This research was supported by funding from the National Heart, Lung, and Blood Institute (NHLBI), National Institutes of Health through grants U01HL099656 (P.G. and D.L.F.) and U01HL134696 (P.G. and D.L.F.).

1. Design and construction of guide RNA (gRNA)
NOTE: Each gRNA is made up of two 60 base pair (bp) oligonucleotides that are annealed to generate a 100 bp double stranded (ds) oligonucleotide (Figure 1A-C). The timeline for gRNA design, generation, and testing cutting efficiency is approximately 2 weeks (Figure 2).
<ol>
	<li>Select the DNA region of interest to be genome edited and identify 3-4 23 bp sequences that fit the format, 5&#39;-G(N19)NGG-3&#39;. These sequences should be located within 20 bp of the region of interest. 
	NOTE: Targeting can be performed on the sense or anti-sense strand.</li>
	<li>Evaluate the gRNA sequences for genomic redundancy and off-target probability using a resource such as CRISPOR (http://crispor.tefor.net).</li>
	<li>Incorporate the 20 bp target sequence (excluding the protospacer adjacent motif or PAM) into two 60-mer oligonucleotides as shown (sequences are 5&#39;&#160;to 3&#39;&#160;and red and green are reverse complements as shown in Figure 1C).</li>
	<li>Order the two 60 bp oligonucleotides from vendor of choice. Once the oligonucleotides are received, resuspend each to a final concentration of 100 &#181;M in ddH2O. Make a working stock of 10 &#181;M.</li>
	<li>Anneal the two oligonucleotides and generate a 100 bp dsDNA fragment using DNA polymerase (Table of Materials). Combine 5 &#181;L of 10 &#181;M forward oligonucleotide and 5 &#181;L of 10 &#181;M reverse oligonucleotide in a polymerase chain reaction (PCR) strip tube and incubate at 95 &#176;C for 5 min. Cool the reaction for 10 min at room temperature (RT).</li>
	<li>Set up the PCR as described in Table 1. Perform PCR amplification in a thermal cycler using the parameters outlined in Table 2.</li>
	<li>Visualize the PCR products on a 1.5% (w/v) ethidium bromide (EtBr) agarose gel electrophoresed at 80-100 V for 40 min. Excise the 100 bp band (Figure 3A), visualized on an LED light box, from the gel using a razor blade and purify using a gel extraction kit (Table of Materials).</li>
</ol>
2. Design of PCR primers for screening
<ol>
	<li>Perform screening of the edited DNA using forward and reverse PCR primers that are specifically designed to amplify a 400-500 bp region of the gene of interest (Table 2). Use DNA isolated from any control iPSC line to confirm a clean amplicon when performing the screening PCR.</li>
	<li>Visualize PCR products on a 1.5% (w/v) gel following electrophoresis at 80-100 V for 1 h. 
	NOTE: Sequencing of edited clones is performed using a nested primer that is designed following confirmation of the screening primer set. Samples are sent to a commercial source for sequencing.</li>
</ol>
3. Preparation of gRNA_cloning vector plasmid
<ol>
	<li>To linearize the cloning vector, take a 1.5 mL centrifuge tube and add 1-5 &#181;g of DNA of the gRNA_cloning vector along with 4 &#181;L of the AflII restriction enzyme buffer and 1.5 &#181;L of AflII restriction enzyme. Bring up the reaction to 24 &#181;L of ddH2O. Mix the reaction by pipetting up and down. Incubate at 37 &#176;C overnight (O/N).</li>
	<li>Electrophorese on a 1% agarose gel at 80-100 V for 1 h and excise bands (expected band size is ~3519 bp).</li>
	<li>Extract and purify as in step 1.6.</li>
</ol>
4. Assembly of gRNA vector
<ol>
	<li>Set up reactions and assemble DNA fragments using the assembly kit (Table of Materials) at 1:5 ratios of AflII digested gRNA cloning vector to 100 bp gel purified insert, as described in Table 3.</li>
	<li>Incubate the reaction at 50 &#176;C for 15 min. Dilute the reaction 1:3 in ddH2O and use 3 &#181;L for bacterial transformation, as per manufacturer&#8217;s instructions (Table of Materials). Plate cells on kanamycin LB/agar plates.</li>
	<li>Pick 3-5 colonies per gRNA. Inoculate each colony in 4 mL of LB and grow O/N at 37 &#176;C in an orbital shaking incubator.</li>
	<li>Purify plasmid DNA using a miniprep plasmid isolation kit, and sequence each gRNA using the following primers to ensure successful cloning: Forward: GTACAAAAAAGCAGGCTTTAAAGG; Reverse: TGCCAACTTTGTACAAGAAAGCT.</li>
</ol>
5. Test gRNA cutting efficiency
<ol>
	<li>Plate hESCs on irradiated murine embryonic fibroblasts (MEFs) in a 6-well plate, as previously described21. When the cells reach 70-80% confluency, prepare the transfection master mix outlined in Table 4.</li>
	<li>Mix by pipetting and incubate at RT for 15 min. Add dropwise to the cells and incubate at 37 &#176;C for 48 h (with a media change after 24 h).</li>
	<li>Harvest cells for sorting after 48 h.
	<ol>
