Name: in vivo biosensor tracks non-apoptotic caspase activity in drosophila
Uploaded: 2016-11-27T13:00:00.000+00:00
Duration: 13 min 21 s
Description: Watch this Scientific Journal Video about In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila at JoVE.com

우리는도 초파리 그림에 대한 Polan 산토스와 대런 Obbard 감사합니다. (2A), 마르셀로 제이콥스 - 로레나 JHMRI의 insectary의 사용. 이 작품은 생명 과학 연구 재단의 교제 (HLT)에 의해 지원되었다, 대학 보조금위원회 홍콩 광역 / B-07 / 99 (MCF), 그리고 NIH가 NS096677, NS037402 및 NS083373 (JMH)를 부여합니다. 호 램 당나라는 생명 과학 연구 재단의 Shurl와 케이 쿠 르치 재단 연구원이다.

CaspaseTracker의 파리 1. 준비 <ol><li> 이 크로스를 수행 CaspaseTracker (DQVD)를 제조 실험을 위해 파리하려면 7-10 처녀 여성을 전송 (또는 남자), UBI-CaspaseTracker는 G-TRACE (유비가&gt; 중지&gt; GFP-NLS; UAS-FLP UAS-RFP를) × 카스파 바이오 센서 기판 mCD8-DIAP1-GAL4를 운반하는 남성 (또는 여성)의 동일한 번호로 유비퀴틴 프로모터 (35) 함께하여 G-의 동형 접합 조합의 치사율을 피하기 위해 두 번째 염색체 CYO 분산이 G-TRACE 파리를 중심 날아 TRACE (UAS-RFP, UAS-FLP, 그리고 유비는&gt; 중지&gt; GFP-NLS) 34. 장소는 단백질 소스로 신선한 효모 페이스트와 신선한 식품 유리 병에 날아간 다. </li><li> 5 ~ 7 일 (최대 이주)을 위해 18 ° C에서 파일을 품어 후 부모가 새로운 자손과 과밀 방지하기 위해, 새로운 사육 병을 설정 유리 병에서 파리 제거합니다. </li><li> 자손이 eclose 파리까지 18 ° C에서 배양을 계속합니다. 비 CYO을 선택 [비 다CaspaseTracker 및 G-TRACE 요소 (35)에 대한 형질 전환됩니다 CaspaseTracker의 정확한 유전자형의 urly 날개] 자손. </li><li> 동시에, 특정 CaspaseTracker의 RFP 및 GFP의 형광을 확인하기 위해 컨트롤 부모의 비 형질 전환 w118 파리와 카스파를 구분 (DQVA)를 병렬로 날아 생성합니다. </li><li> 프라이머를 사용하여 CaspaseTracker와 파일을 확인하기 위해 PCR의 유전자형을 수행합니다 : 5&#39;-TCCCCCGGGCTGCAGGAATTC, 3&#39;-TGGAATTGGGGTACGTCTAGA을하는 3897 bp의 제품을 생산. G-추적 궤적을 유전형를 들어, GFP (474 ​​BP)에 대해 다음 프라이머를 사용, 5&#39;-CAC GAC TTC TTC AAG TCC GCC ATG CCC G, 3&#39;-CTT GTA CAG CTC의 GTC의 CAT GCC GAG AGT GAT C; RFP (258 BP)에 대한, 5&#39;-GGC TGC TTC ATC TAC AAG GTG AAG TTC ATC GG, 3&#39;-GAT GTC CAG CTT GGA GTC CAC GTA GTA GTA GC; 및 Flpase (655 BP), 5&#39;- CCACCTAAGGTGCTTGTTCGTCAGTTTGTGG에 대한 3&#39;-GCC TAC TAA CGC TTG TCT TTG TCT CTG TCA C를 pUWR 벡터의 유전자형 GAL4 (554 BP), 5&#39;-GAA GCA CAC CTT CGC ATC의 GCT의 경우 CAGTCA CGC, 3&#39;-TGG AAT TGG GGT ACG TCT의 AGA. </li></ol> 2. 조직 준비, 염색 및 장착 <ol><li> 플라이 해부를 들어, 물에 용해 1 % 소 혈청 알부민 플라스틱 피펫 팁과 원심 분리기 튜브, 코트 팁 및 튜브 (BSA)에 달라 붙는 해부 조직을 방지 할 수 있습니다. </li><li> 해부는 집게를 사용하여 실리콘 쿠션에 날아갑니다. <ol><li> 조직의 절개를 수행 할 때 딱딱한 표면에 집게의 끝 손상을 방지하기 위해, 실리콘 표면에 절개를 수행합니다. 실리콘 해부 판을 들어, 제조업체 지침 (자료 목록)에 따라 상업 키트에 실리콘을 용융. 실리콘을 용융 한 후, 60mm 직경의 조직 배양 접시에 3 ~ 4 mL를 넣어. 실리콘 요리를 재사용 할 수 있습니다. </li><li> CO 2 플라이를 마취하고, 차가운 PBS 1 ml로 실리콘 플레이트에 옮긴다. 