This research was supported by funding from the National Heart, Lung, and Blood Institute (NHLBI), National Institutes of Health through grants U01HL099656 (P.G. and D.L.F.) and U01HL134696 (P.G. and D.L.F.).

1. Design and construction of guide RNA (gRNA)
NOTE: Each gRNA is made up of two 60 base pair (bp) oligonucleotides that are annealed to generate a 100 bp double stranded (ds) oligonucleotide (Figure 1A-C). The timeline for gRNA design, generation, and testing cutting efficiency is approximately 2 weeks (Figure 2).
<ol>
	<li>Select the DNA region of interest to be genome edited and identify 3-4 23 bp sequences that fit the format, 5&#39;-G(N19)NGG-3&#39;. These sequences should be located within 20 bp of the region of interest. 
	NOTE: Targeting can be performed on the sense or anti-sense strand.</li>
	<li>Evaluate the gRNA sequences for genomic redundancy and off-target probability using a resource such as CRISPOR (http://crispor.tefor.net).</li>
	<li>Incorporate the 20 bp target sequence (excluding the protospacer adjacent motif or PAM) into two 60-mer oligonucleotides as shown (sequences are 5&#39;&#160;to 3&#39;&#160;and red and green are reverse complements as shown in Figure 1C).</li>
	<li>Order the two 60 bp oligonucleotides from vendor of choice. Once the oligonucleotides are received, resuspend each to a final concentration of 100 &#181;M in ddH2O. Make a working stock of 10 &#181;M.</li>
	<li>Anneal the two oligonucleotides and generate a 100 bp dsDNA fragment using DNA polymerase (Table of Materials). Combine 5 &#181;L of 10 &#181;M forward oligonucleotide and 5 &#181;L of 10 &#181;M reverse oligonucleotide in a polymerase chain reaction (PCR) strip tube and incubate at 95 &#176;C for 5 min. Cool the reaction for 10 min at room temperature (RT).</li>
	<li>Set up the PCR as described in Table 1. Perform PCR amplification in a thermal cycler using the parameters outlined in Table 2.</li>
	<li>Visualize the PCR products on a 1.5% (w/v) ethidium bromide (EtBr) agarose gel electrophoresed at 80-100 V for 40 min. Excise the 100 bp band (Figure 3A), visualized on an LED light box, from the gel using a razor blade and purify using a gel extraction kit (Table of Materials).</li>
</ol>
2. Design of PCR primers for screening
<ol>
	<li>Perform screening of the edited DNA using forward and reverse PCR primers that are specifically designed to amplify a 400-500 bp region of the gene of interest (Table 2). Use DNA isolated from any control iPSC line to confirm a clean amplicon when performing the screening PCR.</li>
	<li>Visualize PCR products on a 1.5% (w/v) gel following electrophoresis at 80-100 V for 1 h. 
	NOTE: Sequencing of edited clones is performed using a nested primer that is designed following confirmation of the screening primer set. Samples are sent to a commercial source for sequencing.</li>
</ol>
3. Preparation of gRNA_cloning vector plasmid
<ol>
	<li>To linearize the cloning vector, take a 1.5 mL centrifuge tube and add 1-5 &#181;g of DNA of the gRNA_cloning vector along with 4 &#181;L of the AflII restriction enzyme buffer and 1.5 &#181;L of AflII restriction enzyme. Bring up the reaction to 24 &#181;L of ddH2O. Mix the reaction by pipetting up and down. Incubate at 37 &#176;C overnight (O/N).</li>
	<li>Electrophorese on a 1% agarose gel at 80-100 V for 1 h and excise bands (expected band size is ~3519 bp).</li>
	<li>Extract and purify as in step 1.6.</li>
</ol>
4. Assembly of gRNA vector
<ol>
	<li>Set up reactions and assemble DNA fragments using the assembly kit (Table of Materials) at 1:5 ratios of AflII digested gRNA cloning vector to 100 bp gel purified insert, as described in Table 3.</li>
	<li>Incubate the reaction at 50 &#176;C for 15 min. Dilute the reaction 1:3 in ddH2O and use 3 &#181;L for bacterial transformation, as per manufacturer&#8217;s instructions (Table of Materials). Plate cells on kanamycin LB/agar plates.</li>
	<li>Pick 3-5 colonies per gRNA. Inoculate each colony in 4 mL of LB and grow O/N at 37 &#176;C in an orbital shaking incubator.</li>
	<li>Purify plasmid DNA using a miniprep plasmid isolation kit, and sequence each gRNA using the following primers to ensure successful cloning: Forward: GTACAAAAAAGCAGGCTTTAAAGG; Reverse: TGCCAACTTTGTACAAGAAAGCT.</li>
</ol>
5. Test gRNA cutting efficiency
<ol>
	<li>Plate hESCs on irradiated murine embryonic fibroblasts (MEFs) in a 6-well plate, as previously described21. When the cells reach 70-80% confluency, prepare the transfection master mix outlined in Table 4.</li>
	<li>Mix by pipetting and incubate at RT for 15 min. Add dropwise to the cells and incubate at 37 &#176;C for 48 h (with a media change after 24 h).</li>
	<li>Harvest cells for sorting after 48 h.
	<ol>