		<li>Remove MEFs enzymatically (Table of Materials) with a 3 min RT incubation.</li>
		<li>Rinse cells 1x with hESC medium (Table 5) and scrape into hESC medium + 10 &#181;M Y-27632 dihydrochloride (Table of Materials).</li>
		<li>Pellet cells at 300 x g for 3 min and resuspend in 0.5 mL of hESC medium + 10 &#181;M Y-27632 dihydrochloride.</li>
		<li>Filter into a 5 mL tube through a 35 &#181;m cell-strainer cap.</li>
	</ol>
	</li>
	<li>Using fluorescence activated cell sorting (FACS), gate on live cells and sort the green fluorescent protein (GFP) positive cells.</li>
	<li>Transfer a maximum of 1.5 x 104 sorted cells directly into a 10 cm2 dish coated with 1:3 basement membrane matrix (Table of Materials) and irradiated MEFs in hESC medium (Table 5) containing Y-27632 dihydrochloride.</li>
	<li>Change medium daily using the hESC medium (Table 5) without Y-27632 dihydrochloride and manually pick clones after 10-15 days, when colonies are ~1 mm in diameter.
	<ol>
		<li>Using a P200 pipette and microscope, carefully scrape a single clone and draw cells into the pipette.</li>
		<li>Disperse the cells by gently pipetting 3-4x in a 96 well plate in the medium drawn up with the colony.</li>
		<li>Dispense into PCR strip tubes for screening and pellet the cells by centrifugation at 10,000 x g for 5 min. Pick 20 colonies per gRNA.</li>
	</ol>
	</li>
</ol>
6. Clone screening
<ol>
	<li>Isolate DNA by incubating cell pellets in 20 &#181;L of proteinase K buffer (Table 5) (1 h at 55 &#176;C and 10 min at 95 &#176;C) and vortex vigorously. Centrifuge at 10,000 x g for 5 min and collect the supernatant.</li>
	<li>Perform screening PCR (section 2) in a total volume of 20 &#181;L using a master mix including primers designed to amplify the region of interest and 5 &#181;L of the proteinase K digest. Use genomic DNA isolated from the cell line that was gene edited as a control.</li>
	<li>Evaluate size changes of PCR products following 1 h electrophoresis at 70-90 V on a 2.5% (w/v) agarose gel (Figure 3B,C). Any size difference is indicative of cleavage.</li>
</ol>
7. Precise genome editing in pluripotent stem cells using single strand oligo DNA (ssODNs)
<ol>
	<li>Design 100 bp ssODNs centered around the most efficient gRNA sequence determined to have the best cutting efficiency.</li>
	<li>Prevent re-cleavage of the recombined ODN by introducing silent mutations in the gRNA sequence. A single silent mutation in the PAM sequence is sufficient, but if not possible, 3-4 silent mutations will work. 
	NOTE: To facilitate screening of targeted clones, the introduction of a restriction site within ~20 bp of the gRNA sequence is ideal.</li>
	<li>Design one ODN with the desired base change(s) to create the mutation of interest and one ODN without the base change(s). 
	NOTE: These changes should be no more than ~20 bp from the predicted CRISPR/CAS9 cut site, as recombination drops off considerably at greater distances.</li>
	<li>Order the two ssODNs from vendor of choice and resuspend in water to make 1 &#181;g/&#181;L stocks. Store stocks at -20 &#176;C.</li>
</ol>
8. Transfection setup
<ol>
	<li>To transfect the ssODN and the CRISPR-CAS9 plasmids, plate the target cell line in a 6-well dish on irradiated MEFs to reach 70-80% confluency after an O/N incubation.</li>
	<li>Set up the transfection reaction as described in Table 6. Mix the reaction by pipetting and incubate for 15 min at RT. Add the transfection reaction mixture dropwise to the cells.</li>
	<li>After 48 h, prepare the cells for cell sorting as described in section 5.3.</li>
	<li>Pick colonies ~10 days after plating single cells using a 200 &#956;L pipette. Transfer 100 &#956;L of cells to one well of a 24 or 48 well plate previously coated with gelatin and irradiated MEFs in hESC medium with Y-27632 dihydrochloride. Use the remaining 100 &#956;L for DNA isolation as described in section 6.</li>
</ol>
9. Checking for mutations in single colonies
<ol>
	<li>To check for successful integration of the ssODN, take 5 &#181;L of DNA isolated from each colony to perform PCR using the screening primers designed in section 2. Purify the PCR products (Table of Materials) and prepare the restriction enzyme digestion using the unique enzyme site created in the ssODN. 
	NOTE: This digestion also includes the restriction enzyme buffer and the manufacturer&#39;s recommended concentration of restriction enzyme in a volume of 40 &#181;L.</li>
	<li>Mix the reaction by pipetting and incubate at the manufacturer&#39;s recommended temperature for 1-3 h.</li>
	<li>Visualize the digested PCR products on a 1.5% (w/v) EtBr agarose gel electrophoresed at 80-100 V for 40 min. If successful integration of the ssODN has occurred, sequence specific mutations using a nested primer.</li>
</ol>