블로우 건을 이용하여 플라이를 함유하는 바이알에 이산화탄소를 도입하고 마취 플라이 t 전송할공동 2 공급 장치가 OA 패드. </li><li> 머리와 foregut 사이의 연결을 손상시키지 않고 덮고 몸에서 플라이 헤드를 분리 반대 방향으로 가슴을 끌어 플라이 머리를 잡아 포셉 한 쌍의와 집게의 두 번째 쌍을 사용합니다. </li><li> 흉부에서 날개와 다리를 제거하기 위해 집게 2 쌍을 사용합니다. </li><li> 흉부를 잡아 포셉 한 쌍을 사용하고 포셉의 다른 쌍은 foregut과 중장 사이의 연결을 손상시키지 않고 다시 가슴에서 분리하기 위해 복부를 당겨. </li><li> 이전에 입증 된 바와 같이 뇌, 창자, malpighian 세관 및 난소를 포함한 내부 장기를 해부하다. 39 ~ 41을 </li><li> 이 조직은 강한 형광도를 생산으로 집게로 표피의 모든 조각과 지방의 몸을 제거합니다. 인내와 연습과 같이 전체 기관의 시스템을 준비해야합니다. </li></ol></li><li> 1.5 ML의 원심 분리기 튜브에 해부 조직을 전송하고, 조직의 위스콘신 해결어둠 속에서 20 회전 30 분 동안 실온에서 PBS 중 4 % 파라 포름 알데히드 0.5 ㎖ (인산염 완충 식염수) 번째 조직에서 표백 RFP 및 GFP를 방지한다. 이후의 염색 결과를 손상시킬 수 장시간 고정을하지 마십시오. </li><li> 부드러운 피펫 팅하여 파라 포름 알데히드를 제거하고 실온에서 0.5 mL를 PBST (PBS + 0.1 % 트리톤 X-100)로 3 회 세척한다. </li><li> 부드러운 흔들림과 함께 밤새 4 ° C에서 0.5 mL의 PBST로 조직을 Permeabilize 하시려면. 짧은 배양이 완료되지 permeabilization과 타협 염색 결과가 발생할 수 있습니다. <ol><li> 그것은 배경의 얼룩을 감소시킬 필요가있는 경우, 대신 PBS 중 1 % BSA와 0.5 mL를 PBST로 조직 배양 고려한다. </li></ol></li><li> 0.5 mL의 PBST로 조직을 3 회 반복한다. </li><li> , 핵 및 사상 굴지 (F-액틴)를 얼룩 / mL의 훽스트의 33342 블루 핵 염료 및 0.3 μm의 알렉사 플 루어 633 Phalloidin의 F - 굴지 얼룩 10 μg의 0.5 mL의 PBST을 적용하고 실온에서 1 시간 w를위한 조직과 동시에 부화하기어둠 속에서 i 번째 부드러운 회전. 이 배경을 증가하므로 장시간 염색을 피하십시오. <ol><li> 면역 염색의 경우와 조직을 고정 투과성이 품어 0.1 % 트리톤 X-100, 0.5 mL의 PBS에서 밤새 4 ° C, 1 얼룩에 : 안티 - ELAV 항체 또는 1 100 희석 방지 카스파 제 -3의 200 희석 밤새 4 °의 C (300 μL). (100) 및 실온에서 1 ~ 3 시간 동안 배양 : 1 희석 해당하는 이차 항체에 의해 수행합니다. 특정 항체 정보 자료 목록을 참조하십시오. </li></ol></li><li> 부드러운 회전에 0.5 mL의 PBST에서 5 분 동안 조직 3 회, 각각을 씻으십시오. </li><li> 피펫으로, 모든 PBST를 제거하고 완전히 하룻밤 실온에서 1-3 시간 또는 4 ° C에 대한 조직을 충당하기 위해 (자료 참조) 200 μL 방지 표백제 장착 에이전트를 추가 할 수 있습니다. 완전히 부착 제를 흡수 한 최적의 조직이 튜브 바닥에 가라 앉을 것이다. </li><li> 사전 깨끗한 물 또는 70 % 에탄올로 유리 슬라이드를하고 GLAS에 에이전트를 설치하여 조직을 전송의 슬라이드. </li><li> 조심스럽게 조직 위에 유리 커버 슬립을 배치합니다. 유리 슬라이드와 overcompression하여 조직을 파괴하지 않도록 커버 슬립에 바셀린을 적용합니다. 휴지와 추가 장착 에이전트를 제거합니다. </li><li> 조직에서 에이전트를 실장 누설을 방지하기 위해 모든 커버 슬립의 가장자리 매니큐어를 적용하여 커버 슬립을 밀봉. </li></ol> 3. 공 초점 현미경 <ol><li> 반전 된 공 초점 에피 형광 현미경을 사용합니다. 그러나, 최대 현미경 바로 사용할 수도있다. 타일링을 이용하여 화상 조직에 의한 부품의 열팽창 및 수축에 초점 XY 평면의 시프트의 편차를 방지하는 안정 실온을 유지한다. 환경 제어 시스템과 포커스 드리프트 보정 시스템 인해 현미경 시스템의 열 평형이 손실이 문제를 방지하는 것을 돕는다. </li><li> 현미경의 무대에 슬라이드를 놓습니다. 낮은 해상도로 여러 시험 화상을 (125 X 125 픽셀)을이자 (ROI)의 전체 영역을 커버하는 데 필요한 타일의 적절한 수를 결정할 거라고. </li><li> 스캔 해상도 등의 500 X 500 픽셀의 이미지를 캡처하는 현미경 검사 시스템을 설정한다. 이미지 (타일)의 각각은 모든면에서 20 % 정도 겹치도록, 같은 20X NA 0.8 커버 글라스를 통해 조직을 분석하기위한 63X NA 1.4 계획 - 고차 색지움 목표로 목표를 선택합니다. </li><li> 긴 파장의 빛이 낮은 사진 표백 원인으로, 여기 파장을 최단하기 위해 긴에서 이미지 순서를 설정합니다. 여기 파장을 최단하는 최장의 순서는 (ⅰ) Phalloidin의 F 액틴 및 활성 카스파 항체 633 nm의 RFP 대 (II) 561 nm의 GFP에 대한 (Ⅲ) 488 nm의, 그리고 (ⅳ) 405 nm의 대 훽스트 핵 얼룩. </li><li> 촬상 동안 조직의 고품질 화상을 얻을 수있는 레이저 강도를 감소시킴으로써 포토 블리 칭을 방지 프로세스를 영상화하는 동안 형광 레이저 여기에 세포의 노출을 최소화한다. </li><li> 전 후마법사 현미경 소프트웨어를 사용하여 이미지를 병합 수집된다. </li></ol>

