אנו מודים Polan סנטוס דארן Obbard לאיורים תסיסנית באיור. 2a, מרסלו ג&#39;ייקובס-לורנה לשימוש של insectary JHMRI. עבודה זו נתמכה על ידי מלגת קרן המחקר מדעי החיים (HLT), ועדת המענקים אוניברסיטת הונג קונג AoE / B-07/99 (MCF), ו- NIH מעניקה NS096677, NS037402 ו NS083373 (JMH). הו לם טאנג הוא עמית קרן Shurl וקיי קורצ&#39;י של קרן המחקר למדעי החיים.

1. הכנת זבובים CaspaseTracker <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> כדי להכין CaspaseTracker (DQVD) זבובים לניסויים, לבצע הצלב הזה: UBI-CaspaseTracker x G-TRACE (כטב&quot;מ-RFP; כטב&quot;מ-FLP; Ubi&gt;&gt; עצירה GFP-NLS), על ידי העברת נקבה בתולה 7-10 (או זכר) זבובים נושאת את המצע biosensor caspase mCD8-DIAP1-Gal4 מונע על ידי האמרגן היוביקוויטין 35 יחד עם מספר זהה של גברים (או נשים) זבובים G-TRACE, אשר יש איזון כרומוזום ארגון הנוער הקתולי השנייה, כדי למנוע הקטלניות של שילוב הומוזיגוטים של G- TRACE (כטב&quot;מ-RFP, כטב&quot;מ-FLP, ו Ubi&gt;&gt; עצירה GFP-NLS) 34. מקום טס בקבוקון מזון טרי עם רסק שמרים טריים כמקור חלבון. </li><li style=";text-align:right;direction:rtl"> דגירת קבצים על 18 מעלות צלזיוס במשך 5 עד 7 ימים (מקסימום 2 שבועות) ולאחר מכן הסר את ההורה עף מהבקבוקון להימנע צפיפות עם צאצאים חדשים, וכדי להגדיר בקבוקוני רבייה חדשים. </li><li style=";text-align:right;direction:rtl"> המשך דגירה על 18 מעלות צלזיוס עד צאצאי זבובי eclose. בחר את ארגון הנוער הקתולי הלא [-ג ללאצאצאי urlY כנף] של גנוטיפ הנכונה של CaspaseTracker, שהן מהונדסות עבור אלמנטי CaspaseTracker ו- G-TRACE 35. </li><li style=";text-align:right;direction:rtl"> במקביל, ליצור שליטה הלא מהונדס הורית זבובי w118 ו caspase-רגישות (DQVA) זבובים במקביל לאמת RFP CaspaseTracker הספציפי GFP קרינה. </li><li style=";text-align:right;direction:rtl"> בצע genotyping PCR כדי לאשר קבצים עם CaspaseTracker באמצעות פריימרים: 5&#39;-TCCCCCGGGCTGCAGGAATTC, 3&#39;-TGGAATTGGGGTACGTCTAGA, ייצור מוצר 3897 נ&quot;ב. עבור genotyping לוקוסים G-Trace, השתמש פריימרים הבאים GFP (474 ​​נ&quot;ב), 5&#39;-CAC GAC TTC TTC AAG TCC GCC ATG CCC G, 3&#39;-CTT GTA CAG CTC GTC CAT GCC GAG AGT גת C; עבור RFP (258 נ&quot;ב), 5&#39;-GGC TGC TTC ATC TAC AAG GTG AAG TTC ATC GG, 3&#39;-GAT GTC CAG CTT GGA GTC CAC GTA GTA GTA GC; ועבור Flpase (655 נ&quot;ב), 5&#39;- CCACCTAAGGTGCTTGTTCGTCAGTTTGTGG, 3&#39;-GCC TAC TAA CGC TTG TCT TTG TCT CTG TCA .ג גנוטיפ Gal4 ב וקטור pUWR (554 נ&quot;ב), 5&#39;-GAA GCA CAC CTT CGC ATC GCT CAGTCA CGC, 3&#39;-TGG AAT TGG GGT ACG TCT AGA. </li></ol> 2. רקמות הכנות, מכתים שם <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> עבור וניתוחי זבוב, למנוע רקמות גזורות יידבק טיפי פיפטה פלסטיק צינורות צנטריפוגה, טיפים מעיילים וצינורות עם אלבומין בסרום שור 1% (BSA) מומסים במים. </li><li style=";text-align:right;direction:rtl"> לנתח זבובים על כרית סיליקון באמצעות מלקחיים. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> כדי למנוע נזק קצות מלקחיים על משטח קשה בעת ביצוע לנתיחה רקמות, לבצע דיסקציה על משטח סיליקון. להכנת לוחות לנתיחת סיליקון, להמס את סיליקון בערכה המסחרית בהתאם להוראות יצרן (רשימת חומרים). לאחר המסת סיליקון, להוסיף 3 עד 4 מ&quot;ל לצלחת בתרבית רקמה בקוטר 60 מ&quot;מ. ניתן לעשות שימוש חוזר מנות הסיליקון. </li><li style=";text-align:right;direction:rtl"> להרדים זבוב עם CO 2, ולהעביר אותו לצלחת סיליקון עם 1 מ&quot;ל של קר PBS. הצג את CO 2 בקבוקון המכיל את הזבוב באמצעות צינורית ירי, ולאחר מכן להעביר את t הזבוב הרדיםOA Pad כי יש אספקה 2 CO. </li><li style=";text-align:right;direction:rtl"> השתמש זוג מלקחיים להחזיק את הראש לטוס, וזוג נוסף של מלקחיים למשוך את החזה בכיוון ההפוך כדי לנתק את הראש לטוס מהגוף המכסה מבלי לפגוע בקשר בין הראש במעי הקדמי. </li><li style=";text-align:right;direction:rtl"> שימוש 2 זוגות מלקחיים כדי להסיר את הכנפיים והרגליים מהחזה. </li><li style=";text-align:right;direction:rtl"> השתמש זוג מלקחיים להחזיק את החזה, ועוד זוג מלקחיים למשוך את הבטן על מנת להפריד בינו לבין בית החזה שוב מבלי לפגוע בקשר בין במעי הקדמי ו midgut. </li><li style=";text-align:right;direction:rtl"> לנתח האיברים הפנימיים כולל המוח, הבטן, tubules malpighian והשחלות כפי שהוכח בעבר. 39-41 </li><li style=";text-align:right;direction:rtl"> הסר את כל החלקים של לציפורן וגופי השומן עם מלקחיים כמו רקמות אלה לייצר autofluorescence החזק. סבלנות ותרגול נדרשים להכין מערכת איבר שלם כפי שמוצג. </li></ol></li><li style=";text-align:right;direction:rtl"> העבר