		<li>Remove MEFs enzymatically (Table of Materials) with a 3 min RT incubation.</li>
		<li>Rinse cells 1x with hESC medium (Table 5) and scrape into hESC medium + 10 &#181;M Y-27632 dihydrochloride (Table of Materials).</li>
		<li>Pellet cells at 300 x g for 3 min and resuspend in 0.5 mL of hESC medium + 10 &#181;M Y-27632 dihydrochloride.</li>
		<li>Filter into a 5 mL tube through a 35 &#181;m cell-strainer cap.</li>
	</ol>
	</li>
	<li>Using fluorescence activated cell sorting (FACS), gate on live cells and sort the green fluorescent protein (GFP) positive cells.</li>
	<li>Transfer a maximum of 1.5 x 104 sorted cells directly into a 10 cm2 dish coated with 1:3 basement membrane matrix (Table of Materials) and irradiated MEFs in hESC medium (Table 5) containing Y-27632 dihydrochloride.</li>
	<li>Change medium daily using the hESC medium (Table 5) without Y-27632 dihydrochloride and manually pick clones after 10-15 days, when colonies are ~1 mm in diameter.
	<ol>
		<li>Using a P200 pipette and microscope, carefully scrape a single clone and draw cells into the pipette.</li>
		<li>Disperse the cells by gently pipetting 3-4x in a 96 well plate in the medium drawn up with the colony.</li>
		<li>Dispense into PCR strip tubes for screening and pellet the cells by centrifugation at 10,000 x g for 5 min. Pick 20 colonies per gRNA.</li>
	</ol>
	</li>
</ol>
6. Clone screening
<ol>
	<li>Isolate DNA by incubating cell pellets in 20 &#181;L of proteinase K buffer (Table 5) (1 h at 55 &#176;C and 10 min at 95 &#176;C) and vortex vigorously. Centrifuge at 10,000 x g for 5 min and collect the supernatant.</li>
	<li>Perform screening PCR (section 2) in a total volume of 20 &#181;L using a master mix including primers designed to amplify the region of interest and 5 &#181;L of the proteinase K digest. Use genomic DNA isolated from the cell line that was gene edited as a control.</li>
	<li>Evaluate size changes of PCR products following 1 h electrophoresis at 70-90 V on a 2.5% (w/v) agarose gel (Figure 3B,C). Any size difference is indicative of cleavage.</li>
</ol>
7. Precise genome editing in pluripotent stem cells using single strand oligo DNA (ssODNs)
<ol>
	<li>Design 100 bp ssODNs centered around the most efficient gRNA sequence determined to have the best cutting efficiency.</li>
	<li>Prevent re-cleavage of the recombined ODN by introducing silent mutations in the gRNA sequence. A single silent mutation in the PAM sequence is sufficient, but if not possible, 3-4 silent mutations will work. 
	NOTE: To facilitate screening of targeted clones, the introduction of a restriction site within ~20 bp of the gRNA sequence is ideal.</li>
	<li>Design one ODN with the desired base change(s) to create the mutation of interest and one ODN without the base change(s). 
	NOTE: These changes should be no more than ~20 bp from the predicted CRISPR/CAS9 cut site, as recombination drops off considerably at greater distances.</li>
	<li>Order the two ssODNs from vendor of choice and resuspend in water to make 1 &#181;g/&#181;L stocks. Store stocks at -20 &#176;C.</li>
</ol>
8. Transfection setup
<ol>
	<li>To transfect the ssODN and the CRISPR-CAS9 plasmids, plate the target cell line in a 6-well dish on irradiated MEFs to reach 70-80% confluency after an O/N incubation.</li>
	<li>Set up the transfection reaction as described in Table 6. Mix the reaction by pipetting and incubate for 15 min at RT. Add the transfection reaction mixture dropwise to the cells.</li>
	<li>After 48 h, prepare the cells for cell sorting as described in section 5.3.</li>
	<li>Pick colonies ~10 days after plating single cells using a 200 &#956;L pipette. Transfer 100 &#956;L of cells to one well of a 24 or 48 well plate previously coated with gelatin and irradiated MEFs in hESC medium with Y-27632 dihydrochloride. Use the remaining 100 &#956;L for DNA isolation as described in section 6.</li>
</ol>
9. Checking for mutations in single colonies
<ol>
	<li>To check for successful integration of the ssODN, take 5 &#181;L of DNA isolated from each colony to perform PCR using the screening primers designed in section 2. Purify the PCR products (Table of Materials) and prepare the restriction enzyme digestion using the unique enzyme site created in the ssODN. 
	NOTE: This digestion also includes the restriction enzyme buffer and the manufacturer&#39;s recommended concentration of restriction enzyme in a volume of 40 &#181;L.</li>
	<li>Mix the reaction by pipetting and incubate at the manufacturer&#39;s recommended temperature for 1-3 h.</li>
	<li>Visualize the digested PCR products on a 1.5% (w/v) EtBr agarose gel electrophoresed at 80-100 V for 40 min. If successful integration of the ssODN has occurred, sequence specific mutations using a nested primer.</li>
</ol>