The authors have nothing to disclose.

여기에서 우리는 건강한 조직에서 광범위한 기초 카스파 활동의 검출을 용이하게 CaspaseTracker의 건설 및 내부 동작을 보여줍니다. 생체 내에서 비 - 아폽토시스 카스파 제 활성을 검출하기위한 중요한 단계는 1) 2) 적절한 컨트롤 카스파 특정 리포터 기능 검증 3) 박리 기술을 실시하는 것은 성인 초파리의 모든 내부 기관계를 관찰하여, 상기 바이오 센서 트랜스와 파리 생성 autofluorescen...

카스파는 키 아스 파르 테이트 잔류 후 많은 세포 내 단백질을 절단하여 사멸 세포 사멸을 매개 시스테인 프로테아제이다. 예를 들어, 개시제 카스파는 효과기 카스파, derepress DNA의 뉴 클레아 제, 쪼개짐 세포 골격 성분을 활성화하고 신속하게 세포를 분해하고, 셀 시체 처리 인접 셀하여 인식 말림을 자극하는 세포막의 지질 조성 변화. 1-4 이것은 추정 세포의 수십억 인간의 몸에서 하루에 사망하고, 세포 사멸 화학 요법에 의한 종양 세포 사멸의 중요한 메커니즘이다. 5 카스파의 다른 세트는 선천성 면역을 자극하는 독특한 비 세포 사멸 과정에 의해 세포 사멸의 원인이 될 수 있습니다. (6) 따라서, 카스파 대부분의 연구는 직업 죽음의 기능에 초점을 맞추고있다. 흥미롭게도, 현장에서 초기 증거 홍보 세포 죽음에 책임이있는 같은 카스파도 아닌 죽음의 F를 밝혀unctions. 선구적인 연구는 카스파는 배아 동안 세포 증식 및 이동의 규제를 포함하여 건강한 세포에서 다양한 세포 기능에 관여하고 있음을 증명하고있다. 7-9 카스파가 다른 necroptotic 세포 사멸 경로를 차단, 초파리 10, 11에 spermatid 개별화 필요 마우스 (12, 13), 그리고 마이크로 RNA 프로세싱에 C. 간스. 14, 15 아마도에서 가장 오래 살았다 세포, 신경 세포, 카스파 및 기타 세포 사멸 기계가 시냅스 엔딩을 치기에 의해 신경 세포 활동의 조절에 관여하는, 생각하는 과정은 학습과 기억에 대한 다른 시냅스를 강화하는 것이 중요합니다. 16 18 카스파가 전체 세포 죽음없이 작은 신경 돌기의 미니 고사의 유형에 의해 시냅스 가지 치기를 촉진하는 것이 가능하다. (19) 그러나, 카스파는 세포 사멸과 같은 이벤트에 관련이없는 다른 기능을 가질 수있다. (20, 21) 이중 역할삶과 죽음에들 카스파에 고유하지 않습니다; 증명되지 않았지만 BCL-2 패밀리 단백질, 시토크롬 C는 건강한 세포의 세포 에너지 분야에서 역할을 가질뿐만 아니라, 세포 스트레스의 많은 유형에 의해 활성화되는 코어 사멸 경로의 일부이다. 22-25, 그것은 진화 일 연결된 것으로 논리적 보인다 부적합 또는 바람직하지 않은 세포의 적시 제거를 위해 동일한 분자 내 죽음 작업에 -jobs. 현재, 비 - 아폽토시스 카스파 제 활성의 분자 메커니즘 이해되지 않으며, 배아 발달 동안 성인 조직에서 비 - 아폽토시스 카스파 제 활성의 정도는 알려져 있지 않다. 주요 과제는 카스파의 죽음 작업에서 매일 작업을 구별에 어려움이다. 카스파 제 활성은 단백질 분해 케스케이드 의해 증폭되고 세포 자멸사 및 pyroptosis, 대조적으로, 카스파의 하루 작업은 많은 가능한 TECHN하여 검출 가능성이 아래 효소 활성의 훨씬 낮은 레벨을 발생 예상ologies. 여기에 제시된 작업 이전에, 나머지는 다른 목적을 위해 카스파 다양한 바이오 센서를 개발했다. SCAT 바이오 센서 (예를 들어, ECFP - DEVD - 금성) 빠르게 FRET를 사용하여 배양 세포 및 동물 조직에서 실시간 카스파 활동을 감지합니다. (26, 27)를 카스파 제 절단시, Apoliner (mCD8-RFP-DQVD-의 핵 타겟 GFP 부분 nucGFP)는 자사의 플라즈마 막 밧줄이 카스파에 의해 절단되는 분 이내에 세포 내 relocalization을 겪는다. (28) 마찬가지로, ApoAlert - pCaspase3 - 센서 (NES-DEVD-YFP-NLS)는 카스파 제 절단시 핵 세포질에서 relocalizes. 29, 30을 더 최근 iCasper의 발색단은 세라 초파리 배아 뉴런 실시간 바이오 활성의 검출을 허용, 카스파 제에 의해 분해되지만, 주로 발달 세포 죽음과 연관 될 때 형광을 위해 설계되었다. 후각 뉴런 31 카스파 따라 사망했다 노화 동안에 demonstCPV 바이오 센서 (예를 들어, mCD8-PARP-비너스)의 카스파 제 절단 형태의 면역 검출에 의해 평가. (32, 33) 중요한 것은, 카스파 제 -3의 활성화 된 형태의 척추에 민감한 발현 사이 세포 죽음의 부재에서 발견 된 배양 뉴런 및 소마 핵 CellEvent 리포터 염료의 카스파 종속 형광을 사용하지만, 세포 사멸은 척추 제거 이후까지 지연되었지만 어려움으로 인해 광 독성 발생 하였다 인치 (19)은 따라서 새로운 카스파 바이오 센서가 감지 할 필요 및 생체 내에서 기저 카스파 제 활성을 갖는 세포를 추적. 이러한 어려움을 극복하기 위해, 우리는 CaspaseTracker 지정된 신규 이중 색상 카스파 바이오 센서를 생성. 이 전략은 영구적 라벨 및 생체 내에서 세포를 추적 초파리 G-TRACE FRT 재조합 효소 시스템 (34)과 초파리 카스파 Apoliner 민감한 바이오 센서 (28)의 수정 된 버전을 결합한다. &lt;SUP&gt; 35 GAL4 활성화 된 G-TRACE 시스템. 카스파의 매우 낮은 수준의 적 카스파 활동을 경험 한 모든 세포의 세포질과 영구적 인 핵 타겟 GFP 발현에 RFP 발현의 결과로, CaspaseTracker 활성화 할 수 있습니다 (35)이 시스템은 레이블을 지정할 수 있습니다 초파리 melanogaster의, 카스파 제 및 세포 사멸 연구에 대한 취급 용이하고 널리 사용되는 모델 시스템을 사용하여 전체 동물의 일생 동안 세포. 36-38