רקמות גזורות 1.5 צינורות צנטריפוגה מיליליטר, ולתקן wi רקמותה 0.5 מ&quot;ל של paraformaldehyde 4% PBS (שנאגרו מלוחים פוספט) ב RT במשך 20 עד 30 דקות עם סיבוב בחושך כדי למנוע RFP הלבנת GFP ברקמות. הימנע קיבוע ממושך שיכול להתפשר תוצאות מכתימות שלאחר מכן. </li><li style=";text-align:right;direction:rtl"> הסר את paraformaldehyde ידי pipetting עדין ולשטוף 3 פעמים עם 0.5 מ&quot;ל PBST (PBS + 0.1% Triton X-100) ב RT. </li><li style=";text-align:right;direction:rtl"> Permeabilize הרקמות עם 0.5 מ&quot;ל PBST על 4 מעלות צלזיוס לילה עם רעד עדין. incubations שורטר עלול לגרום לתוצאות permeabilization ופשרת מכתים שלמות. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> אם יש צורך להפחית מכתים רקע, שקול דוגרים הרקמות 0.5 מ&quot;ל PBST עם 1% BSA, במקום PBS. </li></ol></li><li style=";text-align:right;direction:rtl"> שטפו את רקמות 3 פעמים עם 0.5 מ&quot;ל PBST. </li><li style=";text-align:right;direction:rtl"> כדי להכתים גרעינים אקטין פילמנטיות (F- אקטין), להחיל 0.5 מ&quot;ל PBST עם 10 מיקרוגרם / מ&quot;ל ​​של Hoechst 33342 צבע כחול גרעיני 0.3 מיקרומטר אלקסה פלואוריד 633 Phalloidin F- אקטין כתם דגירה זמנית עם רקמות של 1 ש &#39;ב RT wהסיבוב העדין ה- i בחושך. הימנע מכתים ממושך כמו זה יגדיל את הרקע. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> עבור immunostaining, דגירה קבועים permeabilized רקמות עם 0.1% Triton X-100 ב 0.5 מ&quot;ל PBS לילה ב 4 ° C, הכתם עם 1: 100 דילול של נוגדן anti-ELAV או עם 1: 200 דילול של caspase אנטי 3 לילה בשעה 4 ° C (300 μL). עקוב על ידי נוגדנים משני המתאים מדולל 1: 100 ו דגירה במשך 1 עד 3 שעות ב RT. ראה חומרי רשימה למידע נוגדן ספציפי. </li></ol></li><li style=";text-align:right;direction:rtl"> שטפו את רקמות 3 פעמים, כל 5 דקות ב 0.5 מ&quot;ל PBST עם סיבוב עדין. </li><li style=";text-align:right;direction:rtl"> עם pipet, להסיר את כל PBST, ולאחר מכן להוסיף 200 μL אנטי-אקונומיקה סוכן הרכבה (ראה חומרים) כדי לכסות רקמות לחלוטין עבור 1-3 שעות ב RT, או 4 מעלות צלזיוס למשך הלילה. רקמות אופטימליות אשר קלטו סוכן ההרכבה מלא תשקענה לתחתית הצינור. </li><li style=";text-align:right;direction:rtl"> טרום לנקות את שקופית הזכוכית עם אתנול מים או 70% ולהעביר את הרקמות עם הרכבת סוכן אל גלאסשקופיות של. </li><li style=";text-align:right;direction:rtl"> בזהירות במקום להחליק כיסוי זכוכית מעל לרקמות. החל וזלין לשקופית הזכוכית ואת הכיסוי להחליק להימנע להרוס את הרקמה על ידי overcompression. הסר סוכן הרכבה נוסף בנייר טישו. </li><li style=";text-align:right;direction:rtl"> חותם את התלוש לכסות באמצעות החלת לק לאורך כל הקצוות של להחליק את המכסה כדי למנוע דליפה של הרכבת סוכנים מן הרקמות. </li></ol> 3. מיקרוסקופי Confocal <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> שימוש במיקרוסקופ עלית קרינת confocal הפוך. עם זאת, עד-תקין מיקרוסקופים יכול לשמש גם. לרקמות התמונה באמצעות ריצוף, לשמור על טמפרטורת חדר יציבה כדי למנוע סחיפה של מיקוד משמרת של המטוס xy בשל התרחבות והתכווצות תרמית של רכיבים. מערכות בקרת הסביבה ומערכות פיצוי להיסחף מוקד לעזור להימנע מבעיה זו בשל אובדן שיווי משקל תרמי של מערכת מיקרוסקופ. </li><li style=";text-align:right;direction:rtl"> מניחים את השקף על הבמה של המיקרוסקופ. קח כמה תמונות בדיקה באמצעות ברזולוציה נמוכה (125 x 125 פיקסלים)d לקבוע את המספר המתאים של אריחי הדרוש כדי לכסות את האזור כולו של (ROI) ריבית. </li><li style=";text-align:right;direction:rtl"> הגדר את מערכת הסריקה במיקרוסקופ כדי ללכוד תמונות עם רזולוציית סריקה כגון 500 x 500 פיקסלים. בחר את המטרה כגון 20X NA 0.8 או מטרה 63X NA 1.4 Plan-Apochromat לניתוח רקמות באמצעות coverslips זכוכית, כך שכל התמונות (אריחים) חופף ב -20% על כל הצדדים. </li><li style=";text-align:right;direction:rtl"> הגדר את התמונה ברצף מ ארוך ביותר עד קצרות אורכי גל עירור, כמו האור באורכי הגל ארוך יותר גורם צילום הלבנה נמוכה. רצף מ הארוך ביותר עד הקצר גל עירור הוא: (i) 633 ננומטר עבור Phalloidin F אקטין עבור נוגדנים caspases מופעל, (ii) 561 ננומטר עבור RFP, (iii) 488 ננומטר עבור GFP, וכן (iv) 405 ננומטר עבור גרעיני כתם Hoechst. </li><li style=";text-align:right;direction:rtl"> במהלך הדמיה, לצמצם את החשיפה של תאים כדי עירור הלייזר פלורסנט במהלך ההדמיה תהליך להימנע צילום הלבנה על ידי הקטנת עוצמת הלייזר כדי להשיג תמונות באיכות גבוהה של הרקמות. </li><li style=";text-align:right;direction:rtl"> אחרי שאניהמגים נאספים, למזג את התמונות באמצעות תוכנת מיקרוסקופ. </li></ol>

