We would like to thank the Meningitis Trust and the MRC for providing funding for this work.

1. Generation of the mutating amplicon by SOE-PCR23 and amplification of the spectinomycin cassette
<ol>
	<li>Start by performing PCR for the amplification of the homology arms (ply 5&#8217; (488 bp) and ply3&#8217; (715 bp) respectively) of the flanking regions of the ply gene from strain 519/43. Use primers plyFw1_NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), ply5&#8217;R1_BamHI (CGAAATATAGACCAAAGGACGCGGATCC AGAACCAAACTTGACCTTGA), ply3&#8217;F1_BamHI (TCAAGGTCAAGTTTGGTTCTGGATCC GCGTCCTTTGGTCTATATTTCG) and plyRv2_NotI (TTTGCGGCCGCCATTTTCTACCTTATCCTCTACC).</li>
	<li>Use the following PCR conditions for ply5&#8217;: denaturing at 94 &#176;C for 60 s, step 2: denaturing at 94 &#176;C for 30 s, step 3: annealing at 58 &#176;C for 30 s, step 4: extension at 72 &#176;C for 30 s, step 5: go back to step 2 and repeat for 35 cycles, step 6: final extension at 72&#176;C for 30 s.
	<ol>
		<li>Use the same PCR conditions for ply3&#8217; with the exception of the extension time on step 4 and step 6 where it should be 60 s.</li>
	</ol>
	</li>
	<li>Analyze the PCR products by gel electrophoresis and excise the amplicon from the gel.</li>
	<li>Purify the PCR amplicons following the protocol described in the manufacturer&#8217;s instructions (Table of Materials).</li>
	<li>Use equimolar amounts of both homology arms as templates in the SOE-PCR. Fuse the two amplicons using primers plyFw1_ NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), and plyRv2_NotI (TTTGCGGCCGCCATTTTCTACCTTATCCTCTACC).</li>
	<li>Use the following SOE-PCR conditions (step1: denaturing at 94 &#176;C for 2 min, step 2: denaturing at 94 &#176;C for 30 s, step 3: annealing 58 &#176;C for 30 s, Step 4: extension at 68 &#176;C for 60 s, step 5: go back to step 2 and repeat for 25 cycles, step 6: final extension at 68 &#176;C for 90 s).</li>
	<li>Analyze the SOE-PCR product by gel electrophoresis. Excise it from the gel using a gel extraction kit and follow the instructions provided.</li>
	<li>Amplify the spectinomycin cassette from plasmid pR412 using the following PCR conditions: step 1: denaturing at 94 &#176;C for 60 s, step 2: denaturing at 94 &#176;C for 30 s, step 3: annealing at 55 &#176;C for 30 s, step 4: extension at 68 &#176;C for 60 s, step 5: go back to step 2 and repeat for 25 cycles, step 6: final extension at 68 &#176;C for 60 s.
	<ol>
		<li>Use primers BamHI_SP2F2 (GGATCC CTA GAA CTA GTG GAT CCC CC) and BamHI_SP2R2 (GGATCC AAT TCT GCA GAT TTT AC ATG ATC). Plasmid pR412 was acquired from Dr Marc PrudHomme (CNRS-Universite Paul Sabatier Toulouse France).</li>
	</ol>
	</li>
	<li>Analyze the PCR amplicons by gel electrophoresis. Excise and purify the resulting PCR amplicon as described above.</li>
</ol>
2. Generation of plasmid pSD1 and Chemical transformation of E. coli Dh5&#945;
<ol>
	<li>Perform a ligation following the pGEMT-easy system I manufacturer instructions (Table of Materials). In a microcentrifuge tube, add 5 &#181;L of 2x ligation buffer, 1 &#181;L of pGEMTeasy, 2 &#181;L of the ply_SOE product, 1 &#181;L of T4 DNA ligase and water to a 20 &#181;L total volume. Incubate overnight at 4 &#176;C. This generates plasmid pSD1.</li>
	<li>Transform chemically competent E. coli Dh5&#945; with pSD1. Start by incubating 50 &#181;L of chemically competent E. coli Dh5&#945; with 3 &#181;L of pSD1 ligation reaction for 15 min on ice. Then continue by exposing the cells to thermic shock (42 &#176;C, 30 s). Place the cells on ice for 2 min.</li>
