeit, Tag-Jobs aus dem Tod Jobs von Caspasen zu unterscheiden. Im Gegensatz zur Apoptose und pyroptosis, als Caspase-Aktivität durch eine proteolytische Kaskade verstärkt wird, werden die Tag-Jobs von Caspasen erwartet bei wesentlich geringeren Mengen an enzymatischer Aktivität auftreten, wahrscheinlich unter der Nachweis von vielen verfügbaren technologien. Vor der vorliegenden Arbeit entwickelt andere eine Vielzahl von Caspase Biosensoren für verschiedene Zwecke. Die SCAT Biosensoren (zB ECFP-DEVD-Venus) schnell in Echtzeit Caspase - Aktivität in kultivierten Zellen und tierischen Geweben erkennen FRET verwenden. 26,27 Nach Caspase - Spaltung, die Kern gezielte GFP - Einheit von Apoliner (mCD8-RFP-DQVD- nucGFP) erfährt subzellulärer Relokalisation innerhalb von Minuten , wenn seine Plasmamembran-Haltegurt durch Caspasen gespalten wird. 28 in ähnlicher Weise ApoAlert-pCaspase3-Sensor (NES-DEVD-YFP-NLS) relokalisiert aus dem Cytosol in den Zellkern auf Caspase - Spaltung. 29,30 Mehr Vor kurzem wurde das Chromophor in iCasper geschickt entwickelt , wenn sie von Caspasen gespalten zu fluoreszieren, ermöglicht Detektion von Biosensor - Aktivität in Echtzeit in Neuronen von Drosophila - Embryonen, sondern in erster Linie in Verbindung mit Entwicklungs Zelltod. 31 Caspase-abhängigen Tod von olfaktorischen Neuronen während alterte demonstbewertet durch Immundetektion der Caspase-gespaltenen Form von CPV Biosensoren (beispielsweise mCD8-PARP-Venus). 32,33 Wichtig ist , dass die aktivierte Form von Caspase-3 in Abwesenheit von Zelltod durch sensitive immunostain in Stacheln detektierter kultivierten Neuronen und im Soma die Caspase-abhängigen Fluoreszenz des Kern CellEvent Reporterfarbstoff verwenden, aber Schwierigkeiten aufgrund Phototoxizität angetroffen wurden, obwohl Zelltod erst nach spine Eliminierung verzögert. 19 Somit werden neue Caspase Biosensoren erforderlich nachzuweisen und verfolgen Zellen mit basalen Caspase - Aktivität in vivo. Um diese Schwierigkeiten zu überwinden, haben wir einen einen neuen Dual Farbe Caspase Biosensor bezeichnet CaspaseTracker. Diese Strategie kombiniert eine modifizierte Version der Drosophila Caspase-sensitive Apoliner Biosensors 28 mit dem Drosophila G-TRACE FRT - Rekombinase - System 34 permanent zu markieren und die Zellen in vivo zu verfolgen. &lt;sup&gt; 35 Die Gal4-aktivierte G-TRACE - System ermöglicht ein sehr niedriges Niveau von Caspasen CaspaseTracker zu aktivieren, was zu RFP Expression im Zytoplasma und permanent kern gezielte GFP - Expression in einer beliebigen Zelle , die je Caspase - Aktivität erfahren hat. 35 Dieses System kann etikettieren Zellen im Laufe des Lebens in ganzen Tieren unter Verwendung von Drosophila melanogaster, ein lenkbar und am weitesten verbreiteten Modellsystem für die Untersuchung von Caspasen und Zelltod. 36-38