The authors have nothing to disclose.

כאן אנו מדגימים את פעולתו הבנייה הפנימית של CaspaseTracker המאפשר זיהוי של פעילות caspase בסיס נרחבת ברקמות בריאות. השלבים הקריטיים לאיתור פעילות caspase הלא אפופטוטיים in vivo הם: 1) יצירת זבובים עם transgene biosensor, 2) אימות פונקצית כתב ספציפי caspase עם בקרה נאותה, 3) תרגול טכניקות לנתיחה ...

Caspases הם פרוטאזות ציסטאין אשר מתווכים מוות של תאים אפופטוטיים ידי ביקוע חלבונים תאיים רבים אחרי שאריות aspartate מפתח. לדוגמה, caspases יוזם להפעיל caspases מפעיל, nucleases DNA derepress, רכיבים cytoskeletal תדבק ולשנות את הרכב השומנים של קרום התא לפרק תאי במהירות לעורר הכרה היבלעות על ידי תאים שכנים אשר לסלק את הגוויות התא. 1-4 ההערכה היא כי מיליארדי תאים מתים ליום בגוף האדם, אפופטוזיס הוא מנגנון חשוב של מוות של תאים סרטניים הנגרמת כימותרפיה. 5 סט של caspases שונה יכול לגרום מוות של תאים על ידי תהליכים שאינם אפופטוטיים ברורים כדי לעורר חסינות מולדת. 6 לפיכך, עיקר מחקר על caspases התמקד פונקציות פרו-מותם. מעניין לציין, כי עדויות ראשוניות בתחום גילו כי באותה caspases האחראי למותו תא קידום יש גם f שאינו מוותמשיחה. המחקרים החלוציים הוכיחו כי caspases מעורבים תפקודים תאיים מגוונים בתאים בריאים, ובכלל זה הסדרת תא התפשטות והגירה במהלך embryogenesis. 7-9 caspases נדרשים עבור אינדיבידואליזציה spermatid תסיסנית 10,11, עבור חסימת מסלול מוות של תאים necroptotic חלופי בעכברים 12,13, ו לעיבוד microRNA ב C. elegans. 14,15 בשנת אולי התאים-מי שמאריך ימים ביותר, נוירונים, caspases ומכונות אפופטוטיים אחרים מעורבים בוויסות הפעילות העצבית על ידי גיזום סופים הסינפטי, תהליך האמין להיות חיוני כדי לחזק סינפסות אחרות על למידה וזיכרון. 16 18 יתכן כי caspases להקל גיזום סינפטי על ידי סוג של מיני-אפופטוזיס של תחזיות עצביות זעירות ללא מות תא כולו. 19 עם זאת, caspases יכול להיות פונקציות חלופיות שאינן קשורות לאירועים כמו אפופטוזיס. 20,21 תפקיד כפולs בחיים ומוות אינם ייחודיים caspases; BCL-2 חלבונים המשפחה ציטוכרום C יש תפקידים אנרגטיקה הסלולר בתאים בריאים אבל הם גם חלק של מסלול אפופטוטיים הליבה כי הוא מופעל על ידי סוגים רבים של מתח התא. 22-25 אמנם לא הוכח, זה נראה הגיוני שהאבולוציה מקושר יום -משרות אל משרות מוות בתוך אותו למולקולות כדי להבטיח חיסול בזמן של תאים מתאימים או לא רצויים. נכון לעכשיו, את המנגנונים המולקולריים של פעילות caspase הלא אפופטוטיים אינם מובנים, ואת היקף פעילות caspase הלא אפופטוטיים במהלך התפתחות עוברית ברקמות למבוגרות גם אינו ידוע. אחד האתגרים הגדולים הוא הקושי להבחין-עבודות היום ממוות-עבודות של caspases. בניגוד אפופטוזיס pyroptosis, כאשר פעילות caspase מוגברת על ידי מפל פרוטאוליטים, היום-העבודות של caspases צפויות להתרחש בשעה נמוכה בהרבה רמות של פעילות אנזימטית, סביר מתחת זיהוי על ידי techn רב הזמיןologies. לפני העבודה המוצגת כאן, ואחרים פיתחו מגוון של חיישנים ביולוגיים caspase למטרות שונות. את biosensors SCAT (למשל, ECFP-DEVD-ונוס) במהירות לזהות פעילות caspase בזמן אמת בתאים בתרבית ורקמות החיה באמצעות סריג. 26,27 עם מחשוף caspase, מחצית GFP במיקוד הגרעין של Apoliner (mCD8-RFP-DQVD- nucGFP) עובר relocalization subcellular בתוך דקות כאשר-לקשור קרום הפלזמה שלה הוא ביקע ידי caspases. 28 בדומה לכך, ApoAlert-pCaspase3-Sensor (NES-DEVD-YFP-NLS) relocalizes מן cytosol לגרעין על מחשוף caspase. 29,30 נוסף לאחרונה, chromophore ב iCasper תוכנן בחוכמה כדי לזרוח כאשר בקע ידי caspases, המתיר גילוי של פעילות biosensor בזמן אמת בנוירונים של עבר תסיסנית, אבל בעיקר בשיתוף עם מוות של תאים התפתחותי. 31 מות caspase-תלוי של נוירונים חוש הריח במהלך הזדקנות הייתה demonstעל פי דירוג של איתור חיסוני של הטופס בקע-caspase של חיישנים ביולוגיים CPV (למשל, mCD8-PARP-ונוס). 32,33 חשוב לציין, בצורה המופעלת של caspase-3 זוהתה בהעדר המוות של תאים על ידי immunostain הרגיש קוצים של נוירונים בתרבית, ובשנת סומה באמצעות הקרינה תלויה caspase של צבע כתב CellEvent הגרעיני, אך קשיים נתקלו בשל צילום רעיל, למרות מות תאים התעכב עד לאחר חיסול עמוד שדרה. 19 לפיכך, חיישנים הביולוגיים caspase חדשים יש צורך לזהות ולעקוב אחר תאים עם פעילות caspase הבזליים in vivo. כדי להתגבר על קשיים אלה, שעוררנו biosensor caspase צבע כפול רומן, מיועד CaspaseTracker. אסטרטגיה זו משלבת גרסה שונה של biosensor Apoliner caspase-רגיש תסיסנית 28 עם מערכת תסיסנית G-TRACE FRT recombinase 34 לתייג לצמיתות ולעקוב אחר תאים in vivo. &lt;sup&gt; 35 המערכת G-TRACE Gal4 המופעל מאפשר רמות נמוכות מאוד של caspases להפעיל CaspaseTracker, וכתוצאה מכך ביטוי RFP בציטופלסמה וביטוי GFP גרעינית במיקוד קבוע בכל תא שאי פעם חוותה פעילות caspase. 35 מערכת זו יכולה לתייג תאים לאורך כל החיים בחיות כולו באמצעות תסיסנית, מערכת מודל ממושמע בשימוש נרחב לחקר caspases תהליכי המוות התאי. 36-38