	<li>Remove the cells from ice and add 350 &#181;L of S.O.C media. Incubate the culture for 2 h at 37 &#176;C, 120 rpm.</li>
	<li>Plate the transformation on Luria Bertani Agar (LBA) supplemented with 0.4 mM IPTG, 0.24 mg/mL X-Gal for blue/white selection and 100 &#181;g/mL ampicillin to ensure all colonies growing in the plate have the plasmid backbone. White colonies contain pSD1.</li>
	<li>Pick three white colonies and set up overnight growths in 10 mL of LB, supplemented with 100 &#181;g/mL ampicillin. Incubate the cultures overnight at 37 &#176;C with shaking.</li>
	<li>The next day centrifuge the cultures at 3,082 x g and use the pellet for plasmid extraction.</li>
</ol>
3. Plasmid DNA extraction, restriction digestion of pSD1 and spectinomycin gene and assembly of pSD2
<ol>
	<li>Extract the plasmid DNA following the instructions provided with the commercial kit (Table of Materials).</li>
	<li>Set up a BamHI-restriction digestion for both pSD1 plasmid and the spectinomycin cassette previously amplified and purified. Use the following conditions and quantities described in Table 1.</li>
	<li>Incubate the restriction digestion reactions and controls at 37 &#176;C for 3 h.</li>
	<li>Analyze the restriction digest by electrophoresis, excise the band and purify following the instructions provided with the commercial kit (Table of Materials).</li>
	<li>Next, prepare a ligation reaction following the manufacturer instructions (Table of Materials) using the BamHI- digested pSD1 and spectinomycin (from step 3.2). In a microcentrifuge tube, add the following reaction components: 5 &#181;L of 2x ligation buffer, 2 &#181;L pSD1, 2 &#181;L of spectinomycin cassette, 1 &#181;L of T4 DNA ligase and incubate overnight at 4 &#176;C. This generates plasmid pSD2.</li>
	<li>Transform plasmid pSD2 into chemically competent E. coli Dh5&#945; as described in step 2.2.</li>
	<li>Select the transformants carrying plasmid pSD2 based on their ability to grow in LBA supplemented with 100 &#181;g/mL of spectinomycin and ampicillin.</li>
	<li>Perform a plasmid DNA extraction (pSD2) as described above and following the manufacturer&#8217;s instructions (&#181;L).</li>
</ol>
4. Transformation of S. pneumoniae strain 519/43
<ol>
	<li>Prepare an overnight culture of S. pneumoniae 519/43 in BHI and allow it to grow statically at 37 &#176;C, 5% CO2.</li>
	<li>The following day dilute the cultures 1:50 and 1:100 in 10 mL of fresh BHI broth. Incubate the cultures statically at 37 &#176;C until the OD595nm is between 0.05 and 0.1 (optimal acquisition of DNA closer to 0.1 OD).</li>
	<li>Once an OD of 0.1 is reached, take 860 &#181;L and transfer into a microcentrifuge tube. In this same microcentrifuge tube add: 100 &#181;L of 100 mM NaOH, 10 &#181;L of 20% (w/v) BSA, 10 &#181;L of 100 mM CaCl2, 2 &#181;L of 50 ng/mL CSP124 and 500 ng of pSD2.</li>
	<li>Incubate the reaction statically at 37 &#176;C for 3 h.</li>
	<li>Plate 330 &#181;L onto 5% blood agar plates (BA) supplemented with 100 &#956;g/mL spectinomycin, every hour over the 3 incubation hours.</li>
	<li>Incubate plates overnight at 37 &#176;C, 5% CO2. Patch spectinomycin resistant colonies onto another BA plate supplemented with 100 &#956;g/mL spectinomycin as well as onto BA plates supplemented with 100 &#956;g/mL of ampicillin. Incubate both sets of plates overnight under the conditions stated above. The ampicillin plates are to test for the presence of the plasmid backbone.</li>