<ol>
	<li>Srivastava, D., Dewitt, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review+In+Vivo+Cellular+Reprogramming:+The+Next+Generation.">Review In Vivo Cellular Reprogramming: The Next Generation.</a> Cell. 166 (6), 1386-1396 (2016).</li><li>Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review+Modeling+Development+and+Disease+with+Organoids.">Review Modeling Development and Disease with Organoids.</a> Cell. 165 (7), 1586-1597 (2016).</li><li>Murry, C. E., Keller, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+Embryonic+Stem+Cells+to+Relevant+Populations:+Lessons+from+Embryonic+Development.">Differentiation of Embryonic Stem Cells to Relevant Populations: Lessons from Embryonic Development.</a> Cell. 132 (4), 661-680 (2008).</li><li>Liu, C., Oikonomopoulos, A., Sayed, N., Wu, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+human+diseases+with+induced+pluripotent+stem+cells:+from+2D+to+3D+and+beyond.">Modeling human diseases with induced pluripotent stem cells: from 2D to 3D and beyond.</a> Development. 145 (5), 1-6 (2018).</li><li>Avior, Y., Sagi, I., Benvenisty, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pluripotent+stem+cells+in+disease+modelling+and+drug+discovery.">Pluripotent stem cells in disease modelling and drug discovery.</a> Nature Reviews Molecular Cell Biology. 17 (3), 170-182 (2016).</li><li>Tiyaboonchai, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GATA6+Plays+an+Important+Role+in+the+Induction+of+Human+Definitive+Endoderm,+Development+of+the+Pancreas,+and+Functionality+of+Pancreatic+&#946;+Cells.">GATA6 Plays an Important Role in the Induction of Human Definitive Endoderm, Development of the Pancreas, and Functionality of Pancreatic &#946; Cells.</a> Stem Cell Reports. 8 (3), 589-604 (2017).</li><li>Guo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+hESCs+to+Probe+the+Interaction+of+the+Diabetes-Associated+Genes+CDKAL1+and+MT1E.">Using hESCs to Probe the Interaction of the Diabetes-Associated Genes CDKAL1 and MT1E.</a> Cell Reports. 19 (8), 1512-1521 (2017).</li><li>Zeng, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Isogenic+Human+ESC+Platform+for+Functional+Evaluation+of+Genome-wide-Association-Study-Identified+Diabetes+Genes+and+Drug+Discovery.">An Isogenic Human ESC Platform for Functional Evaluation of Genome-wide-Association-Study-Identified Diabetes Genes and Drug Discovery.</a> Cell Stem Cell. 19 (3), 326-340 (2016).</li><li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+editing+of+human+embryonic+stem+cells+and+induced+pluripotent+stem+cells+with+zinc+finger+nucleases+for+cellular+imaging.">Genome editing of human embryonic stem cells and induced pluripotent stem cells with zinc finger nucleases for cellular imaging.</a> Circulation Research. 111, 1494-1503 (2012).</li><li>Xue, H., Wu, J., Li, S., Rao, M. S., Liu, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Modification+in+Human+Pluripotent+Stem+Cells+by+Homologous+Recombination+and+CRISPR/Cas9+System.">Genetic Modification in Human Pluripotent Stem Cells by Homologous Recombination and CRISPR/Cas9 System.</a> Methods in Molecular Biology. 1307, 173-190 (2014).</li><li>Huang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+gene-corrected+adult+beta+globin+protein+in+human+erythrocytes+differentiated+from+patient+iPSCs+after+genome+editing+of+the+sickle+point+mutation.">Production of gene-corrected adult beta globin protein in human erythrocytes differentiated from patient iPSCs after genome editing of the sickle point mutation.</a> Stem Cells. 33 (5), 1470-1479 (2015).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unbiased+detection+of+off-target+cleavage+by+CRISPR-Cas9+and+TALENs+using+integrase-defective+lentiviral+vectors.">Unbiased detection of off-target cleavage by CRISPR-Cas9 and TALENs using integrase-defective lentiviral vectors.</a> Nature Biotechnology. 33 (2), 175-178 (2015).</li><li>Sim, X., Cardenas-Diaz, F. L., French, D. L., Gadue, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Doxycycline-Inducible+System+for+Genetic+Correction+of+iPSC+Disease+Models.">A Doxycycline-Inducible System for Genetic Correction of iPSC Disease Models.</a> Methods in Molecular Biology. 1353, 13-23 (2015).</li><li>Hockemeyer, D., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review+Induced+Pluripotent+Stem+Cells+Meet+Genome+Editing.">Review Induced Pluripotent Stem Cells Meet Genome Editing.</a> Stem Cell. 18 (5), 573-586 (2016).</li><li>Byrne, S. M., Mali, P., Church, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+editing+in+human+stem+cells.">Genome editing in human stem cells.</a> Methods in Enzymology. 546, 119-138 (2014).</li><li>Zhu, Z., Gonz&#225;lez, F., Huangfu, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+iCRISPR+platform+for+rapid+genome+editing+in+human+pluripotent+stem+cells.">The iCRISPR platform for rapid genome editing in human pluripotent stem cells.</a> Methods in Enzymology. 546, 215-250 (2014).</li><li>Hou, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+engineering+in+human+pluripotent+stem+cells+using+Cas9+from+Neisseria+meningitidis.">Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (39), 15644-15649 (2013).</li><li>Cong, L., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+using+CRISPR-Cas9+system.">Genome engineering using CRISPR-Cas9 system.</a> Methods in Molecular Biology. 1239, 197-217 (2015).</li><li>Mali, P., Esvelt, K. M., Church, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cas9+as+a+versatile+tool+for+engineering+biology.">Cas9 as a versatile tool for engineering biology.</a> Nature Methods. 10 (10), 957-963 (2013).</li><li>Richardson, C. D., Ray, G. J., DeWitt, M. A., Curie, G. L., Corn, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+homology+directed+genome+editing+by+catalytically+active+and+inactive+CRISPR-Cas9+using+asymmetric+donor+DNA.">Enhancing homology directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA.</a> Nature Biotechnology. 34 (3), 339-344 (2016).</li><li>Maguire, J. A., Cardenas-Diaz, F. L., Gadue, P., French, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+crispr+cas9-mediated+genome+editing+in+human+pluripotent+stem+cells.">Highly efficient crispr cas9-mediated genome editing in human pluripotent stem cells.</a> Current Protocols in Stem Cell Biology. 48 (1), 64 (2019).</li></ol>