<table border="0" cellpadding="0" cellspacing="0" width="949">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:273px;">CONSUMABLES AND REAGENTS</td>
			<td style="width:229px;"></td>
			<td style="width:225px;"></td>
			<td style="width:223px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vectashield</td>
			<td style="width:229px;">Vector Products</td>
			<td style="width:225px;">H-1000</td>
			<td>Mounting medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Forceps</td>
			<td style="width:229px;">Ted Pella</td>
			<td style="width:225px;">#505 (110mm, #5)</td>
			<td>Dumont tweezer biology grade, stainless steel</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hanging Drop Slides</td>
			<td style="width:229px;">Fisher Scientific</td>
			<td style="width:225px;">12-565B</td>
			<td>Glass slides</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hoechst 33342</td>
			<td style="width:229px;">Molecular Probes</td>
			<td style="width:225px;">H1399</td>
			<td>DNA stain</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Alexa Fluor 633 Phalloidin</td>
			<td style="width:229px;">Molecular Probes</td>
			<td style="width:225px;">A22284</td>
			<td>Actin stain</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:273px;">Rat-Elav-7E8A10 anti-elav antibody</td>
			<td style="width:229px;">&#160;Developmental Studies Hybridoma Bank (DSHB)</td>
			<td style="width:225px;">Antibody Registry ID:&#160; AB_528218&#160;</td>
			<td>Stain for Drosophla pan-neuronal ELAV</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:273px;">Cleaved caspase-3 (Asp175) antibody</td>
			<td style="width:229px;">Cell Signaling Technology</td>
			<td style="width:225px;">#9661</td>
			<td>Stain for active fragment of caspase-3</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ProLong Gold antifade reagent</td>
			<td style="width:229px;">Life Technologies</td>
			<td style="width:225px;">P36934</td>
			<td>to preserve fluorophores&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:273px;">ProLong Diamond Antifade Mountant</td>
			<td style="width:229px;">Life Technologies</td>
			<td style="width:225px;">P36961</td>
			<td>to preserve fluorophores&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:273px;">SylGard 182 Silicone Elastomer Kit</td>
			<td style="width:229px;">Dow Corning&#160;</td>
			<td style="width:225px;">Product code: 0001023934</td>
			<td>for dissection plates</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:273px;">EQUIPMENT</td>
			<td style="width:229px;"></td>
			<td style="width:225px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LSM780 confocal microscope</td>
			<td style="width:229px;">Carl Zeiss</td>
			<td style="width:225px;">N/A</td>
			<td>Imaging</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:273px;">Carl Zeiss Stereomicroscope Stemi 2000&#160;</td>
			<td style="width:229px;">Carl Zeiss</td>
			<td style="width:225px;">N/A</td>
			<td>Drosophila dissection</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:273px;">AmScope Fiber Optic Dual Gooseneck Microscope Illuminator, 150W</td>
			<td style="width:229px;">AmScope</td>
			<td style="width:225px;">WBM99316&#160;</td>
			<td>Light source</td>
		</tr>
	</tbody>
</table>