	<li>Confirm the presence of the spectinomycin cassette by PCR using primers plyFw1_ NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG) and SPEC_REV (TAATTCCTCTAAGTCATAATTTCCG). Confirm the mutation by PCR using primers plySCN1 (CCAATGGAAATCGCTAGGCAAGAGATAA) and plySCN2 (ATTACTTAGTCCAACCACGGCTGAT) which attach outside of the mutated region.</li>
	<li>Confirm the integration in the correct location of the genome by sequencing using primers plySCN1 (CCAATGGAAATCGCTAGGCAAGAGATAA), plySCN2 (ATTACTTAGTCCAACCACGGCTGAT), as well as primers with their binding site in the spectinomycin cassette sqr1 (CCTGATCCAAACATGTAAGTACC) sqf2 (CGTAGTTATCTTGGAGAGAATA) spec_sqf1 (GGTACTTACATGTTTGGATCAGG ) and spec_sqr2 TATTCTCTCCAAGATAACTACG.</li>
</ol>

<ol><li>Bentley, S. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genetic+Analysis+of+the+Capsular+Biosynthetic+Locus+from+All+90+Pneumococcal+Serotypes%5BTitle%5D)+AND+%22PLoS+Genetics%22%5BJournal%5D)">Genetic Analysis of the Capsular Biosynthetic Locus from All 90 Pneumococcal Serotypes.</a> PLoS Genetics. 2 (3), 31(2006).</li>
<li>Calix, J. J., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+new+pneumococcal+serotype%2C+11E%2C+has+a+variably+inactivated+wcjE+gene%5BTitle%5D)+AND+%22The+Journal+of+Infectious+Diseases%22%5BJournal%5D)">A new pneumococcal serotype, 11E, has a variably inactivated wcjE gene.</a> The Journal of Infectious Diseases. 202 (1), 29-38 (2010).</li>
<li>Park, I. H., Pritchard, D. G., Cartee, R., Brandao, A., Brandileone, M. C. C., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Discovery+of+a+New+Capsular+Serotype+%286C%29+within+Serogroup+6+of+Streptococcus+pneumoniae%5BTitle%5D)+AND+%22Journal+of+Clinical+Microbiology%22%5BJournal%5D)">Discovery of a New Capsular Serotype (6C) within Serogroup 6 of Streptococcus pneumoniae.</a> Journal of Clinical Microbiology. 45 (4), 1225-1233 (2007).</li>
<li>Jin, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((First+Report+of+Putative+Streptococcus+pneumoniae+Serotype+6D+among+Nasopharyngeal+Isolates+from+Fijian+Children%5BTitle%5D)+AND+%22The+Journal+of+Infectious+Diseases%22%5BJournal%5D)">First Report of Putative Streptococcus pneumoniae Serotype 6D among Nasopharyngeal Isolates from Fijian Children.</a> The Journal of Infectious Diseases. 200 (9), 1375-1380 (2009).</li>
<li>Oliver, M. B., vander Linden, M. P. G., Küntzel, S. A., Saad, J. S., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Discovery+of+Streptococcus+pneumoniae+Serotype+6+Variants+with+Glycosyltransferases+Synthesizing+Two+Differing+Repeating+Units%5BTitle%5D)+AND+%22Journal+of+Biological+Chemistry%22%5BJournal%5D)">Discovery of Streptococcus pneumoniae Serotype 6 Variants with Glycosyltransferases Synthesizing Two Differing Repeating Units.</a> Journal of Biological Chemistry. 288 (36), 25976-25985 (2013).</li>
<li>Calix, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Serological+Characterization+of+Two+Capsule+Subtypes+among+Streptococcus+pneumoniae+Serotype+20+Strains%5BTitle%5D)+AND+%22Journal+of+Biological+Chemistry%22%5BJournal%5D)">Serological Characterization of Two Capsule Subtypes among Streptococcus pneumoniae Serotype 20 Strains.</a> Journal of Biological Chemistry. 287 (33), 27885-27894 (2012).</li>
<li>Park, I. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((and+Serological+Characterization+of+a+New+Pneumococcal+Serotype%2C+6H%2C+and+Generation+of+a+Pneumococcal+Strain+Producing+Three+Different+Capsular+Repeat+Units%5BTitle%5D)+AND+%22Clinical+and+Vaccine+Immunology%22%5BJournal%5D)">and Serological Characterization of a New Pneumococcal Serotype, 6H, and Generation of a Pneumococcal Strain Producing Three Different Capsular Repeat Units.</a> Clinical and Vaccine Immunology. 22 (3), 313-318 (2015).</li>