<ol><li>Srivastava, D., Dewitt, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Review+In+Vivo+Cellular+Reprogramming%3A+The+Next+Generation%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Review In Vivo Cellular Reprogramming: The Next Generation.</a> Cell. 166 (6), 1386-1396 (2016).</li>
<li>Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Review+Modeling+Development+and+Disease+with+Organoids%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Review Modeling Development and Disease with Organoids.</a> Cell. 165 (7), 1586-1597 (2016).</li>
<li>Murry, C. E., Keller, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Differentiation+of+Embryonic+Stem+Cells+to+Relevant+Populations%3A+Lessons+from+Embryonic+Development%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Differentiation of Embryonic Stem Cells to Relevant Populations: Lessons from Embryonic Development.</a> Cell. 132 (4), 661-680 (2008).</li>
<li>Liu, C., Oikonomopoulos, A., Sayed, N., Wu, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Modeling+human+diseases+with+induced+pluripotent+stem+cells%3A+from+2D+to+3D+and+beyond%5BTitle%5D)+AND+%22Development%22%5BJournal%5D)">Modeling human diseases with induced pluripotent stem cells: from 2D to 3D and beyond.</a> Development. 145 (5), 1-6 (2018).</li>
<li>Avior, Y., Sagi, I., Benvenisty, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Pluripotent+stem+cells+in+disease+modelling+and+drug+discovery%5BTitle%5D)+AND+%22Nature+Reviews+Molecular+Cell+Biology%22%5BJournal%5D)">Pluripotent stem cells in disease modelling and drug discovery.</a> Nature Reviews Molecular Cell Biology. 17 (3), 170-182 (2016).</li>
<li>Tiyaboonchai, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((GATA6+Plays+an+Important+Role+in+the+Induction+of+Human+Definitive+Endoderm%2C+Development+of+the+Pancreas%2C+and+Functionality+of+Pancreatic+%CE%B2+Cells%5BTitle%5D)+AND+%22Stem+Cell+Reports%22%5BJournal%5D)">GATA6 Plays an Important Role in the Induction of Human Definitive Endoderm, Development of the Pancreas, and Functionality of Pancreatic β Cells.</a> Stem Cell Reports. 8 (3), 589-604 (2017).</li>
<li>Guo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Using+hESCs+to+Probe+the+Interaction+of+the+Diabetes-Associated+Genes+CDKAL1+and+MT1E%5BTitle%5D)+AND+%22Cell+Reports%22%5BJournal%5D)">Using hESCs to Probe the Interaction of the Diabetes-Associated Genes CDKAL1 and MT1E.</a> Cell Reports. 19 (8), 1512-1521 (2017).</li>
<li>Zeng, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+Isogenic+Human+ESC+Platform+for+Functional+Evaluation+of+Genome-wide-Association-Study-Identified+Diabetes+Genes+and+Drug+Discovery%5BTitle%5D)+AND+%22Cell+Stem+Cell%22%5BJournal%5D)">An Isogenic Human ESC Platform for Functional Evaluation of Genome-wide-Association-Study-Identified Diabetes Genes and Drug Discovery.</a> Cell Stem Cell. 19 (3), 326-340 (2016).</li>
<li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome+editing+of+human+embryonic+stem+cells+and+induced+pluripotent+stem+cells+with+zinc+finger+nucleases+for+cellular+imaging%5BTitle%5D)+AND+%22Circulation+Research%22%5BJournal%5D)">Genome editing of human embryonic stem cells and induced pluripotent stem cells with zinc finger nucleases for cellular imaging.</a> Circulation Research. 111, 1494-1503 (2012).</li>
<li>Xue, H., Wu, J., Li, S., Rao, M. S., Liu, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genetic+Modification+in+Human+Pluripotent+Stem+Cells+by+Homologous+Recombination+and+CRISPR%2FCas9+System%5BTitle%5D)+AND+%22Methods+in+Molecular+Biology%22%5BJournal%5D)">Genetic Modification in Human Pluripotent Stem Cells by Homologous Recombination and CRISPR/Cas9 System.</a> Methods in Molecular Biology. 1307, 173-190 (2014).</li>
<li>Huang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Production+of+gene-corrected+adult+beta+globin+protein+in+human+erythrocytes+differentiated+from+patient+iPSCs+after+genome+editing+of+the+sickle+point+mutation%5BTitle%5D)+AND+%22Stem+Cells%22%5BJournal%5D)">Production of gene-corrected adult beta globin protein in human erythrocytes differentiated from patient iPSCs after genome editing of the sickle point mutation.</a> Stem Cells. 33 (5), 1470-1479 (2015).</li>
<li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Unbiased+detection+of+off-target+cleavage+by+CRISPR-Cas9+and+TALENs+using+integrase-defective+lentiviral+vectors%5BTitle%5D)+AND+%22Nature+Biotechnology%22%5BJournal%5D)">Unbiased detection of off-target cleavage by CRISPR-Cas9 and TALENs using integrase-defective lentiviral vectors.</a> Nature Biotechnology. 33 (2), 175-178 (2015).</li>
<li>Sim, X., Cardenas-Diaz, F. L., French, D. L., Gadue, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+Doxycycline-Inducible+System+for+Genetic+Correction+of+iPSC+Disease+Models%5BTitle%5D)+AND+%22Methods+in+Molecular+Biology%22%5BJournal%5D)">A Doxycycline-Inducible System for Genetic Correction of iPSC Disease Models.</a> Methods in Molecular Biology. 1353, 13-23 (2015).</li>
<li>Hockemeyer, D., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Review+Induced+Pluripotent+Stem+Cells+Meet+Genome+Editing%5BTitle%5D)+AND+%22Stem+Cell%22%5BJournal%5D)">Review Induced Pluripotent Stem Cells Meet Genome Editing.</a> Stem Cell. 18 (5), 573-586 (2016).</li>
<li>Byrne, S. M., Mali, P., Church, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome+editing+in+human+stem+cells%5BTitle%5D)+AND+%22Methods+in+Enzymology%22%5BJournal%5D)">Genome editing in human stem cells.</a> Methods in Enzymology. 546, 119-138 (2014).</li>
<li>Zhu, Z., González, F., Huangfu, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+iCRISPR+platform+for+rapid+genome+editing+in+human+pluripotent+stem+cells%5BTitle%5D)+AND+%22Methods+in+Enzymology%22%5BJournal%5D)">The iCRISPR platform for rapid genome editing in human pluripotent stem cells.</a> Methods in Enzymology. 546, 215-250 (2014).</li>
<li>Hou, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Efficient+genome+engineering+in+human+pluripotent+stem+cells+using+Cas9+from+Neisseria+meningitidis%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (39), 15644-15649 (2013).</li>
<li>Cong, L., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome+engineering+using+CRISPR-Cas9+system%5BTitle%5D)+AND+%22Methods+in+Molecular+Biology%22%5BJournal%5D)">Genome engineering using CRISPR-Cas9 system.</a> Methods in Molecular Biology. 1239, Clifton, N.J. 197-217 (2015).</li>
<li>Mali, P., Esvelt, K. M., Church, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cas9+as+a+versatile+tool+for+engineering+biology%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">Cas9 as a versatile tool for engineering biology.</a> Nature Methods. 10 (10), 957-963 (2013).</li>
<li>Richardson, C. D., Ray, G. J., DeWitt, M. A., Curie, G. L., Corn, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Enhancing+homology+directed+genome+editing+by+catalytically+active+and+inactive+CRISPR-Cas9+using+asymmetric+donor+DNA%5BTitle%5D)+AND+%22Nature+Biotechnology%22%5BJournal%5D)">Enhancing homology directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA.</a> Nature Biotechnology. 34 (3), 339-344 (2016).</li>
<li>Maguire, J. A., Cardenas-Diaz, F. L., Gadue, P., French, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Highly+efficient+crispr+cas9-mediated+genome+editing+in+human+pluripotent+stem+cells%5BTitle%5D)+AND+%22Current+Protocols+in+Stem+Cell+Biology%22%5BJournal%5D)">Highly efficient crispr cas9-mediated genome editing in human pluripotent stem cells.</a> Current Protocols in Stem Cell Biology. 48 (1), 64(2019).</li>
</ol>