in vivo biosensor tracks non-apoptotic caspase activity in drosophila

Caspases are the key mediators of apoptotic cell death via their proteolytic activity. When caspases are activated in cells to levels detectable by available technologies, apoptosis is generally assumed to occur shortly thereafter. Caspases can cleave many functional and structural components to cause rapid and complete cell destruction within a few minutes. However, accumulating evidence indicates that in normal healthy cells the same caspases have other functions, presumably at lower enzymatic levels. Studies of non-apoptotic caspase activity have been hampered by difficulties with detecting low levels of caspase activity and with tracking ultimate cell fate in vivo. Here, we illustrate the use of an ultrasensitive caspase reporter, CaspaseTracker, which permanently labels cells that have experienced caspase activity in whole animals. This in vivo dual color CaspaseTracker biosensor for Drosophila melanogaster transiently expresses red fluorescent protein (RFP) to indicate recent or on-going caspase activity, and permanently expresses green fluorescent protein (GFP) in cells that have experienced caspase activity at any time in the past yet did not die. Importantly, this caspase-dependent in vivo biosensor readily reveals the presence of non-apoptotic caspase activity in the tissues of organ systems throughout the adult fly. This is demonstrated using whole mount dissections of individual flies to detect biosensor activity in healthy cells throughout the brain, gut, malpighian tubules, cardia, ovary ducts and other tissues. CaspaseTracker detects non-apoptotic caspase activity in long-lived cells, as biosensor activity is detected in adult neurons and in other tissues at least 10 days after caspase activation. This biosensor serves as an important tool to uncover the roles and molecular mechanisms of non-apoptotic caspase activity in live animals.

ישנם שני מרכיבים מרכזיים המאפשרים CaspaseTracker כדי לזהות פעילות caspase בתאים הבריאים (איור 1 א). הראשון שבהם הוא חומצת אמינו 146 פוליפפטיד caspase-cleavable במתכונת (איור 1b) caspase biosensor Apoliner. 28 פוליפפטיד זה נגזר DIAP1 (דרוזופילה מעכב אפופטוזיס...

Watch this Scientific Journal Video about In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila at JoVE.com

In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

כדי לזהות תאים בריאים בחיות כולה המכילות רמות נמוכות של פעילות caspase, את biosensor הרגישות הגבוהה המיועד CaspaseTracker נוצרה עבור תסיסנית. Caspase-תלוי בפעילות biosensor מזוהית בתאים בריאים האריך ימים ברחבי האיברים הפנימיים של בעלי חיים בוגרים שגדלו בתנאים אופטימיזציה בהיעדר גירויי מוות.

In vivo biosensor Tracks ללא אפופטוטיים caspase פעילות תסיסנית

Caspases are the key mediators of apoptotic cell death via their proteolytic activity. When caspases are activated in cells to levels detectable by ...

in-vivo-biosensor-tracks-non-apoptotic-caspase-activity-in-drosophila

Research

JoVE Journal

Biology

In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

9.0K Views.  Johns Hopkins University Bloomberg School of Public Health.  כדי לזהות תאים בריאים בחיות כולה המכילות רמות נמוכות של פעילות caspase, את biosensor הרגישות הגבוהה המיועד CaspaseTracker נוצרה עבור תסיסנית. Caspase-תלוי בפעילות biosensor מזוהית בתאים בריאים האריך ימים ברחבי האיברים הפנימיים של בעלי חיים בוגרים שגדלו בתנ...

Video: In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

Mesoscopic Fluorescence Tomography for In-vivo Imaging of Developing Drosophila

Visualizing developing organ formation as well as progession and treatment of disease often heavily relies on the ability to optically interrogate molecular and functional changes in intact living organisms. Most existing optical imaging methods are inadequate for imaging at dimensions that lie between the penetration limits of modern optical microscopy (0.5-1mm) and the diffusion-imposed limits of optical macroscopy (&gt;1cm) [1]. Thus, many important model organisms, e.g. insects, animal embryos or small animal extremities, remain inaccessible for in-vivo optical imaging. 
Although there is increasing interest towards the development of nanometer-resolution optical imaging methods, there have not been many successful efforts in improving the imaging penetration depth. The ability to perform in-vivo imaging beyond microscopy limits is in fact met with the difficulties associated with photon scattering present in tissues. Recent efforts to image entire embryos for example [2,3] require special chemical treatment of the specimen, to clear them from scattering, a procedure that makes them suitable only for post-mortem imaging. These methods however evidence the need for imaging larger specimens than the ones usually allowed by two-photon or confocal microscopy, especially in developmental biology and in drug discovery.
We have developed a new optical imaging technique named Mesoscopic Fluorescence Tomography [4], which appropriate for non-invasive in-vivo imaging at dimensions of 1mm-5mm. The method exchanges resolution for penetration depth, but offers unprecedented tomographic imaging performance and it has been developed to add time as a new dimension in developmental biology observations (and possibly other areas of biological research) by imparting the ability to image the evolution of fluorescence-tagged responses over time. As such it can accelerate studies of morphological or functional dependencies on gene mutations or external stimuli, and can importantly, capture the complete picture of development or tissue function by allowing longitudinal time-lapse visualization of the same, developing organism.
The technique utilizes a modified laboratory microscope and multi-projection illumination to collect data at 360-degree projections. It applies the Fermi simplification to Fokker-Plank solution of the photon transport equation, combined with geometrical optics principles in order to build a realistic inversion scheme suitable for mesoscopic range. This allows in-vivo whole-body visualization of non-transparent three-dimensional structures in samples up to several millimeters in size.
We have demonstrated the in-vivo performance of the technique by imaging three-dimensional structures of developing Drosophila tissues in-vivo and by following the morphogenesis of the wings in the opaque Drosophila pupae in real time over six consecutive hours.