The authors have nothing to disclose.

In this protocol, the use of CRISPR-CAS9 along with two ssODN repair templates to generate specific heterozygous or homozygous genome changes is demonstrated in human pluripotent stem cells. This method resulted in the successful generation of isogenic cell lines expressing heterozygous genomic changes with an efficiency close to 10%. This protocol has been optimized for both human ESCs and iPSCs grown on irradiated MEFs which support cell growth and survival after culturing cells at low density after cell sorting. Cell ...

Human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs) are valuable tools for modeling human disease due to their capacity for renewal, while maintaining the ability to generate cell types of different lineages1,2,3,4. These models open the possibility to interrogate gene function, and understand how specific mutations and phenotypes are related to various diseases5,6. However, to understand how a specific alteration is linked to a particular phenotype, the use of a paired isogenic control and mutant cell lines is important to control for line to line variability7,8. Transcription activator-like effector nucleases (TALENs) and zinc finger nucleases have been used to generate insertion or deletion (indels) mutations in diverse genetic models, including primary cells; but these nucleases can be cumbersome to use and expensive9,10,11,12,13,14. The discovery of the clustered regularly interspaced short palindromic repeat (CRISPR)-CAS9 nuclease has revolutionized the field due to efficiency in indel formation in virtually any region of the genome, simplicity of use, and reduction in cost15,16,17,18,19.
A challenge in using the CRISPR-CAS9 based genome editing technology has been the generation or correction of specific mutations in one allele without creating an indel mutation in the second allele20. The major goal of this protocol is to overcome this challenge by using two single-stranded oligonucleotide (ssODN) repair templates to reduce indel formation in the second allele. Both ssODNs are designed to contain silent mutations to prevent re-cutting by the CAS9 nuclease, but only one contains the alteration of interest. This method increases the efficiency of generating a specific heterozygous genetic modification without inducing indel formation in the second allele. Using this protocol, gene editing experiments in six independent genomic locations demonstrate the precise introduction of the desired genomic change in one allele without indel formation in the second allele and occurs with an overall efficiency of ~10%. The described protocol has been adapted from Maguire et al.21.