The authors have nothing to disclose.

In this protocol, the use of CRISPR-CAS9 along with two ssODN repair templates to generate specific heterozygous or homozygous genome changes is demonstrated in human pluripotent stem cells. This method resulted in the successful generation of isogenic cell lines expressing heterozygous genomic changes with an efficiency close to 10%. This protocol has been optimized for both human ESCs and iPSCs grown on irradiated MEFs which support cell growth and survival after culturing cells at low density after cell sorting. Cell ...

Human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs) are valuable tools for modeling human disease due to their capacity for renewal, while maintaining the ability to generate cell types of different lineages1,2,3,4. These models open the possibility to interrogate gene function, and understand how specific mutations and phenotypes are related to various diseases5,6. However, to understand how a specific alteration is linked to a particular phenotype, the use of a paired isogenic control and mutant cell lines is important to control for line to line variability7,8. Transcription activator-like effector nucleases (TALENs) and zinc finger nucleases have been used to generate insertion or deletion (indels) mutations in diverse genetic models, including primary cells; but these nucleases can be cumbersome to use and expensive9,10,11,12,13,14. The discovery of the clustered regularly interspaced short palindromic repeat (CRISPR)-CAS9 nuclease has revolutionized the field due to efficiency in indel formation in virtually any region of the genome, simplicity of use, and reduction in cost15,16,17,18,19.
A challenge in using the CRISPR-CAS9 based genome editing technology has been the generation or correction of specific mutations in one allele without creating an indel mutation in the second allele20. The major goal of this protocol is to overcome this challenge by using two single-stranded oligonucleotide (ssODN) repair templates to reduce indel formation in the second allele. Both ssODNs are designed to contain silent mutations to prevent re-cutting by the CAS9 nuclease, but only one contains the alteration of interest. This method increases the efficiency of generating a specific heterozygous genetic modification without inducing indel formation in the second allele. Using this protocol, gene editing experiments in six independent genomic locations demonstrate the precise introduction of the desired genomic change in one allele without indel formation in the second allele and occurs with an overall efficiency of ~10%. The described protocol has been adapted from Maguire et al.21.