<table><tbody><tr><td colspan="4">&lt;strong&gt;Consumables and Reagents&lt;/strong&gt;</td></tr><tr><td>Vectashield</td><td>Vector Products</td><td>H-1000</td><td>Mounting medium</td></tr><tr><td>Forceps</td><td>Ted Pella</td><td>#505 (110mm, #5)</td><td>Dumont tweezer biology grade, stainless steel</td></tr><tr><td>Hanging Drop Slides</td><td>Fisher Scientific</td><td>12-565B</td><td>Glass slides</td></tr><tr><td>Hoechst 33342</td><td>Molecular Probes</td><td>H1399</td><td>DNA stain</td></tr><tr><td>Alexa Fluor 633 Phalloidin</td><td>Molecular Probes</td><td>A22284</td><td>Actin stain</td></tr><tr><td>Rat-Elav-7E8A10 anti-elav antibody</td><td>Developmental Studies Hybridoma Bank (DSHB)</td><td>Antibody Registry ID:&amp;nbsp; AB_528218&amp;nbsp;</td><td>Stain for Drosophla pan-neuronal ELAV</td></tr><tr><td>Cleaved caspase-3 (Asp175) antibody</td><td>Cell Signaling Technology</td><td>#9661</td><td>Stain for active fragment of caspase-3</td></tr><tr><td>ProLong Gold antifade reagent</td><td>Life Technologies</td><td>P36934</td><td>to preserve fluorophores&amp;nbsp;</td></tr><tr><td>ProLong Diamond Antifade Mountant</td><td>Life Technologies</td><td>P36961</td><td>to preserve fluorophores&amp;nbsp;</td></tr><tr><td>SylGard 182 Silicone Elastomer Kit</td><td>Dow Corning&amp;nbsp;</td><td>Product code: 0001023934</td><td>for dissection plates</td></tr><tr><td colspan="4">&lt;strong&gt;Equipment&lt;/strong&gt;</td></tr><tr><td>LSM780 confocal microscope</td><td>Carl Zeiss</td><td>N/A</td><td>Imaging</td></tr><tr><td>Carl Zeiss Stereomicroscope Stemi 2000</td><td>Carl Zeiss</td><td>N/A</td><td>&lt;em&gt;Drosophila&lt;/em&gt; dissection</td></tr><tr><td>AmScope Fiber Optic Dual Gooseneck Microscope Illuminator, 150&amp;nbsp;W</td><td>AmScope</td><td>WBM99316</td><td>Light source</td></tr></tbody></table>

in vivo biosensor tracks non-apoptotic caspase activity in drosophila

Caspases are the key mediators of apoptotic cell death via their proteolytic activity. When caspases are activated in cells to levels detectable by available technologies, apoptosis is generally assumed to occur shortly thereafter. Caspases can cleave many functional and structural components to cause rapid and complete cell destruction within a few minutes. However, accumulating evidence indicates that in normal healthy cells the same caspases have other functions, presumably at lower enzymatic levels. Studies of non-apoptotic caspase activity have been hampered by difficulties with detecting low levels of caspase activity and with tracking ultimate cell fate in vivo. Here, we illustrate the use of an ultrasensitive caspase reporter, CaspaseTracker, which permanently labels cells that have experienced caspase activity in whole animals. This in vivo dual color CaspaseTracker biosensor for Drosophila melanogaster transiently expresses red fluorescent protein (RFP) to indicate recent or on-going caspase activity, and permanently expresses green fluorescent protein (GFP) in cells that have experienced caspase activity at any time in the past yet did not die. Importantly, this caspase-dependent in vivo biosensor readily reveals the presence of non-apoptotic caspase activity in the tissues of organ systems throughout the adult fly. This is demonstrated using whole mount dissections of individual flies to detect biosensor activity in healthy cells throughout the brain, gut, malpighian tubules, cardia, ovary ducts and other tissues. CaspaseTracker detects non-apoptotic caspase activity in long-lived cells, as biosensor activity is detected in adult neurons and in other tissues at least 10 days after caspase activation. This biosensor serves as an important tool to uncover the roles and molecular mechanisms of non-apoptotic caspase activity in live animals.