<table border="0" cellpadding="0" cellspacing="0" style="width:707px;" width="705">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:375px;">5-ml polystyrene round-bottom tube with cell-strainer cap</td>
			<td style="width:145px;">Corning</td>
			<td style="width:124px;">352235</td>
			<td style="width:63px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">6-well polystyrene tissue culture dishes</td>
			<td>Corning</td>
			<td style="width:124px;">353046</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">AflII restriction endonuclease</td>
			<td>New England Biolabs</td>
			<td style="width:124px;">R0520</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agarose</td>
			<td>VWR</td>
			<td style="width:124px;">N605</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DMEM/F12 medium</td>
			<td style="width:145px;">ThermoFisher</td>
			<td>11320033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:375px;">dNTPs</td>
			<td style="width:145px;">Roche</td>
			<td style="width:124px;">11969064001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fluorescence-activated cell sorter (FACS) apparatus</td>
			<td style="width:145px;"></td>
			<td style="width:124px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gel extraction kit</td>
			<td>Macherey-Nagel</td>
			<td>740609</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gibson Assembly Kit</td>
			<td>New England Biolabs</td>
			<td>E2611</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">gRNA_Cloning Vector</td>
			<td>Addgene</td>
			<td style="width:124px;">41824</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LB agar plates containing 50 &#956;g/ml kanamycin</td>
			<td style="width:145px;"></td>
			<td style="width:124px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Lipofectamine Stem Reagent</td>
			<td style="width:145px;">ThermoFisher</td>
			<td style="width:124px;">(STEM00001)</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Matrigel Growth Factor Reduced (GFR)</td>
			<td>Corning</td>
			<td style="width:124px;">354230</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Murine embryonic fibroblasts (MEFs)</td>
			<td style="width:145px;"></td>
			<td style="width:124px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nucleospin Gel Extraction and PCR Clean-up Kit</td>
			<td>Macherey-Nagel</td>
			<td style="width:124px;">740609</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Orbital shaking incubator</td>
			<td style="width:145px;"></td>
			<td style="width:124px;"></td>
			<td></td>
		</tr>
		<tr height="18">
			<td height="18" style="height:19px;">pCas9_GFP vector</td>
			<td style="width:145px;">Addgene</td>
			<td style="width:124px;">44719</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PCR strip tubes</td>
			<td style="width:145px;">USA Scientific</td>
			<td>1402-2900</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phusion High Fidelity DNA Polymerase and 5&#215; Phusion buffer</td>
			<td>New England Biolabs</td>
			<td>M0530</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PurelinkTM Quick Plasmid Miniprep Kit</td>
			<td>Invitrogen</td>
			<td style="width:124px;">K210011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K</td>
			<td style="width:145px;">Qiagen</td>
			<td style="width:124px;">Qiagen 19133</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">StellarTM electrocompetent Escherichia coli cells</td>
			<td>Takara</td>
			<td style="width:124px;">636763</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SOC medium</td>
			<td>New England Biolabs</td>
			<td>B9020S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TrypLE Express Enzyme</td>
			<td>ThermoFisher</td>
			<td style="width:124px;">12605036</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Y-27632 dihydrochloride/ROCK inhibitor (ROCKi)</td>
			<td>Tocris</td>
			<td style="width:124px;">1254</td>
			<td></td>
		</tr>
	</tbody>
</table>

generation of defined genomic modifications using crispr-cas9 in human pluripotent stem cells

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise heterozygous genetic modifications is challenging due to CRISPR-CAS9 mediated indel formation in the second allele. Here, we demonstrate a protocol to help overcome this difficulty by using two repair templates in which only one expresses the desired sequence change, while both templates contain silent mutations to prevent re-cutting and indel formation. This methodology is most advantageous for gene editing coding regions of DNA to generate isogenic control and mutant human stem cell lines for studying human disease and biology. In addition, optimization of transfection and screening methodologies have been performed to reduce labor and cost of a gene editing experiment. Overall, this protocol is widely applicable to many genome editing projects utilizing the human pluripotent stem cell model.

Generation of gRNAs and screening for indels
Each gRNA will be cloned into a plasmid vector and expressed using the U6 promoter. The AflII restriction enzyme is used to linearize the plasmid (addgene #41824) and is located after the U6 promoter. The 100 bp band generated after annealing the two 60 bp oligos is cloned into the gRNA expression vector using the DNA assembly. Once the gRNA plasmids are generated, they are transfected into hESCs or iPSCs along with a CRISP...