<table><tbody><tr><td>5-ml polystyrene round-bottom tube with cell-strainer cap</td><td>Corning</td><td>352235</td><td></td></tr><tr><td>6-well polystyrene tissue culture dishes</td><td>Corning</td><td>353046</td><td></td></tr><tr><td>AflII restriction endonuclease</td><td>New England Biolabs</td><td>R0520</td><td></td></tr><tr><td>Agarose</td><td>VWR</td><td>N605</td><td></td></tr><tr><td>DMEM/F12 medium</td><td>ThermoFisher</td><td>11320033</td><td></td></tr><tr><td>dNTPs</td><td>Roche</td><td>11969064001</td><td></td></tr><tr><td>Fluorescence-activated cell sorter (FACS) apparatus</td><td></td><td></td><td></td></tr><tr><td>Gel extraction kit</td><td>Macherey-Nagel</td><td>740609</td><td></td></tr><tr><td>Gibson Assembly Kit</td><td>New England Biolabs</td><td>E2611</td><td></td></tr><tr><td>gRNA_Cloning Vector</td><td>Addgene</td><td>41824</td><td></td></tr><tr><td>LB agar plates containing 50 &amp;mu;g/ml kanamycin</td><td></td><td></td><td></td></tr><tr><td>Lipofectamine Stem Reagent</td><td>ThermoFisher</td><td>(STEM00001)</td><td></td></tr><tr><td>Matrigel Growth Factor Reduced (GFR)</td><td>Corning</td><td>354230</td><td></td></tr><tr><td>Murine embryonic fibroblasts (MEFs)</td><td></td><td></td><td></td></tr><tr><td>Nucleospin Gel Extraction and PCR Clean-up Kit</td><td>Macherey-Nagel</td><td>740609</td><td></td></tr><tr><td>Orbital shaking incubator</td><td></td><td></td><td></td></tr><tr><td>pCas9_GFP vector</td><td>Addgene</td><td>44719</td><td></td></tr><tr><td>PCR strip tubes</td><td>USA Scientific</td><td>1402-2900</td><td></td></tr><tr><td>Phusion High Fidelity DNA Polymerase and 5&amp;times; Phusion buffer</td><td>New England Biolabs</td><td>M0530</td><td></td></tr><tr><td>PurelinkTM Quick Plasmid Miniprep Kit</td><td>Invitrogen</td><td>K210011</td><td></td></tr><tr><td>Proteinase K</td><td>Qiagen</td><td>Qiagen 19133</td><td></td></tr><tr><td>StellarTM electrocompetent Escherichia coli cells</td><td>Takara</td><td>636763</td><td></td></tr><tr><td>SOC medium</td><td>New England Biolabs</td><td>B9020S</td><td></td></tr><tr><td>TrypLE Express Enzyme</td><td>ThermoFisher</td><td>12605036</td><td></td></tr><tr><td>Y-27632 dihydrochloride/ROCK inhibitor (ROCKi)</td><td>Tocris</td><td>1254</td><td></td></tr></tbody></table>

generation of defined genomic modifications using crispr-cas9 in human pluripotent stem cells

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise heterozygous genetic modifications is challenging due to CRISPR-CAS9 mediated indel formation in the second allele. Here, we demonstrate a protocol to help overcome this difficulty by using two repair templates in which only one expresses the desired sequence change, while both templates contain silent mutations to prevent re-cutting and indel formation. This methodology is most advantageous for gene editing coding regions of DNA to generate isogenic control and mutant human stem cell lines for studying human disease and biology. In addition, optimization of transfection and screening methodologies have been performed to reduce labor and cost of a gene editing experiment. Overall, this protocol is widely applicable to many genome editing projects utilizing the human pluripotent stem cell model.

Generation of gRNAs and screening for indels
Each gRNA will be cloned into a plasmid vector and expressed using the U6 promoter. The AflII restriction enzyme is used to linearize the plasmid (addgene #41824) and is located after the U6 promoter. The 100 bp band generated after annealing the two 60 bp oligos is cloned into the gRNA expression vector using the DNA assembly. Once the gRNA plasmids are generated, they are transfected into hESCs or iPSCs along with a CRISP...

Watch this Scientific Journal Video about Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells at JoVE.com

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

This protocol provides a method to facilitate the generation of defined heterozygous or homozygous nucleotide changes using CRISPR-CAS9 in human pluripotent stem cells.