Es gibt zwei wichtige Komponenten , die CaspaseTracker erlauben, Caspase - Aktivität in normalen , gesunden Zellen (Abbildung 1a) zu erkennen. Die erste davon ist ein 146 Aminosäure-Caspase-spaltbare Polypeptid nach der Caspase modellierten Biosensor Apoliner (Abbildung 1b). 28 Das Polypeptid aus DIAP1 (Drosophila Inhibitor der Apoptose) abgeleitet ist , eine einzelne natürlich vorkommenden Caspase - Stelle enthält , die typischer...

Watch this Scientific Journal Video about In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila at JoVE.com

In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

Um gesunde Zellen in ganzen Tieren erkennen , die geringe Mengen an Caspase - Aktivität enthalten, die hochempfindliche Biosensor bezeichnet CaspaseTracker wurde für Drosophila erzeugt. Caspase-abhängigen Biosensor-Aktivität wird in langlebigen gesunden Zellen in den inneren Organen der erwachsenen Tiere aufgezogen unter optimierten Bedingungen in Abwesenheit von Tod Stimuli detektiert.

In - vivo - Biosensor - Spuren Non-apoptotischen Caspase - Aktivität in Drosophila

Caspases are the key mediators of apoptotic cell death via their proteolytic activity. When caspases are activated in cells to levels detectable by ...

in-vivo-biosensor-tracks-non-apoptotic-caspase-activity-in-drosophila

Research

JoVE Journal

Biology

In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

9.0K Aufrufe.  Johns Hopkins University Bloomberg School of Public Health.  Um gesunde Zellen in ganzen Tieren erkennen , die geringe Mengen an Caspase - Aktivität enthalten, die hochempfindliche Biosensor bezeichnet CaspaseTracker wurde für Drosophila erzeugt. Caspase-abhängigen Biosensor-Aktivität wird in langlebigen gesunden Zellen in den inneren Organen der erwachsenen Tiere aufgezogen unter optimierten Bedingungen in Abwesenheit von Tod Stimuli detektiert. 

Serie: In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

Lighting Up the Pathways to Caspase Activation Using Bimolecular Fluorescence Complementation

The caspase family of proteases play essential roles in apoptosis and innate immunity. Among these, a subgroup known as initiator caspases are the first to be activated in these pathways. This group includes caspase-2, -8, and -9, as well as the inflammatory caspases, caspase-1, -4, and -5. The initiator caspases are all activated by dimerization following recruitment to specific multiprotein complexes called activation platforms. Caspase Bimolecular Fluorescence Complementation (BiFC) is an imaging-based approach where split fluorescent proteins fused to initiator caspases are used to visualize the recruitment of initiator caspases to their activation platforms and the resulting induced proximity. This fluorescence provides a readout of one of the earliest steps required for initiator caspase activation. Using a number of different microscopy-based approaches, this technique can provide quantitative data on the efficiency of caspase activation on a population level as well as the kinetics of caspase activation and the size and number of caspase activating complexes on a per cell basis.

This protocol describes caspase Bimolecular Fluorescence Complementation (BiFC); an imaging-based method that can be used to visualize induced proximity of initiator caspases, which is the first step in their activation.

Die Wege zur Aktivierung der Caspase bimolekulare Fluoreszenz Ergänzung mit Beleuchtung

The caspase family of proteases play essential roles in apoptosis and innate immunity. Among these, a subgroup known as initiator caspases are the first ...

Forschung

Biochemie

Measuring Caspase Activity Using a Fluorometric Assay or Flow Cytometry

The activation of cysteine proteases, known as caspases, remains an important process in multiple forms of cell death. Caspases are critical initiators and executioners of apoptosis, the most studied form of programmed cell death. Apoptosis occurs during developmental processes and is a necessary event in tissue homeostasis. Pyroptosis is another form of cell death that utilizes caspases and is a critical process in activating the immune system through the activation of the inflammasome, which results in the release of members of the interleukin-1 (IL-1) family. To assess caspase activity, target substrates can be assessed. However, sensitivity can be an issue when examining single cells or low-level activity. We demonstrate how a fluorogenic substrate can be used with a population-based assay or single-cell assay by flow cytometry. With proper controls, different amino acid sequences can be used to identify which caspases are active. Using these assays, the simultaneous loss of the inhibitors of apoptosis proteins upon tumor necrosis factor (TNF) stimulation has been identified, which primarily induces apoptosis in macrophages rather than other forms of cell death.