<table><tbody><tr><td colspan="4">&lt;strong&gt;Consumables and Reagents&lt;/strong&gt;</td></tr><tr><td>Vectashield</td><td>Vector Products</td><td>H-1000</td><td>Mounting medium</td></tr><tr><td>Forceps</td><td>Ted Pella</td><td>#505 (110mm, #5)</td><td>Dumont tweezer biology grade, stainless steel</td></tr><tr><td>Hanging Drop Slides</td><td>Fisher Scientific</td><td>12-565B</td><td>Glass slides</td></tr><tr><td>Hoechst 33342</td><td>Molecular Probes</td><td>H1399</td><td>DNA stain</td></tr><tr><td>Alexa Fluor 633 Phalloidin</td><td>Molecular Probes</td><td>A22284</td><td>Actin stain</td></tr><tr><td>Rat-Elav-7E8A10 anti-elav antibody</td><td>Developmental Studies Hybridoma Bank (DSHB)</td><td>Antibody Registry ID:&amp;nbsp; AB_528218&amp;nbsp;</td><td>Stain for Drosophla pan-neuronal ELAV</td></tr><tr><td>Cleaved caspase-3 (Asp175) antibody</td><td>Cell Signaling Technology</td><td>#9661</td><td>Stain for active fragment of caspase-3</td></tr><tr><td>ProLong Gold antifade reagent</td><td>Life Technologies</td><td>P36934</td><td>to preserve fluorophores&amp;nbsp;</td></tr><tr><td>ProLong Diamond Antifade Mountant</td><td>Life Technologies</td><td>P36961</td><td>to preserve fluorophores&amp;nbsp;</td></tr><tr><td>SylGard 182 Silicone Elastomer Kit</td><td>Dow Corning&amp;nbsp;</td><td>Product code: 0001023934</td><td>for dissection plates</td></tr><tr><td colspan="4">&lt;strong&gt;Equipment&lt;/strong&gt;</td></tr><tr><td>LSM780 confocal microscope</td><td>Carl Zeiss</td><td>N/A</td><td>Imaging</td></tr><tr><td>Carl Zeiss Stereomicroscope Stemi 2000</td><td>Carl Zeiss</td><td>N/A</td><td>&lt;em&gt;Drosophila&lt;/em&gt; dissection</td></tr><tr><td>AmScope Fiber Optic Dual Gooseneck Microscope Illuminator, 150&amp;nbsp;W</td><td>AmScope</td><td>WBM99316</td><td>Light source</td></tr></tbody></table>