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...

generation-defined-genomic-modifications-using-crispr-cas9-human

Research

JoVE Journal

Genetics

8.2K Views.  The Children's Hospital of Philadelphia. De studie van genfunctie en ziekte wordt belemmerd door de outbred aard van de menselijke bevolking. De verschillende genetische achtergronden van patiëntspecifieke en controle-iPS-cellijnen kunnen de differentiatie-efficiëntie en fenotypes in een bepaalde functionele test beïnvloeden. Gebruik van genetisch identieke of isogene lijnen waarbij het enige verschil is dat de specifieke mutatie van belang van cruciaal belang is om deze problemen te overwinnen.Veel menselijke ziekten word...

Video: Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Transfection, Selection, and Colony-picking of Human Induced Pluripotent Stem Cells TALEN-targeted with a GFP Gene into the AAVS1 Safe Harbor

Targeted transgene addition can provide persistent gene expression while circumventing the gene silencing and insertional mutagenesis caused by viral vector mediated random integration. This protocol describes a universal and efficient transgene targeted addition platform in human iPSCs based on utilization of validated open-source TALENs and a gene-trap-like donor to deliver transgenes into a safe harbor locus. Importantly, effective gene editing is rate-limited by the delivery efficiency of gene editing vectors. Therefore, this protocol first focuses on preparation of iPSCs for transfection to achieve high nuclear delivery efficiency. When iPSCs are dissociated into single cells using a gentle-cell dissociation reagent and transfected using an optimized program, >50% cells can be induced to take up the large gene editing vectors. Because the AAVS1 locus is located in the intron of an active gene (PPP1R12C), a splicing acceptor (SA)-linked puromycin resistant gene (PAC) was used to select targeted iPSCs while excluding random integration-only and untransfected cells. This strategy greatly increases the chance of obtaining targeted clones, and can be used in other active gene targeting experiments as well. Two weeks after puromycin selection at the dose adjusted for the specific iPSC line, clones are ready to be picked by manual dissection of large, isolated colonies into smaller pieces that are transferred to fresh medium in a smaller well for further expansion and genetic and functional screening. One can follow this protocol to readily obtain multiple GFP reporter iPSC lines that are useful for in vivo and in vitro imaging and cell isolation.

TALEN-mediated gene editing at the safe harbor AAVS1 locus enables high-efficiency transgene addition in human iPSCs. This protocol describes the procedures for preparing iPSCs for TALEN and donor vector delivery, transfecting iPSCs, and selecting and isolating iPSC clones to achieve targeted integration of a GFP gene to generate reporter lines.

Targeted transgene addition can provide persistent gene expression while circumventing the gene silencing and insertional mutagenesis caused by viral ...

Developmental Biology

Efficient Generation of hiPSC Neural Lineage Specific Knockin Reporters Using the CRISPR/Cas9 and Cas9 Double Nickase System

Gene targeting is a critical approach for characterizing gene functions in modern biomedical research. However, the efficiency of gene targeting in human cells has been low, which prevents the generation of human cell lines at a desired rate. The past two years have witnessed a rapid progression on improving efficiency of genetic manipulation by genome editing tools such as the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas (CRISPR-associated) system. This manuscript describes a protocol for generating lineage specific human induced pluripotent stem cell (hiPSC) reporters using CRISPR/Cas system assisted homologous recombination. Procedures for obtaining necessary components for making neural lineage reporter lines using the CRISPR/Cas system, focusing on construction of targeting vectors and single guide RNAs, are described. This protocol can be extended to platform establishment and mutation correction in hiPSCs.

Genome editing tools such as the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas (CRISPR-associated) system have greatly improved gene targeting efficiency in human induced pluripotent stem cells (hiPSCs). This manuscript describes a protocol for generating lineage specific hiPSC reporter using CRISPR/Cas system assisted homologous recombination.

Gene targeting is a critical approach for characterizing gene functions in modern biomedical research. However, the efficiency of gene targeting in human ...

Genome Editing and Directed Differentiation of hPSCs for Interrogating Lineage Determinants in Human Pancreatic Development

Interrogating gene function in self-renewing or differentiating human pluripotent stem cells (hPSCs) offers a valuable platform towards understanding human development and dissecting disease mechanisms in a dish. To capitalize on this potential application requires efficient genome-editing tools to generate hPSC mutants in disease-associated genes, as well as in vitro hPSC differentiation protocols to produce disease-relevant cell types that closely recapitulate their in vivo counterparts. An efficient genome-editing platform for hPSCs named iCRISPR has been developed through the TALEN-mediated targeting of a Cas9 expression cassette in the AAVS1 locus. Here, the protocols for the generation of inducible Cas9 hPSC lines using cells cultured in a chemically defined medium and a feeder-free condition are described. Detailed procedures for using the iCRISPR system for gene knockout or precise genetic alterations in hPSCs, either through non-homologous end joining (NHEJ) or via precise nucleotide alterations using a homology-directed repair (HDR) template, respectively, are included. These technical procedures include descriptions of the design, production, and transfection of CRISPR guide RNAs (gRNAs); the measurement of the CRISPR mutation rate by T7E1 or RFLP assays; and the establishment and validation of clonal mutant lines. Finally, we chronicle procedures for hPSC differentiation into glucose-responsive pancreatic &#946;-like cells by mimicking in vivo pancreatic embryonic development. Combining iCRISPR technology with directed hPSC differentiation enables the systematic examination of gene function to further our understanding of pancreatic development and diabetes disease mechanisms.