The present protocol describes two methods to measure caspase activity through a fluorogenic substrate using flow cytometry or a spectrofluorometer.

Messung der Caspase-Aktivität mit einem fluorometrischen Assay oder einer Durchflusszytometrie

The activation of cysteine proteases, known as caspases, remains an important process in multiple forms of cell death. Caspases are critical initiators ...

Phagocytosis Assay for Apoptotic Cells in Drosophila Embryos

The molecular mechanisms underlying the phagocytosis of apoptotic cells need to be elucidated in more detail because of its role in immune and inflammatory intractable diseases. We herein developed an experimental method to investigate phagocytosis quantitatively using the fruit fly Drosophila, in which the gene network controlling engulfment reactions is evolutionally conserved from mammals. In order to accurately detect and count engulfing and un-engulfing phagocytes using whole animals, Drosophila embryos were homogenized to obtain dispersed cells including phagocytes and apoptotic cells. The use of dispersed embryonic cells enables us to measure in vivo phagocytosis levels as if we performed an in vitro phagocytosis assay in which it is possible to observe all phagocytes and apoptotic cells in whole embryos and precisely quantify the level of phagocytosis. We confirmed that this method reproduces those of previous studies that identified the genes required for the phagocytosis of apoptotic cells. This method allows the engulfment of dead cells to be analyzed, and when combined with the powerful genetics of Drosophila, will reveal the complex phagocytic reactions comprised of the migration, recognition, engulfment, and degradation of apoptotic cells by phagocytes.

Phagocytosis Assay for Apoptotic Cells in Drosophila Embryos

We herein describe a phagocytosis assay using the dispersed embryonic cells of Drosophila. It enables us to easily and precisely quantify in vivo phagocytosis levels, and to identify new molecules required for the phagocytosis of apoptotic cells.

Phagozytose - Assay für apoptotische Zellen in<em&gt; Drosophila</em&gt; Embryonen

The molecular mechanisms underlying the phagocytosis of apoptotic cells need to be elucidated in more detail because of its role in immune and ...

Immunologie und Infektion

Detecting Anastasis In Vivo by CaspaseTracker Biosensor

Anastasis (Greek for &#8220;rising to life&#8221;) is a recently discovered cell recovery phenomenon whereby dying cells can reverse late-stage cell death processes that are generally assumed to be intrinsically irreversible. Promoting anastasis could in principle rescue or preserve injured cells that are difficult to replace such as cardiomyocytes or neurons, thereby facilitating tissue recovery. Conversely, suppressing anastasis in cancer cells, undergoing apoptosis after anti-cancer therapies, may ensure cancer cell death and reduce the chances of recurrence. However, these studies have been hampered by the lack of tools for tracking the fate of cells that undergo anastasis in live animals. The challenge is to identify the cells that have reversed the cell death process despite their morphologically normal appearance after recovery. To overcome this difficulty, we have developed Drosophila and mammalian CaspaseTracker biosensor systems that can identify and permanently track the anastatic cells in vitro or in vivo. Here, we present in vivo protocols for the generation and use of the CaspaseTracker dual biosensor system to detect and track anastasis in Drosophila melanogaster after transient exposure to cell death stimuli. While conventional biosensors and protocols can label cells actively undergoing apoptotic cell death, the CaspaseTracker biosensor can permanently label cells that have recovered after caspase activation - a hallmark of late-stage apoptosis, and simultaneously identify active apoptotic processes. This biosensor can also track the recovery of the cells that attempted other forms of cell death that directly or indirectly involved caspase activity. Therefore, this protocol enables us to continuously track the fate of these cells and their progeny, facilitating future studies of the biological functions, molecular mechanisms, physiological and pathological consequences, and therapeutic implications of anastasis. We also discuss the appropriate controls to distinguish cells that undergo anastasis from those that display non-apoptotic caspase activity in vivo.