Watch this Scientific Journal Video about Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells at JoVE.com

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

This protocol provides a method to facilitate the generation of defined heterozygous or homozygous nucleotide changes using CRISPR-CAS9 in human pluripotent stem cells.

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...

generation-defined-genomic-modifications-using-crispr-cas9-human

Research

JoVE Journal

Genetics

8.1K Views.  The Children's Hospital of Philadelphia. This protocol provides a method to facilitate the generation of defined heterozygous or homozygous nucleotide changes using CRISPR-CAS9 in human pluripotent stem cells.

Video: Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play in the functioning of cells and whole organisms. This cause has been tremendously aided by the recent introduction of the CRISPR/Cas9 system-a versatile tool that allows researchers to manipulate the genome and transcriptome in order to, among other things, knock out, knock down, or knock in genes in a targeted manner. For the purpose of knocking out a gene, CRISPR/Cas9-mediated double-strand breaks recruit the non-homologous end-joining DNA repair pathway to introduce the frameshift-causing insertion or deletion of nucleotides at the break site. However, an individual guide RNA may cause undesirable off-target effects, and to rule these out, the use of multiple guide RNAs is necessary. This multiplicity of targets also means that a high-volume screening of clones is required, which in turn begs the use of an efficient high-throughput technique to genotype the knockout clones. Current genotyping techniques either suffer from inherent limitations or incur high cost, hence rendering them unsuitable for high-throughput purposes. Here, we detail the protocol for using fluorescent PCR, which uses genomic DNA from crude cell lysate as a template, and then resolving the PCR fragments via capillary gel electrophoresis. This technique is accurate enough to differentiate one base-pair difference between fragments and hence is adequate in indicating the presence or absence of a frameshift in the coding sequence of the targeted gene. This precise knowledge effectively precludes the need for a confirmatory sequencing step and allows users to save time and cost in the process. Moreover, this technique has proven to be versatile in genotyping various mammalian cells of various tissue origins targeted by guide RNAs against numerous genes, as shown here and elsewhere.

The genotyping technique described here, which couples fluorescent polymerase chain reaction (PCR) to capillary gel electrophoresis, allows for high-throughput genotyping of nuclease-mediated knockout clones. It circumvents limitations faced by other genotyping techniques and is more cost effective than sequencing methods.

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play ...

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide RNA (sgRNA) that confers specificity, the Cas9 protein cleaves both DNA strands at the targeted locus. The DNA break can trigger either non-homologous end joining (NHEJ) or homology directed repair (HDR). NHEJ can introduce small deletions or insertions which lead to frame-shift mutations, while HDR allows for larger and more precise perturbations. Here, we present protocols for generating knockout cell lines by coupling established CRISPR/Cas9 methods with two options for downstream selection/screening. The NHEJ approach uses a single sgRNA cut site and selection-independent screening, where protein production is assessed by dot immunoblot in a high-throughput manner. The HDR approach uses two sgRNA cut sites that span the gene of interest. Together with a provided HDR template, this method can achieve deletion of tens of kb, aided by the inserted selectable resistance marker. The appropriate applications and advantages of each method are discussed.

Recent advances in the ability to genetically manipulate somatic cell lines hold great potential for basic and applied research. Here, we present two approaches for CRISPR/Cas9 generated knockout production and screening in mammalian cell lines, with and without the use of selectable markers.

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

Primordial Germ Cell Transplantation for CRISPR/Cas9-based Leapfrogging in Xenopus

The creation of mutant lines by genome editing is accelerating genetic analysis in many organisms. CRISPR/Cas9 methods have been adapted for use in the African clawed frog, Xenopus, a longstanding model organism for biomedical research. Traditional breeding schemes for creating homozygous mutant lines with CRISPR/Cas9-targeted mutagenesis have several time-consuming and laborious steps. To facilitate the creation of mutant embryos, particularly to overcome the obstacles associated with knocking out genes that are essential for embryogenesis, a new method called leapfrogging was developed. This technique leverages the robustness of Xenopus embryos to &#34;cut and paste&#34; embryological methods. Leapfrogging utilizes the transfer of primordial germ cells (PGCs) from efficiently-mutagenized donor embryos into PGC-ablated wildtype siblings. This method allows for the efficient mutation of essential genes by creating chimeric animals with wildtype somatic cells that carry a mutant germline. When two F0 animals carrying &#34;leapfrog transplants&#34; (i.e., mutant germ cells) are intercrossed, they produce homozygous, or compound heterozygous, null F1 embryos, thus saving a full generation time to obtain phenotypic data. Leapfrogging also provides a new approach for analyzing maternal effect genes, which are refractory to F0 phenotypic analysis following CRISPR/Cas9 mutagenesis. This manuscript details the method of leapfrogging, with special emphasis on how to successfully perform PGC transplantation.