Protocols to generate hPSC mutant lines using the iCRISPR platform and to differentiate hPSCs into glucose-responsive &#946;-like cells are described. Combining genome editing technology with hPSC-directed differentiation provides a powerful platform for the systematic analysis of the role of lineage determinants in human development and disease progression.

Interrogating gene function in self-renewing or differentiating human pluripotent stem cells (hPSCs) offers a valuable platform towards understanding ...

Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation

Genome-editing of human pluripotent stem cells (hPSCs) provides a genetically controlled and clinically relevant platform from which to understand human development and investigate the pathophysiology of disease. By employing site-specific nucleases (SSNs) for genome editing, the rapid derivation of new hPSC lines harboring specific genetic alterations in an otherwise isogenic setting becomes possible. Zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 are the most commonly used SSNs. All of these nucleases function by introducing a double stranded DNA break at a specified site, thereby promoting precise gene editing at a genomic locus. SSN-meditated genome editing exploits two of the cell&#39;s endogenous DNA repair mechanisms, non-homologous end joining (NHEJ) and homology directed repair (HDR), to either introduce insertion/deletion mutations or alter the genome using a homologous repair template at the site of the double stranded break. Electroporation of hPSCs is an efficient means of transfecting SSNs and repair templates that incorporate transgenes such as fluorescent reporters and antibiotic resistance cassettes. After electroporation, it is possible to isolate only those hPSCs that incorporated the repair construct by selecting for antibiotic resistance. Mechanically separating hPSC colonies and confirming proper integration at the target site through genotyping allows for the isolation of correctly targeted and genetically homogeneous cell lines. The validity of this protocol is demonstrated here by using all three SSN platforms to incorporate EGFP and a puromycin resistance construct into the AAVS1 safe harbor locus in human pluripotent&#160;stem cells.

Genome editing of human pluripotent stem cells (hPSCs) can be done quickly and efficiently. Presented here is a robust experimental procedure to genetically engineer hPSCs as exemplified by editing the AAVS1 safe harbor locus to express EGFP and introduce antibiotic resistance.

Genome-editing of human pluripotent stem cells (hPSCs) provides a genetically controlled and clinically relevant platform from which to understand human ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Endogenous Protein Tagging in Human Induced Pluripotent Stem Cells Using CRISPR/Cas9

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or C-terminal fluorescent tags. The prokaryotic CRISPR/Cas9 system (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9) may be used to introduce large exogenous sequences into genomic loci via homology directed repair (HDR). To achieve the desired knock-in, this protocol employs the ribonucleoprotein (RNP)-based approach where wild type Streptococcus pyogenes Cas9 protein, synthetic 2-part guide RNA (gRNA), and a donor template plasmid are delivered to the cells via electroporation. Putatively edited cells expressing the fluorescently tagged proteins are enriched by fluorescence activated cell sorting (FACS). Clonal lines are then generated and can be analyzed for precise editing outcomes. By introducing the fluorescent tag at the genomic locus of the gene of interest, the resulting subcellular localization and dynamics of the fusion protein can be studied under endogenous regulatory control, a key improvement over conventional overexpression systems. The use of hiPSCs as a model system for gene tagging provides the opportunity to study the tagged proteins in diploid, nontransformed cells. Since hiPSCs can be differentiated into multiple cell types, this approach provides the opportunity to create and study tagged proteins in a variety of isogenic cellular contexts.

Described here is a protocol for tagging endogenously expressed proteins with fluorescent tags in human induced pluripotent stem cells using CRISPR/Cas9. Putatively edited cells are enriched by fluorescence activated cell sorting and clonal cell lines are generated.

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or ...

Genome Editing in Mammalian Cell Lines using CRISPR-Cas

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been successfully repurposed for genome engineering in many different living organisms. Most commonly, the wildtype CRISPR associated 9 (Cas9) or Cas12a endonuclease is used to cleave specific sites in the genome, after which the DNA double-stranded break is repaired via the non-homologous end joining (NHEJ) pathway or the homology-directed repair (HDR) pathway depending on whether a donor template is absent or present respectively. To date, CRISPR systems from different bacterial species have been shown to be capable of performing genome editing in mammalian cells. However, despite the apparent simplicity of the technology, multiple design parameters need to be considered, which often leave users perplexed about how best to carry out their genome editing experiments. Here, we describe a complete workflow from experimental design to identification of cell clones that carry desired DNA modifications, with the goal of facilitating successful execution of genome editing experiments in mammalian cell lines. We highlight key considerations for users to take note of, including the choice of CRISPR system, the spacer length, and the design of a single-stranded oligodeoxynucleotide (ssODN) donor template. We envision that this workflow will be useful for gene knockout studies, disease modeling efforts, or the generation of reporter cell lines.