Detecting Anastasis In Vivo by CaspaseTracker Biosensor

Anastasis is technically challenging to detect in vivo because the cells that have reversed the cell death process can be morphologically indistinguishable from normal healthy cells. Here we describe protocols for detecting and tracking cells that undergo anastasis in live animals by using our newly developed in vivo CaspaseTracker biosensor system.

Erkennung von Anastasis In Vivo durch CaspaseTracker Biosensor

Anastasis (Greek for &#8220;rising to life&#8221;) is a recently discovered cell recovery phenomenon whereby dying cells can reverse late-stage cell death ...

Medizin

Long-term In Vivo Tracking of Inflammatory Cell Dynamics Within Drosophila Pupae

During the rapid inflammatory response to tissue damage, cells of the innate immune system are quickly recruited to the injury site. Once at the wound, innate immune cells perform a number of essential functions, such as fighting infection, clearing necrotic debris, and stimulating matrix deposition. In order to fully understand the diverse signaling events that regulate this immune response, it is crucial to observe the complex behaviors of (and interactions that occur between) multiple cell lineages in vivo, and in real-time, with the high spatio-temporal resolution. The optical translucency and the genetic tractability of Drosophila embryos have established Drosophila as an invaluable model to live-image and dissect fundamental aspects of inflammatory cell behavior, including mechanisms of developmental dispersal, clearance of apoptotic corpses&#160;and/or microbial pathogens, and recruitment to wounds. However, more recent work has now demonstrated that employing a much later stage in the Drosophila lifecycle &#8211; the Drosophila pupa &#8211; offers a number of distinct advantages, including improved RNAi efficiency, longer imaging periods, and significantly greater immune cell numbers. Here we describe a protocol for imaging wound repair and the associated inflammatory response at the high spatio-temporal resolution in live Drosophila pupae. To follow the dynamics of both re-epithelialization and inflammation, we use a number of specific in vivo fluorescent markers for both the epithelium and innate immune cells. We also demonstrate the effectiveness of photo-convertible fluorophores, such as Kaede, for following the specific immune cell subsets, to track their behavior as they migrate to, and resolve from, the injury site.

Long-term In Vivo Tracking of Inflammatory Cell Dynamics Within Drosophila Pupae

Here we present a protocol for live-imaging wound repair and the associated inflammatory response at high spatio-temporal resolution in vivo. This method utilizes the pupal stage of Drosophila development to enable long-term imaging and tracking of specific cell populations over time and is compatible with efficient RNAi-mediated gene inactivation.

Langfristig In Vivo Verfolgung von entzündlichen Zelldynamik in Drosophila Puppen

During the rapid inflammatory response to tissue damage, cells of the innate immune system are quickly recruited to the injury site. Once at the wound, ...

In Vivo Single-Molecule Tracking at the Drosophila Presynaptic Motor Nerve Terminal

An increasing number of super-resolution microscopy techniques are helping to uncover the mechanisms that govern the nanoscale cellular world. Single-molecule imaging is gaining momentum as it provides exceptional access to the visualization of individual molecules in living cells. Here, we describe a technique that we developed to perform single-particle tracking photo-activated localization microscopy (sptPALM) in Drosophila larvae. Synaptic communication relies on key presynaptic proteins that act by docking, priming, and promoting the fusion of neurotransmitter-containing vesicles with the plasma membrane. A range of protein-protein and protein-lipid interactions tightly regulates these processes and the presynaptic proteins therefore exhibit changes in mobility associated with each of these key events. Investigating how mobility of these proteins correlates with their physiological function in an intact live animal is essential to understanding their precise mechanism of action. Extracting protein mobility with high resolution in vivo requires overcoming limitations such as optical transparency, accessibility, and penetration depth. We describe how photoconvertible fluorescent proteins tagged to the presynaptic protein Syntaxin-1A can be visualized via slight oblique illumination and tracked at the motor nerve terminal or along the motor neuron axon of the third instar Drosophila larva.