Primordial Germ Cell Transplantation for CRISPR/Cas9-based Leapfrogging in Xenopus

Genes essential for survival pose technical hurdles for creating mutant lines. Leapfrogging circumvents lethality by combining genome editing with primordial germ cell transplantation to create wild-type animals carrying germline mutations. Leapfrogging also permits the efficient generation of homozygous null mutants in the F1 generation. Here, the transplantation step is demonstrated.

The creation of mutant lines by genome editing is accelerating genetic analysis in many organisms. CRISPR/Cas9 methods have been adapted for use in the ...

Immunostaining for DNA Modifications: Computational Analysis of Confocal Images

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of enzymatic oxidation of 5mC to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) as well as detection of N6-methyladenine (6mA) in the DNA of multicellular organisms provided additional degrees of complexity to the epigenetic research. According to a growing body of experimental evidence, these novel DNA modifications may play specific roles in different cellular and developmental processes. Importantly, as some of these marks (e. g. 5hmC, 5fC and 5caC) exhibit tissue- and developmental stage-specific occurrence in vertebrates, immunochemistry represents an important tool allowing assessment of spatial distribution of DNA modifications in different biological contexts. Here the methods for computational analysis of DNA modifications visualized by immunostaining followed by confocal microscopy are described. Specifically, the generation of 2.5 dimension (2.5D) signal intensity plots, signal intensity profiles, quantification of staining intensity in multiple cells and determination of signal colocalization coefficients are shown. Collectively, these techniques may be operational in evaluating the levels and localization of these DNA modifications in the nucleus, contributing to elucidating their biological roles in metazoans.

Newly discovered oxidized forms of 5-methylcytosine (oxi-mCs), 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) may represent distinct DNA modifications with unique functional roles. Here a semi-quantitative workflow for visualization of oxi-mCs' spatial distribution, signal intensity profiling and colocalization is described.

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of ...

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration of transgenes. However, due to the low efficiency of homologous recombination (HR) and various indel mutations of non-homologous end joining (NHEJ)-based strategies in non-dividing cells, in vivo genome editing remains a great challenge. Here, we describe a homology-mediated end joining (HMEJ)-based CRISPR/Cas9 system for efficient in vivo precise targeted integration. In this system, the targeted genome and the donor vector containing homology arms (~800 bp) flanked by single guide RNA (sgRNA) target sequences are cleaved by CRISPR/Cas9. This HMEJ-based strategy achieves efficient transgene integration in mouse zygotes, as well as in hepatocytes in vivo. Moreover, a HMEJ-based strategy offers an efficient approach for correction of fumarylacetoacetate hydrolase (Fah) mutation in the hepatocytes and rescues Fah-deficiency induced liver failure mice. Taken together, focusing on targeted integration, this HMEJ-based strategy provides a promising tool for a variety of applications, including generation of genetically modified animal models and targeted gene therapies.

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

The clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9 (CRISPR/Cas9) system provides a promising tool for genetic engineering, and opens up the possibility of targeted integration of transgenes. We describe a homology-mediated end joining (HMEJ)-based strategy for efficient DNA targeted integration in vivo and targeted gene therapies using CRISPR/Cas9.

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

The clustered regularly interspersed palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) prokaryotic adaptive immune defense system has been co-opted as a powerful tool for precise eukaryotic genome engineering. Here, we present a rapid and simple method using chimeric single guide RNAs (sgRNA) and CRISPR-Cas9 Ribonucleoproteins (RNPs) for the efficient and precise generation of genomic point mutations in C. elegans. We describe a pipeline for sgRNA target selection, homology-directed repair (HDR) template design, CRISPR-Cas9-RNP complexing and delivery, and a genotyping strategy that enables the robust and rapid identification of correctly edited animals. Our approach not only permits the facile generation and identification of desired genomic point mutant animals, but also facilitates the detection of other complex indel alleles in approximately 4 - 5 days with high efficiency and a reduced screening workload.

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

Here, we present a method to engineer the genome of C. elegans using CRISPR-Cas9 ribonucleoproteins and homology dependent repair templates.

The clustered regularly interspersed palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) prokaryotic adaptive immune defense system has been ...