CRISPR-Cas is a powerful technology to engineer the complex genomes of plants and animals. Here, we detail a protocol to efficiently edit the human genome using different Cas endonucleases. We highlight important considerations and design parameters to optimize editing efficiency.

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been ...

Introducing Point Mutations into Human Pluripotent Stem Cells Using Seamless Genome Editing

Custom designed endonucleases, such as RNA-guided Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9, enable efficient genome editing in mammalian cells. Here we describe detailed procedures to seamlessly genome edit the hepatocyte nuclear factor 4 alpha (HNF4&#945;) locus as an example in human pluripotent stem cells. Combining a piggyBac-based donor plasmid and the CRISPR-Cas9 nickase mutant in a two-step genetic selection, we demonstrate correct and efficient targeting of the HNF4&#945; locus.

Here, we describe a detailed method for seamless gene editing in human pluripotent stem cells using a piggyBac-based donor plasmid and the Cas9 nickase mutant. Two point mutations were introduced into exon 8 of the hepatocyte nuclear factor 4 alpha (HNF4&#945;) locus in human embryonic stem cells (hESCs).

Custom designed endonucleases, such as RNA-guided Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9, enable efficient genome editing ...

Efficient Generation and Editing of Feeder-free IPSCs from Human Pancreatic Cells Using the CRISPR-Cas9 System

Embryonic and induced pluripotent stem cells can self-renew and differentiate into multiple cell types of the body. The pluripotent cells are thus coveted for research in regenerative medicine and are currently in clinical trials for eye diseases, diabetes, heart diseases, and other disorders. The potential to differentiate into specialized cell types coupled with the recent advances in genome editing technologies including the CRISPR/Cas system have provided additional opportunities for tailoring the genome of iPSC for varied applications including disease modeling, gene therapy, and biasing pathways of differentiation, to name a few. Among the available editing technologies, the CRISPR/Cas9 from Streptococcus pyogenes has emerged as a tool of choice for site-specific editing of the eukaryotic genome. The CRISPRs are easily accessible, inexpensive, and highly efficient in engineering targeted edits. The system requires a Cas9 nuclease and a guide sequence (20-mer) specific to the genomic target abutting a 3-nucleotide &#34;NGG&#34; protospacer-adjacent-motif (PAM) for targeting Cas9 to the desired genomic locus, alongside a universal Cas9 binding tracer RNA (together called single guide RNA or sgRNA). Here we present a step-by-step protocol for efficient generation of feeder-independent and footprint-free iPSC and describe methodologies for genome editing of iPSC using the Cas9 ribonucleoprotein (RNP) complexes. The genome editing protocol is effective and can be easily multiplexed by pre-complexing sgRNAs for more than one target with the Cas9 protein and simultaneously delivering into the cells. Finally, we describe a simplified approach for identification and characterization of iPSCs with desired edits. Taken together, the outlined strategies are expected to streamline generation and editing of iPSC for manifold applications.

This protocol describes in detail the generation of footprint-free induced pluripotent stem cells (iPSCs) from human pancreatic cells in feeder-free conditions, followed by editing using CRISPR/Cas9 ribonucleoproteins and characterization of the modified single-cell clones.

Embryonic and induced pluripotent stem cells can self-renew and differentiate into multiple cell types of the body. The pluripotent cells are thus coveted ...

Bioengineering

CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical application of this technique, particularly in pluripotent stem cells, presents certain challenges, such as being time- and labor-intensive and having low editing efficiency. Here, we describe the generation of a CRISPR-mediated gene knockout in a human embryonic stem cell (hESC) line stably expressing sgRNAs for the L2HGDH gene, using a highly efficient and stable lentiviral-mediated gene delivery system. The sgRNAs targeting exon 1 of the L2HGDH gene were chemically synthesized and cloned into the lentiCRISPR v2-puro vector, which combines the constitutive expression of sgRNAs with Cas9 in a highly efficient single-vector system to achieve higher lentiviral titers for hESC infection and stable selection using puromycin. Puromycin-selected cells were further expanded, and single-cell clones were obtained using the limited dilution method. The single clones were expanded, and several homozygous knockout clones for the L2HGDH gene were obtained, as confirmed by a 100% reduction in L2HGDH expression using Western blot analysis. Furthermore, using MSBSP-PCR, the CRISPR mutation site was mapped upstream of the PAM recognition sequence of Cas9 in the selected homozygous clones. Sanger sequencing was performed to analyze the exact insertions/deletions, and functional characterization of the clones was conducted. This method produced a significantly higher percentage of homozygous deletions compared to previously reported non-viral gene delivery methods. Although this report focuses on the L2HGDH gene, this robust and cost-effective approach can be used to create homozygous knockouts for other genes in pluripotent stem cells for gene function studies.

The presented method describes the generation of a CRISPR-mediated gene knockout in the human embryonic stem cell (hESC) line H9, which stably expresses sgRNAs targeting the L2HGDH gene using a highly efficient lentiviral-mediated gene delivery system.

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical ...

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Samenvatting

Meer video's verkennen