Mesoscopic Fluorescence Tomography for In-vivo Imaging of Developing Drosophila

Mesoscopic fluorescence tomography operates beyond the penetration limits of tissue-sectioning fluorescence microscopy. The technique is based on multi-projection illumination and a photon transport description. We demonstrate in-vivo whole-body 3D visualization of the morphogenesis of GFP-expressing wing imaginal discs in Drosophila melanogaster.

Mesoscopic Fluorescence טומוגרפיה עבור In-vivo הדמיה של פיתוח תסיסנית</em

Visualizing  developing organ formation as well as progession and treatment of disease often  heavily relies on the ability to optically interrogate ...

Preparation of embryos for Electron Microscopy of the Drosophila embryonic heart tube

The morphogenesis of the Drosophila embryonic heart tube has emerged as a valuable model system for studying cell migration, cell-cell adhesion and cell shape changes during embryonic development. One of the challenges faced in studying this structure is that the lumen of the heart tube, as well as the membrane features that are crucial to heart tube formation, are difficult to visualize in whole mount embryos, due to the small size of the heart tube and intra-lumenal space relative to the embryo. The use of transmission electron microscopy allows for higher magnification of these structures and gives the advantage of examining the embryos in cross section, which easily reveals the size and shape of the lumen. In this video, we detail the process for reliable fixation, embedding, and sectioning of late stage Drosophila embryos in order to visualize the heart tube lumen as well as important cellular structures including cell-cell junctions and the basement membrane.

Preparation of embryos for Electron Microscopy of the Drosophila embryonic heart tube

We describe a process for fixation, embedding, sectioning, and imaging of late stage Drosophila embryos for Trasmission Electron Microscopy of the embryonic heart tube. This technique allows for the visualization of the heart tube lumen as well as the basement membrane, which lines the lumen of the heart.

הכנת עוברים אלקטרונים מיקרוסקופית של תסיסנית לב עוברי צינור

The morphogenesis of the Drosophila  embryonic heart tube has emerged as a valuable model system for studying cell migration, cell-cell adhesion and cell ...

In-vivo Centrifugation of Drosophila Embryos

A major strategy for purifying and isolating different types of intracellular organelles is to separate them from each other based on differences in buoyant density. However, when cells are disrupted prior to centrifugation, proteins and organelles in this non-native environment often inappropriately stick to each other. Here we describe a method to separate organelles by density in intact, living Drosophila embryos. Early embryos before cellularization are harvested from population cages, and their outer egg shells are removed by treatment with 50% bleach. Embryos are then transferred to a small agar plate and inserted, posterior end first, into small vertical holes in the agar. The plates containing embedded embryos are centrifuged for 30 min at 3000g. The agar supports the embryos and keeps them in a defined orientation. Afterwards, the embryos are dug out of the agar with a blunt needle. Centrifugation separates major organelles into distinct layers, a stratification easily visible by bright-field microscopy. A number of fluorescent markers are available to confirm successful stratification in living embryos. Proteins associated with certain organelles will be enriched in a particular layer, demonstrating colocalization. Individual layers can be recovered for biochemical analysis or transplantation into donor eggs. This technique is applicable for organelle separation in other large cells, including the eggs and oocytes of diverse species.

In-vivo Centrifugation of Drosophila Embryos

We describe a method to separate organelles by density in living Drosophila embryos. Embryos are embedded in agar and centrifuged. This technique yields reproducible separation of major organelles along the anterior-posterior embryo axis. This method facilitates colocalization experiments and yields organelle fractions for biochemical analysis and transplantation experiments.

In-vivo צנטריפוגה של עוברים תסיסנית

A major strategy for purifying and isolating different types of intracellular organelles is to separate them from each other based on differences in ...

In vivo Imaging of Intact Drosophila Larvae at Sub-cellular Resolution

Recent improvements in optical imaging, genetically encoded fluorophores and genetic tools allowing efficient establishment of desired transgenic animal lines have enabled biological processes to be studied in the context of a living, and in some instances even behaving, organism. In this protocol we will describe how to anesthetize intact Drosophila larvae, using the volatile anesthetic desflurane, to follow the development and plasticity of synaptic populations at sub-cellular resolution1-3. While other useful methods to anesthetize Drosophila melanogaster larvae have been previously described4,5,6,7,8, the protocol presented herein demonstrates significant improvements due to the following combined key features: (1) A very high degree of anesthetization; even the heart beat is arrested allowing for lateral resolution of up to 150 nm1, (2) a high survival rate of &gt; 90% per anesthetization cycle, permitting the recording of more than five time-points over a period of hours to days2 and (3) a high sensitivity enabling us in 2 instances to study the dynamics of proteins expressed at physiological levels. In detail, we were able to visualize the postsynaptic glutamate receptor subunit GluR-IIA expressed via the endogenous promoter1 in stable transgenic lines and the exon trap line FasII-GFP1. (4) In contrast to other methods4,7 the larvae can be imaged not only alive, but also intact (i.e. non-dissected) allowing observation to occur over a number of days1. The accompanying video details the function of individual parts of the in vivo imaging chamber2,3, the correct mounting of the larvae, the anesthetization procedure, how to re-identify specific positions within a larva and the safe removal of the larvae from the imaging chamber.