in vivo biosensor tracks non-apoptotic caspase activity in drosophila

Caspases are the key mediators of apoptotic cell death via their proteolytic activity. When caspases are activated in cells to levels detectable by available technologies, apoptosis is generally assumed to occur shortly thereafter. Caspases can cleave many functional and structural components to cause rapid and complete cell destruction within a few minutes. However, accumulating evidence indicates that in normal healthy cells the same caspases have other functions, presumably at lower enzymatic levels. Studies of non-apoptotic caspase activity have been hampered by difficulties with detecting low levels of caspase activity and with tracking ultimate cell fate in vivo. Here, we illustrate the use of an ultrasensitive caspase reporter, CaspaseTracker, which permanently labels cells that have experienced caspase activity in whole animals. This in vivo dual color CaspaseTracker biosensor for Drosophila melanogaster transiently expresses red fluorescent protein (RFP) to indicate recent or on-going caspase activity, and permanently expresses green fluorescent protein (GFP) in cells that have experienced caspase activity at any time in the past yet did not die. Importantly, this caspase-dependent in vivo biosensor readily reveals the presence of non-apoptotic caspase activity in the tissues of organ systems throughout the adult fly. This is demonstrated using whole mount dissections of individual flies to detect biosensor activity in healthy cells throughout the brain, gut, malpighian tubules, cardia, ovary ducts and other tissues. CaspaseTracker detects non-apoptotic caspase activity in long-lived cells, as biosensor activity is detected in adult neurons and in other tissues at least 10 days after caspase activation. This biosensor serves as an important tool to uncover the roles and molecular mechanisms of non-apoptotic caspase activity in live animals.

CaspaseTracker 정상적인 건강한 세포 (그림 1a)에서 카스파 제의 활동을 감지 할 수 있도록 두 가지 주요 구성 요소가 있습니다. 이들 중 첫 번째는 카스파 바이오 Apoliner (도 1b) 본뜬 146 아미노산 카스파 절단 폴리펩티드이다. 이러한 폴리펩티드는 일반적으로 아폽토시스 동안 절단되는 단일 천연 카스파 부위를 포함 DIAP1 (아폽토시스 초파리 억제?...

Watch this Scientific Journal Video about In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila at JoVE.com

In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

카스파 제 활성의 낮은 농도를 포함하는 전체 동물의 건강한 세포를 검출하기 위해, CaspaseTracker 지정된 고감도 바이오 센서 초파리에 대해 생성 하였다. 카스파 따라 바이오 활성 데스 자극의 부재 하에서 최적 조건 하에서 사육 성인 동물의 내부 장기에 걸쳐 긴 수명이 건강한 세포에서 검출된다.

생체 내에서 바이오 센서는 초파리에서 비 세포 사멸 카스파 활동을 추적

Caspases are the key mediators of apoptotic cell death via their proteolytic activity. When caspases are activated in cells to levels detectable by ...

in-vivo-biosensor-tracks-non-apoptotic-caspase-activity-in-drosophila

Research

JoVE Journal

Biology

In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

9.0K 조회수.  Johns Hopkins University Bloomberg School of Public Health.  카스파 제 활성의 낮은 농도를 포함하는 전체 동물의 건강한 세포를 검출하기 위해, CaspaseTracker 지정된 고감도 바이오 센서 초파리에 대해 생성 하였다. 카스파 따라 바이오 활성 데스 자극의 부재 하에서 최적 조건 하에서 사육 성인 동물의 내부 장기에 걸쳐 긴 수명이 건강한 세포에서 검출된다. 

비디오: In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

Lighting Up the Pathways to Caspase Activation Using Bimolecular Fluorescence Complementation

The caspase family of proteases play essential roles in apoptosis and innate immunity. Among these, a subgroup known as initiator caspases are the first to be activated in these pathways. This group includes caspase-2, -8, and -9, as well as the inflammatory caspases, caspase-1, -4, and -5. The initiator caspases are all activated by dimerization following recruitment to specific multiprotein complexes called activation platforms. Caspase Bimolecular Fluorescence Complementation (BiFC) is an imaging-based approach where split fluorescent proteins fused to initiator caspases are used to visualize the recruitment of initiator caspases to their activation platforms and the resulting induced proximity. This fluorescence provides a readout of one of the earliest steps required for initiator caspase activation. Using a number of different microscopy-based approaches, this technique can provide quantitative data on the efficiency of caspase activation on a population level as well as the kinetics of caspase activation and the size and number of caspase activating complexes on a per cell basis.

This protocol describes caspase Bimolecular Fluorescence Complementation (BiFC); an imaging-based method that can be used to visualize induced proximity of initiator caspases, which is the first step in their activation.

Caspase 활성화 분자 형광 보완성을 사용 하 여 경로를 조명

The caspase family of proteases play essential roles in apoptosis and innate immunity. Among these, a subgroup known as initiator caspases are the first ...