In Vivo Single-Molecule Tracking at the Drosophila Presynaptic Motor Nerve Terminal

Here we illustrate how single molecule photo-activated localization microscopy can be carried out on the motor nerve terminal of a live Drosophila melanogaster third instar larva.

In Vivo Einzelmolekül-Tracking bei Drosophila präsynaptischen motorischen Nerv Terminal

An increasing number of super-resolution microscopy techniques are helping to uncover the mechanisms that govern the nanoscale cellular world. ...

Neurowissenschaften

Live Imaging of Apoptotic Cell Clearance during Drosophila Embryogenesis

The proper elimination of unwanted or aberrant cells through apoptosis and subsequent phagocytosis (apoptotic cell clearance) is crucial for normal development in all metazoan organisms. Apoptotic cell clearance is a highly dynamic process intimately associated with cell death; unengulfed apoptotic cells are barely seen in vivo under normal conditions. In order to understand the different steps of apoptotic cell clearance and to compare 'professional' phagocytes - macrophages and dendritic cells to 'non-professional' - tissue-resident neighboring cells, in vivo live imaging of the process is extremely valuable. Here we describe a protocol for studying apoptotic cell clearance in live Drosophila embryos. To follow the dynamics of different steps in phagocytosis we use specific markers for apoptotic cells and phagocytes. In addition, we can monitor two phagocyte systems in parallel: 'professional' macrophages and 'semi-professional' glia in the developing central nervous system (CNS). The method described here employs the Drosophila embryo as an excellent model for real time studies of apoptotic cell clearance.

Live Imaging of Apoptotic Cell Clearance during Drosophila Embryogenesis

Here we describe an effective method for studying dynamics of apoptotic cell clearance in vivo. This method employs live Drosophila embryos as a powerful model for monitoring phagocytosis of apoptotic cells using specific labeling of apoptotic cells and phagocytes.

Live-Imaging von apoptotischen Ausverkauf während<em&gt; Drosophila</em&gt; Embryogenese

The  proper elimination of unwanted or aberrant cells through apoptosis and  subsequent phagocytosis (apoptotic cell clearance) is crucial for normal  ...

Biologie

In Vitro Cleavage Assays using Purified Recombinant Drosophila Caspases for Substrate Screening

Caspases are very specific cell death proteases that are involved in apoptotic and non-apoptotic processes. While the role of caspases during apoptosis has been very well defined and many apoptotic proteolytic substrates of caspases have been identified and characterized, the role of caspases for non-apoptotic processes is not well understood. In particular, few non-apoptotic substrates of caspases have been identified thus far. Here, in order to facilitate the identification and characterization of potential caspase substrates, a protocol that allows the testing of candidate substrates in caspase cleavage assays in vitro is described. This protocol includes the production and purification of recombinant caspase proteins, the production of the candidate substrates either recombinantly or in a cell-free expression system, and the actual in vitro cleavage reaction followed by SDS-PAGE and immunoblotting. This protocol is tailored for the Drosophila caspases Dronc and Drice but can easily be adapted for caspases from other organisms, including mammals.

In Vitro Cleavage Assays using Purified Recombinant Drosophila Caspases for Substrate Screening

Here we present a protocol to express and purify recombinant Drosophila caspases Dronc and Drice, and their use in in vitro cleavage assays.

In vitro Spaltungstests mit gereinigten rekombinanten Drosophila-Caspasen für das Substrat-Screening

Caspases are very specific cell death proteases that are involved in apoptotic and non-apoptotic processes. While the role of caspases during apoptosis ...