In vivo Imaging of Intact Drosophila Larvae at Sub-cellular Resolution

This protocol describes a reliable method for anesthetization and imaging of intact Drosophila melanogaster larvae. We have utilized the volatile anesthetic desflurane to allow for repetitive imaging at sub-cellular resolution and re-identification of structures for up to a few days1.

בתחום ההדמיה vivo של הזחלים תסיסנית אינטקט ברזולוציה משנה הסלולר

Recent improvements in optical imaging, genetically encoded fluorophores and genetic tools allowing efficient establishment of desired transgenic animal ...

Patch Clamp and Perfusion Techniques for Studying Ion Channels Expressed in Xenopus oocytes

The protocol presented here is designed to study the activation of the large conductance, voltage- and Ca2+-activated K+ (BK) channels. The protocol may also be used to study the structure-function relationship for other ion channels and neurotransmitter receptors1. BK channels are widely expressed in different tissues and have been implicated in many physiological functions, including regulation of smooth muscle contraction, frequency tuning of inner hair cells and regulation of neurotransmitter release2-6. BK channels are activated by membrane depolarization and by intracellular Ca2+ and Mg2+ 6-9. Therefore, the protocol is designed to control both the membrane voltage and the intracellular solution. In this protocol, messenger RNA of BK channels is injected into Xenopus laevis oocytes (stage V-VI) followed by 2-5 days of incubation at 18&deg;C10-13. Membrane patches that contain single or multiple BK channels are excised with the inside-out configuration using patch clamp techniques10-13. The intracellular side of the patch is perfused with desired solutions during recording so that the channel activation under different conditions can be examined. To summarize, the mRNA of BK channels is injected into Xenopus laevis oocytes to express channel proteins on the oocyte membrane; patch clamp techniques are used to record currents flowing through the channels under controlled voltage and intracellular solutions.

Patch Clamp and Perfusion Techniques for Studying Ion Channels Expressed in Xenopus oocytes

Ionic current of BK channels is recorded using patch clamp techniques. BK channels are expressed in Xenopus oocytes by injecting messenger RNA. The intracellular solution during patch clamp recordings is controlled by a perfusion system.

הצמד תיקון וטכניקות זלוף עבור לימוד תעלות יונים מתבטא Xenopus ביציות

The protocol presented here is designed to study the activation of the large conductance, voltage- and Ca2+-activated K+ (BK) channels. The protocol may ...

Imaging Cell Shape Change in Living Drosophila Embryos

The developing Drosophila melanogaster embryo undergoes a number of cell shape changes that are highly amenable to live confocal imaging. Cell shape changes in the fly are analogous to those in higher organisms, and they drive tissue morphogenesis. So, in many cases, their study has direct implications for understanding human disease (Table 1)1-5. On the sub-cellular scale, these cell shape changes are the product of activities ranging from gene expression to signal transduction, cell polarity, cytoskeletal remodeling and membrane trafficking. Thus, the Drosophila embryo provides not only the context to evaluate cell shape changes as they relate to tissue morphogenesis, but also offers a completely physiological environment to study the sub-cellular activities that shape cells.
The protocol described here is designed to image a specific cell shape change called cellularization. Cellularization is a process of dramatic plasma membrane growth, and it ultimately converts the syncytial embryo into the cellular blastoderm. That is, at interphase of mitotic cycle 14, the plasma membrane simultaneously invaginates around each of ~6000 cortically anchored nuclei to generate a sheet of primary epithelial cells. Counter to previous suggestions, cellularization is not driven by Myosin-2 contractility6, but is instead fueled largely by exocytosis of membrane from internal stores7. Thus, cellularization is an excellent system for studying membrane trafficking during cell shape changes that require plasma membrane invagination or expansion, such as cytokinesis or transverse-tubule (T-tubule) morphogenesis in muscle.
Note that this protocol is easily applied to the imaging of other cell shape changes in the fly embryo, and only requires slight adaptations such as changing the stage of embryo collection, or using "embryo glue" to mount the embryo in a specific orientation (Table 1)8-19. In all cases, the workflow is basically the same (Figure 1). Standard methods for cloning and Drosophila transgenesis are used to prepare stable fly stocks that express a protein of interest, fused to Green Fluorescent Protein (GFP) or its variants, and these flies provide a renewable source of embryos. Alternatively, fluorescent proteins/probes are directly introduced into fly embryos via straightforward micro-injection techniques9-10. Then, depending on the developmental event and cell shape change to be imaged, embryos are collected and staged by morphology on a dissecting microscope, and finally positioned and mounted for time-lapse imaging on a confocal microscope.

Imaging Cell Shape Change in Living Drosophila Embryos

Early development of the fruit fly, Drosophila melanogaster, is characterized by a number of cell shape changes that are well suited for imaging approaches. This article will describe basic tools and methods required for live confocal imaging of Drosophila embryos, and will focus on a cell shape change called cellularization.

צורה הדמיה תא שינוי חיים תסיסנית עוברים

The developing Drosophila melanogaster embryo undergoes a number of cell shape changes that are highly amenable to live confocal imaging.  Cell shape ...