연구

생화학

Measuring Caspase Activity Using a Fluorometric Assay or Flow Cytometry

The activation of cysteine proteases, known as caspases, remains an important process in multiple forms of cell death. Caspases are critical initiators and executioners of apoptosis, the most studied form of programmed cell death. Apoptosis occurs during developmental processes and is a necessary event in tissue homeostasis. Pyroptosis is another form of cell death that utilizes caspases and is a critical process in activating the immune system through the activation of the inflammasome, which results in the release of members of the interleukin-1 (IL-1) family. To assess caspase activity, target substrates can be assessed. However, sensitivity can be an issue when examining single cells or low-level activity. We demonstrate how a fluorogenic substrate can be used with a population-based assay or single-cell assay by flow cytometry. With proper controls, different amino acid sequences can be used to identify which caspases are active. Using these assays, the simultaneous loss of the inhibitors of apoptosis proteins upon tumor necrosis factor (TNF) stimulation has been identified, which primarily induces apoptosis in macrophages rather than other forms of cell death.

The present protocol describes two methods to measure caspase activity through a fluorogenic substrate using flow cytometry or a spectrofluorometer.

형광 분석 또는 유세포분석을 사용한 카스파제 활성 측정

The activation of cysteine proteases, known as caspases, remains an important process in multiple forms of cell death. Caspases are critical initiators ...

Phagocytosis Assay for Apoptotic Cells in Drosophila Embryos

The molecular mechanisms underlying the phagocytosis of apoptotic cells need to be elucidated in more detail because of its role in immune and inflammatory intractable diseases. We herein developed an experimental method to investigate phagocytosis quantitatively using the fruit fly Drosophila, in which the gene network controlling engulfment reactions is evolutionally conserved from mammals. In order to accurately detect and count engulfing and un-engulfing phagocytes using whole animals, Drosophila embryos were homogenized to obtain dispersed cells including phagocytes and apoptotic cells. The use of dispersed embryonic cells enables us to measure in vivo phagocytosis levels as if we performed an in vitro phagocytosis assay in which it is possible to observe all phagocytes and apoptotic cells in whole embryos and precisely quantify the level of phagocytosis. We confirmed that this method reproduces those of previous studies that identified the genes required for the phagocytosis of apoptotic cells. This method allows the engulfment of dead cells to be analyzed, and when combined with the powerful genetics of Drosophila, will reveal the complex phagocytic reactions comprised of the migration, recognition, engulfment, and degradation of apoptotic cells by phagocytes.

Phagocytosis Assay for Apoptotic Cells in Drosophila Embryos

We herein describe a phagocytosis assay using the dispersed embryonic cells of Drosophila. It enables us to easily and precisely quantify in vivo phagocytosis levels, and to identify new molecules required for the phagocytosis of apoptotic cells.

에있는 Apoptotic 세포를위한 Phagocytosis 검정<em&gt; Drosophila</em&gt; 태아

The molecular mechanisms underlying the phagocytosis of apoptotic cells need to be elucidated in more detail because of its role in immune and ...

면역학 및 감염병학

Detecting Anastasis In Vivo by CaspaseTracker Biosensor

Anastasis (Greek for &#8220;rising to life&#8221;) is a recently discovered cell recovery phenomenon whereby dying cells can reverse late-stage cell death processes that are generally assumed to be intrinsically irreversible. Promoting anastasis could in principle rescue or preserve injured cells that are difficult to replace such as cardiomyocytes or neurons, thereby facilitating tissue recovery. Conversely, suppressing anastasis in cancer cells, undergoing apoptosis after anti-cancer therapies, may ensure cancer cell death and reduce the chances of recurrence. However, these studies have been hampered by the lack of tools for tracking the fate of cells that undergo anastasis in live animals. The challenge is to identify the cells that have reversed the cell death process despite their morphologically normal appearance after recovery. To overcome this difficulty, we have developed Drosophila and mammalian CaspaseTracker biosensor systems that can identify and permanently track the anastatic cells in vitro or in vivo. Here, we present in vivo protocols for the generation and use of the CaspaseTracker dual biosensor system to detect and track anastasis in Drosophila melanogaster after transient exposure to cell death stimuli. While conventional biosensors and protocols can label cells actively undergoing apoptotic cell death, the CaspaseTracker biosensor can permanently label cells that have recovered after caspase activation - a hallmark of late-stage apoptosis, and simultaneously identify active apoptotic processes. This biosensor can also track the recovery of the cells that attempted other forms of cell death that directly or indirectly involved caspase activity. Therefore, this protocol enables us to continuously track the fate of these cells and their progeny, facilitating future studies of the biological functions, molecular mechanisms, physiological and pathological consequences, and therapeutic implications of anastasis. We also discuss the appropriate controls to distinguish cells that undergo anastasis from those that display non-apoptotic caspase activity in vivo.

Detecting Anastasis In Vivo by CaspaseTracker Biosensor

Anastasis is technically challenging to detect in vivo because the cells that have reversed the cell death process can be morphologically indistinguishable from normal healthy cells. Here we describe protocols for detecting and tracking cells that undergo anastasis in live animals by using our newly developed in vivo CaspaseTracker biosensor system.

Anastasis에서 Vivo에서 CaspaseTracker 바이오 센서에 의해 감지

Anastasis (Greek for &#8220;rising to life&#8221;) is a recently discovered cell recovery phenomenon whereby dying cells can reverse late-stage cell death ...