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

Malaria is a significant cause of morbidity and mortality worldwide. This disease, which primarily affects those living in tropical and subtropical regions, is caused by infection with Plasmodium parasites. The development of more effective drugs to combat malaria can be accelerated by improving our understanding of the biology of this complex parasite. Genetic manipulation of these parasites is key to understanding their biology; however, historically the genome of P. falciparum has been difficult to manipulate. Recently, CRISPR/Cas9 genome editing has been utilized in malaria parasites, allowing for easier protein tagging, generation of conditional protein knockdowns, and deletion of genes. CRISPR/Cas9 genome editing has proven to be a powerful tool for advancing the field of malaria research. Here, we describe a CRISPR/Cas9 method for generating glmS-based conditional knockdown mutants in P. falciparum. This method is highly adaptable to other types of genetic manipulations, including protein tagging and gene knockouts.

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

We describe a method for generating glmS-based conditional knockdown mutants in Plasmodium falciparum using CRISPR/Cas9 genome editing.

Malaria is a significant cause of morbidity and mortality worldwide. This disease, which primarily affects those living in tropical and subtropical ...

Endogenous Protein Tagging in Human Induced Pluripotent Stem Cells Using CRISPR/Cas9

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or C-terminal fluorescent tags. The prokaryotic CRISPR/Cas9 system (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9) may be used to introduce large exogenous sequences into genomic loci via homology directed repair (HDR). To achieve the desired knock-in, this protocol employs the ribonucleoprotein (RNP)-based approach where wild type Streptococcus pyogenes Cas9 protein, synthetic 2-part guide RNA (gRNA), and a donor template plasmid are delivered to the cells via electroporation. Putatively edited cells expressing the fluorescently tagged proteins are enriched by fluorescence activated cell sorting (FACS). Clonal lines are then generated and can be analyzed for precise editing outcomes. By introducing the fluorescent tag at the genomic locus of the gene of interest, the resulting subcellular localization and dynamics of the fusion protein can be studied under endogenous regulatory control, a key improvement over conventional overexpression systems. The use of hiPSCs as a model system for gene tagging provides the opportunity to study the tagged proteins in diploid, nontransformed cells. Since hiPSCs can be differentiated into multiple cell types, this approach provides the opportunity to create and study tagged proteins in a variety of isogenic cellular contexts.

Described here is a protocol for tagging endogenously expressed proteins with fluorescent tags in human induced pluripotent stem cells using CRISPR/Cas9. Putatively edited cells are enriched by fluorescence activated cell sorting and clonal cell lines are generated.

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or ...

Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models

The use of hiPSC-derived cells represents a valuable approach to study human neurodegenerative diseases. Here, we describe an optimized protocol for the differentiation of hiPSCs derived from a patient with the triplication of the alpha-synuclein gene (SNCA) locus into Parkinson&#8217;s disease (PD)-relevant dopaminergic neuronal populations. Accumulating evidence has shown that high levels of SNCA are causative for the development of PD. Recognizing the unmet need to establish novel therapeutic approaches for PD, especially those targeting the regulation of SNCA expression, we recently developed a CRISPR/dCas9-DNA-methylation-based system to epigenetically modulate SNCA transcription by enriching methylation levels at the SNCA intron 1 regulatory region. To deliver the system, consisting of a dead (deactivated) version of Cas9 (dCas9) fused with the catalytic domain of the DNA methyltransferase enzyme 3A (DNMT3A), a lentiviral vector is used. This system is applied to cells with the triplication of the SNCA locus and reduces the SNCA-mRNA and protein levels by about 30% through the targeted DNA methylation of SNCA intron 1. The fine-tuned downregulation of the SNCA levels rescues disease-related cellular phenotypes. In the current protocol, we aim to describe a step-by-step procedure for differentiating hiPSCs into neural progenitor cells (NPCs) and the establishment and validation of pyrosequencing assays for the evaluation of the methylation profile in the SNCA intron 1. To outline in more detail the lentivirus-CRISPR/dCas9 system used in these experiments, this protocol describes how to produce, purify, and concentrate lentiviral vectors and to highlight their suitability for epigenome- and genome-editing applications using hiPSCs and NPCs. The protocol is easily adaptable and can be used to produce high titer lentiviruses for in vitro and in vivo applications.

Targeted DNA epigenome editing represents a powerful therapeutic approach. This protocol describes the production, purification, and concentration of all-in-one lentiviral vectors harboring the CRISPR-dCas9-DNMT3A transgene for epigenome-editing applications in human induced pluripotent stem cell (hiPSC)-derived neurons.

The use of hiPSC-derived cells represents a valuable approach to study human neurodegenerative diseases. Here, we describe an optimized protocol for the ...

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Summary

Explore More Videos

Chapters in this video

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

Primordial Germ Cell Transplantation for CRISPR/Cas9-based Leapfrogging in Xenopus

Immunostaining for DNA Modifications: Computational Analysis of Confocal Images

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

Endogenous Protein Tagging in Human Induced Pluripotent Stem Cells Using CRISPR/Cas9

Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models