Live Imaging of Apoptotic Cell Clearance during Drosophila Embryogenesis

The proper elimination of unwanted or aberrant cells through apoptosis and subsequent phagocytosis (apoptotic cell clearance) is crucial for normal development in all metazoan organisms. Apoptotic cell clearance is a highly dynamic process intimately associated with cell death; unengulfed apoptotic cells are barely seen in vivo under normal conditions. In order to understand the different steps of apoptotic cell clearance and to compare 'professional' phagocytes - macrophages and dendritic cells to 'non-professional' - tissue-resident neighboring cells, in vivo live imaging of the process is extremely valuable. Here we describe a protocol for studying apoptotic cell clearance in live Drosophila embryos. To follow the dynamics of different steps in phagocytosis we use specific markers for apoptotic cells and phagocytes. In addition, we can monitor two phagocyte systems in parallel: 'professional' macrophages and 'semi-professional' glia in the developing central nervous system (CNS). The method described here employs the Drosophila embryo as an excellent model for real time studies of apoptotic cell clearance.

Live Imaging of Apoptotic Cell Clearance during Drosophila Embryogenesis

Here we describe an effective method for studying dynamics of apoptotic cell clearance in vivo. This method employs live Drosophila embryos as a powerful model for monitoring phagocytosis of apoptotic cells using specific labeling of apoptotic cells and phagocytes.

חי הדמיה של חיסול תאים אפופטוטיים במהלך<em&gt; דרוזופילה</em&gt; עובר

The  proper elimination of unwanted or aberrant cells through apoptosis and  subsequent phagocytosis (apoptotic cell clearance) is crucial for normal  ...

An in vivo Crosslinking Approach to Isolate Protein Complexes From Drosophila Embryos

Many cellular processes are controlled by multisubunit protein complexes. Frequently these complexes form transiently and require native environment to assemble. Therefore, to identify these functional protein complexes, it is important to stabilize them in vivo before cell lysis and subsequent purification. Here we describe a method used to isolate large bona fide protein complexes from Drosophila embryos. This method is based on embryo permeabilization and stabilization of the complexes inside the embryos by in vivo crosslinking using a low concentration of formaldehyde, which can easily cross the cell membrane. Subsequently, the protein complex of interest is immunopurified followed by gel purification and analyzed by mass spectrometry. We illustrate this method using purification of a Tudor protein complex, which is essential for germline development. Tudor is a large protein, which contains multiple Tudor domains - small modules that interact with methylated arginines or lysines of target proteins. This method can be adapted for isolation of native protein complexes from different organisms and tissues.

An in vivo Crosslinking Approach to Isolate Protein Complexes From Drosophila Embryos

Multi-component protein complexes play crucial roles during cellular function and development. Here we describe a method used to isolate native protein complexes from Drosophila embryos after in vivo crosslinking followed by purification of the crosslinked complexes for subsequent structure-function analysis.

In vivo גישת Crosslinking לבודד חלבון מן מכלולים דרוזופילה עוברים

Many cellular processes are controlled by multisubunit protein complexes. Frequently these complexes form transiently and require native environment to ...

Functional Reconstitution and Channel Activity Measurements of Purified Wildtype and Mutant CFTR Protein

The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a unique channel-forming member of the ATP Binding Cassette (ABC) superfamily of transporters. The phosphorylation and nucleotide dependent chloride channel activity of CFTR has been frequently studied in whole cell systems and as single channels in excised membrane patches. Many Cystic Fibrosis-causing mutations have been shown to alter this activity. While a small number of purification protocols have been published, a fast reconstitution method that retains channel activity and a suitable method for studying population channel activity in a purified system have been lacking. Here rapid methods are described for purification and functional reconstitution of the full-length CFTR protein into proteoliposomes of defined lipid composition that retains activity as a regulated halide channel. This reconstitution method together with a novel flux-based assay of channel activity is a suitable system for studying the population channel properties of wild type CFTR and the disease-causing mutants F508del- and G551D-CFTR. Specifically, the method has utility in studying the direct effects of phosphorylation, nucleotides and small molecules such as potentiators and inhibitors on CFTR channel activity. The methods are also amenable to the study of other membrane channels/transporters for anionic substrates.

Described here is a rapid and effective procedure for functional reconstitution of purified wild-type and mutant CFTR protein that preserves activity for this chloride channel, which is defective in Cystic Fibrosis. Iodide efflux from reconstituted proteoliposomes mediated by CFTR allows studies of channel activity and the effects of small molecules.

מדידות הכינון פונקציונלי ופעילות הערוץ של מטוהרים wildtype וחלבון CFTR Mutant

The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a unique channel-forming member of the ATP Binding Cassette (ABC) superfamily of ...

Measurement of Larval Activity in the Drosophila Activity Monitor

Drosophila larvae are used in many behavioral studies, yet a simple device for measuring basic parameters of larval activity has not been available. This protocol repurposes an instrument often used to measure adult activity, the TriKinetics Drosophila activity monitor (MB5 Multi-Beam Activity Monitor) to study larval activity. The instrument can monitor the movements of animals in 16 individual 8 cm glass assay tubes, using 17 infrared detection beams per tube. Logging software automatically saves data to a computer, recording parameters such as number of moves, times sensors were triggered, and animals&#8217; positions within the tubes. The data can then be analyzed to represent overall locomotion and/or position preference as well as other measurements. All data are easily accessible and compatible with basic graphing and data manipulation software. This protocol will discuss how to use the apparatus, how to operate the software and how to run a larval activity assay from start to finish.

Measurement of Larval Activity in the Drosophila Activity Monitor

This report describes a method for measuring Drosophila larval activity using the TriKinetics Drosophila Activity Monitor. The device employs infrared beams to detect movements of up to 16 individual animals. Data can be analyzed to represent motion parameters including rates and the positions of the animals within the assay chambers.

מדידה של הזחל פעילות ב<em&gt; דרוזופילה</em&gt; צג פעילות

Drosophila larvae are used in many behavioral studies, yet a simple device for measuring basic parameters of larval activity has not been available. This ...