의학

Long-term In Vivo Tracking of Inflammatory Cell Dynamics Within Drosophila Pupae

During the rapid inflammatory response to tissue damage, cells of the innate immune system are quickly recruited to the injury site. Once at the wound, innate immune cells perform a number of essential functions, such as fighting infection, clearing necrotic debris, and stimulating matrix deposition. In order to fully understand the diverse signaling events that regulate this immune response, it is crucial to observe the complex behaviors of (and interactions that occur between) multiple cell lineages in vivo, and in real-time, with the high spatio-temporal resolution. The optical translucency and the genetic tractability of Drosophila embryos have established Drosophila as an invaluable model to live-image and dissect fundamental aspects of inflammatory cell behavior, including mechanisms of developmental dispersal, clearance of apoptotic corpses&#160;and/or microbial pathogens, and recruitment to wounds. However, more recent work has now demonstrated that employing a much later stage in the Drosophila lifecycle &#8211; the Drosophila pupa &#8211; offers a number of distinct advantages, including improved RNAi efficiency, longer imaging periods, and significantly greater immune cell numbers. Here we describe a protocol for imaging wound repair and the associated inflammatory response at the high spatio-temporal resolution in live Drosophila pupae. To follow the dynamics of both re-epithelialization and inflammation, we use a number of specific in vivo fluorescent markers for both the epithelium and innate immune cells. We also demonstrate the effectiveness of photo-convertible fluorophores, such as Kaede, for following the specific immune cell subsets, to track their behavior as they migrate to, and resolve from, the injury site.

Long-term In Vivo Tracking of Inflammatory Cell Dynamics Within Drosophila Pupae

Here we present a protocol for live-imaging wound repair and the associated inflammatory response at high spatio-temporal resolution in vivo. This method utilizes the pupal stage of Drosophila development to enable long-term imaging and tracking of specific cell populations over time and is compatible with efficient RNAi-mediated gene inactivation.

초파리 번데기 내에서 염증 성 세포 역학의 장기 Vivo에서 추적

During the rapid inflammatory response to tissue damage, cells of the innate immune system are quickly recruited to the injury site. Once at the wound, ...

In Vivo Single-Molecule Tracking at the Drosophila Presynaptic Motor Nerve Terminal

An increasing number of super-resolution microscopy techniques are helping to uncover the mechanisms that govern the nanoscale cellular world. Single-molecule imaging is gaining momentum as it provides exceptional access to the visualization of individual molecules in living cells. Here, we describe a technique that we developed to perform single-particle tracking photo-activated localization microscopy (sptPALM) in Drosophila larvae. Synaptic communication relies on key presynaptic proteins that act by docking, priming, and promoting the fusion of neurotransmitter-containing vesicles with the plasma membrane. A range of protein-protein and protein-lipid interactions tightly regulates these processes and the presynaptic proteins therefore exhibit changes in mobility associated with each of these key events. Investigating how mobility of these proteins correlates with their physiological function in an intact live animal is essential to understanding their precise mechanism of action. Extracting protein mobility with high resolution in vivo requires overcoming limitations such as optical transparency, accessibility, and penetration depth. We describe how photoconvertible fluorescent proteins tagged to the presynaptic protein Syntaxin-1A can be visualized via slight oblique illumination and tracked at the motor nerve terminal or along the motor neuron axon of the third instar Drosophila larva.

In Vivo Single-Molecule Tracking at the Drosophila Presynaptic Motor Nerve Terminal

Here we illustrate how single molecule photo-activated localization microscopy can be carried out on the motor nerve terminal of a live Drosophila melanogaster third instar larva.

Vivo에서 단일 분자 초파리 연 접 모터 신경 맨끝에 추적

An increasing number of super-resolution microscopy techniques are helping to uncover the mechanisms that govern the nanoscale cellular world. ...

신경과학

Live Imaging of Apoptotic Cell Clearance during Drosophila Embryogenesis

The proper elimination of unwanted or aberrant cells through apoptosis and subsequent phagocytosis (apoptotic cell clearance) is crucial for normal development in all metazoan organisms. Apoptotic cell clearance is a highly dynamic process intimately associated with cell death; unengulfed apoptotic cells are barely seen in vivo under normal conditions. In order to understand the different steps of apoptotic cell clearance and to compare 'professional' phagocytes - macrophages and dendritic cells to 'non-professional' - tissue-resident neighboring cells, in vivo live imaging of the process is extremely valuable. Here we describe a protocol for studying apoptotic cell clearance in live Drosophila embryos. To follow the dynamics of different steps in phagocytosis we use specific markers for apoptotic cells and phagocytes. In addition, we can monitor two phagocyte systems in parallel: 'professional' macrophages and 'semi-professional' glia in the developing central nervous system (CNS). The method described here employs the Drosophila embryo as an excellent model for real time studies of apoptotic cell clearance.

Live Imaging of Apoptotic Cell Clearance during Drosophila Embryogenesis

Here we describe an effective method for studying dynamics of apoptotic cell clearance in vivo. This method employs live Drosophila embryos as a powerful model for monitoring phagocytosis of apoptotic cells using specific labeling of apoptotic cells and phagocytes.

사멸 세포 간극의 이미지를하는 동안 라이브<em&gt; 초파리</em&gt; 배아

The  proper elimination of unwanted or aberrant cells through apoptosis and  subsequent phagocytosis (apoptotic cell clearance) is crucial for normal  ...