Biotechnik

Visualization of Inflammatory Caspases Induced Proximity in Human Monocyte-Derived Macrophages

Inflammatory caspases include caspase-1, -4, -5, -11, and -12 and belong to the subgroup of initiator caspases. Caspase-1 is required to ensure correct regulation of inflammatory signaling and is activated by proximity-induced dimerization following recruitment to inflammasomes. Caspase-1 is abundant in the monocytic cell lineage and induces maturation of the pro-inflammatory cytokines interleukin (IL)-1&#946; and IL-18 to active secreted molecules. The other inflammatory caspases, caspase-4 and -5 (and their murine homolog caspase-11) promote IL-1&#946; release by inducing pyroptosis. Caspase Bimolecular Fluorescence Complementation (BiFC) is a tool used to measure inflammatory caspase induced proximity as a readout of caspase activation. The caspase-1, -4, or -5 prodomain, which contains the region that binds to the inflammasome, is fused to non-fluorescent fragments of the yellow fluorescent protein Venus (Venus-N [VN] or Venus-C [VC]) that associate to reform the fluorescent Venus complex when the caspases undergo induced proximity. This protocol describes how to introduce these reporters into primary human monocyte-derived macrophages (MDM) using nucleofection, treat the cells to induce inflammatory caspase activation, and measure caspase activation using fluorescence and confocal microscopy. The advantage of this approach is that it can be used to identify the components, requirements, and localization of the inflammatory caspase activation complex in living cells. However, careful controls need to be considered to avoid compromising cell viability and behavior. This technique is a powerful tool for the analysis of dynamic caspase interactions at the inflammasome level as well as for the interrogation of the inflammatory signaling cascades in living MDM and monocytes derived from human blood samples.

This protocol describes the workflow to obtain monocytes-derived macrophages (MDM) from human blood samples, a simple method to efficiently introduce inflammatory caspase Bimolecular Fluorescence Complementation (BiFC) reporters into human MDM without compromising cell viability and behavior, and an imaging-based approach to measure inflammatory caspase activation in living cells.

Visualisierung von entzündlichen Kaspasen induzierter Nähe in humanen Monozyten-abgeleiteten Makrophagen

Inflammatory caspases include caspase-1, -4, -5, -11, and -12 and belong to the subgroup of initiator caspases. Caspase-1 is required to ensure correct ...

Strategies for Tracking Anastasis, A Cell Survival Phenomenon that Reverses Apoptosis

Anastasis (Greek for &#8220;rising to life&#8221;) refers to the recovery of dying cells. Before these cells recover, they have passed through important checkpoints of apoptosis, including mitochondrial fragmentation, release of mitochondrial cytochrome c into the cytosol, activation of caspases, chromatin condensation, DNA damage, nuclear fragmentation, plasma membrane blebbing, cell shrinkage, cell surface exposure of phosphatidylserine, and formation of apoptotic bodies. Anastasis can occur when apoptotic stimuli are removed prior to death, thereby allowing dying cells to reverse apoptosis and potentially other death mechanisms. Therefore, anastasis appears to involve physiological healing processes that could also sustain damaged cells inappropriately. The functions and mechanisms of anastasis are still unclear, hampered in part by the limited tools for detecting past events after the recovery of apparently healthy cells. Strategies to detect anastasis will enable studies of the physiological mechanisms, the hazards of undead cells in disease pathology, and potential therapeutics to modulate anastasis. Here, we describe effective strategies using live cell microscopy and a mammalian caspase biosensor&#160;for identifying and tracking anastasis in mammalian cells.

The term anastasis refers to the phenomenon in which dying cells reverse a cell suicide process at a late stage, repair themselves, and ultimately survive. Here we demonstrate protocols for detecting and tracking cells that undergo anastasis.

Strategien für die Spurhaltung Anastasis, einer Zelle Überleben Phänomen, das Apoptose Kehrt

Anastasis (Greek for &#8220;rising to life&#8221;) refers to the recovery of dying cells. Before these cells recover, they have passed through important ...

In - vivo - Biosensor - Spuren Non-apoptotischen Caspase - Aktivität in Drosophila

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video