생물학

In Vitro Cleavage Assays using Purified Recombinant Drosophila Caspases for Substrate Screening

Caspases are very specific cell death proteases that are involved in apoptotic and non-apoptotic processes. While the role of caspases during apoptosis has been very well defined and many apoptotic proteolytic substrates of caspases have been identified and characterized, the role of caspases for non-apoptotic processes is not well understood. In particular, few non-apoptotic substrates of caspases have been identified thus far. Here, in order to facilitate the identification and characterization of potential caspase substrates, a protocol that allows the testing of candidate substrates in caspase cleavage assays in vitro is described. This protocol includes the production and purification of recombinant caspase proteins, the production of the candidate substrates either recombinantly or in a cell-free expression system, and the actual in vitro cleavage reaction followed by SDS-PAGE and immunoblotting. This protocol is tailored for the Drosophila caspases Dronc and Drice but can easily be adapted for caspases from other organisms, including mammals.

In Vitro Cleavage Assays using Purified Recombinant Drosophila Caspases for Substrate Screening

Here we present a protocol to express and purify recombinant Drosophila caspases Dronc and Drice, and their use in in vitro cleavage assays.

체외 기질 스크리닝을 위해 정제된 재조합 초파리 카스파제를 사용한 절단 분석

Caspases are very specific cell death proteases that are involved in apoptotic and non-apoptotic processes. While the role of caspases during apoptosis ...

생체공학

Visualization of Inflammatory Caspases Induced Proximity in Human Monocyte-Derived Macrophages

Inflammatory caspases include caspase-1, -4, -5, -11, and -12 and belong to the subgroup of initiator caspases. Caspase-1 is required to ensure correct regulation of inflammatory signaling and is activated by proximity-induced dimerization following recruitment to inflammasomes. Caspase-1 is abundant in the monocytic cell lineage and induces maturation of the pro-inflammatory cytokines interleukin (IL)-1&#946; and IL-18 to active secreted molecules. The other inflammatory caspases, caspase-4 and -5 (and their murine homolog caspase-11) promote IL-1&#946; release by inducing pyroptosis. Caspase Bimolecular Fluorescence Complementation (BiFC) is a tool used to measure inflammatory caspase induced proximity as a readout of caspase activation. The caspase-1, -4, or -5 prodomain, which contains the region that binds to the inflammasome, is fused to non-fluorescent fragments of the yellow fluorescent protein Venus (Venus-N [VN] or Venus-C [VC]) that associate to reform the fluorescent Venus complex when the caspases undergo induced proximity. This protocol describes how to introduce these reporters into primary human monocyte-derived macrophages (MDM) using nucleofection, treat the cells to induce inflammatory caspase activation, and measure caspase activation using fluorescence and confocal microscopy. The advantage of this approach is that it can be used to identify the components, requirements, and localization of the inflammatory caspase activation complex in living cells. However, careful controls need to be considered to avoid compromising cell viability and behavior. This technique is a powerful tool for the analysis of dynamic caspase interactions at the inflammasome level as well as for the interrogation of the inflammatory signaling cascades in living MDM and monocytes derived from human blood samples.

This protocol describes the workflow to obtain monocytes-derived macrophages (MDM) from human blood samples, a simple method to efficiently introduce inflammatory caspase Bimolecular Fluorescence Complementation (BiFC) reporters into human MDM without compromising cell viability and behavior, and an imaging-based approach to measure inflammatory caspase activation in living cells.

인간 단핵구 유래 대식세포에서 근접성을 유도한 염증성 카스파제의 시각화

Inflammatory caspases include caspase-1, -4, -5, -11, and -12 and belong to the subgroup of initiator caspases. Caspase-1 is required to ensure correct ...

Strategies for Tracking Anastasis, A Cell Survival Phenomenon that Reverses Apoptosis

Anastasis (Greek for &#8220;rising to life&#8221;) refers to the recovery of dying cells. Before these cells recover, they have passed through important checkpoints of apoptosis, including mitochondrial fragmentation, release of mitochondrial cytochrome c into the cytosol, activation of caspases, chromatin condensation, DNA damage, nuclear fragmentation, plasma membrane blebbing, cell shrinkage, cell surface exposure of phosphatidylserine, and formation of apoptotic bodies. Anastasis can occur when apoptotic stimuli are removed prior to death, thereby allowing dying cells to reverse apoptosis and potentially other death mechanisms. Therefore, anastasis appears to involve physiological healing processes that could also sustain damaged cells inappropriately. The functions and mechanisms of anastasis are still unclear, hampered in part by the limited tools for detecting past events after the recovery of apparently healthy cells. Strategies to detect anastasis will enable studies of the physiological mechanisms, the hazards of undead cells in disease pathology, and potential therapeutics to modulate anastasis. Here, we describe effective strategies using live cell microscopy and a mammalian caspase biosensor&#160;for identifying and tracking anastasis in mammalian cells.

The term anastasis refers to the phenomenon in which dying cells reverse a cell suicide process at a late stage, repair themselves, and ultimately survive. Here we demonstrate protocols for detecting and tracking cells that undergo anastasis.

추적 아나스타시스, 세포 사멸을 취소 세포 생존 현상에 대한 전략

Anastasis (Greek for &#8220;rising to life&#8221;) refers to the recovery of dying cells. Before these cells recover, they have passed through important ...

생체 내에서 바이오 센서는 초파리에서 비 세포 사멸 카스파 활동을 추적

요약

더 많은 비디오 탐색

이 비디오의 챕터