<li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years%3A+global+estimates%5BTitle%5D)+AND+%22The+Lancet%22%5BJournal%5D)">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> The Lancet. 374 (9693), 893-902 (2009).</li>
<li>Henriques-Normark, B., Tuomanen, E. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+Pneumococcus%3A+Epidemiology%2C+Microbiology%2C+and+Pathogenesis%5BTitle%5D)+AND+%22Cold+Spring+Harbor+Perspectives+in+Medicine%22%5BJournal%5D)">The Pneumococcus: Epidemiology, Microbiology, and Pathogenesis.</a> Cold Spring Harbor Perspectives in Medicine. 3 (7), 010215(2013).</li>
<li>Leimkugel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+Outbreak+of+Serotype+1+Streptococcus+pneumoniae+Meningitis+in+Northern+Ghana+with+Features+That+Are+Characteristic+of+Neisseria+meningitidis+Meningitis+Epidemics%5BTitle%5D)+AND+%22The+Journal+of+Infectious+Diseases%22%5BJournal%5D)">An Outbreak of Serotype 1 Streptococcus pneumoniae Meningitis in Northern Ghana with Features That Are Characteristic of Neisseria meningitidis Meningitis Epidemics.</a> The Journal of Infectious Diseases. 192 (2), 192-199 (2005).</li>
<li>Yaro, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Epidemiological+and+Molecular+Characteristics+of+a+Highly+Lethal+Pneumococcal+Meningitis+Epidemic+in+Burkina+Faso%5BTitle%5D)+AND+%22Clinical+Infectious+Diseases%22%5BJournal%5D)">Epidemiological and Molecular Characteristics of a Highly Lethal Pneumococcal Meningitis Epidemic in Burkina Faso.</a> Clinical Infectious Diseases. 43 (6), 693-700 (2006).</li>
<li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Molecular+epidemiology+of+pneumococci+obtained+from+Gambian+children+aged+2-29+months+with+invasive+pneumococcal+disease+during+a+trial+of+a+9-valent+pneumococcal+conjugate+vaccine%5BTitle%5D)+AND+%22BMC+Infectious+Diseases%22%5BJournal%5D)">Molecular epidemiology of pneumococci obtained from Gambian children aged 2-29 months with invasive pneumococcal disease during a trial of a 9-valent pneumococcal conjugate vaccine.</a> BMC Infectious Diseases. 8 (1), 81(2008).</li>
<li>Kwambana-Adams, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+outbreak+of+pneumococcal+meningitis+among+older+children+%28%E2%89%A55+years%29+and+adults+after+the+implementation+of+an+infant+vaccination+programme+with+the+13-valent+pneumococcal+conjugate+vaccine+in+Ghana%5BTitle%5D)+AND+%22BMC+Infectious+Diseases%22%5BJournal%5D)">An outbreak of pneumococcal meningitis among older children (≥5 years) and adults after the implementation of an infant vaccination programme with the 13-valent pneumococcal conjugate vaccine in Ghana.</a> BMC Infectious Diseases. 16 (1), 575(2016).</li>
<li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Seasonality+and+outbreak+of+a+predominant+Streptococcus+pneumoniae+serotype+1+clone+from+The+Gambia%3A+Expansion+of+ST217+hypervirulent+clonal+complex+in+West+Africa%5BTitle%5D)+AND+%22BMC+Microbiology%22%5BJournal%5D)">Seasonality and outbreak of a predominant Streptococcus pneumoniae serotype 1 clone from The Gambia: Expansion of ST217 hypervirulent clonal complex in West Africa.</a> BMC Microbiology. 8 (1), 198(2008).</li>
<li>Staples, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Molecular+characterization+of+an+Australian+serotype+1+Streptococcus+pneumoniae+outbreak%5BTitle%5D)+AND+%22Epidemiology+and+Infection%22%5BJournal%5D)">Molecular characterization of an Australian serotype 1 Streptococcus pneumoniae outbreak.</a> Epidemiology and Infection. 143 (2), 325-333 (2015).</li>
<li>Gessner, B. D., Mueller, J. E., Yaro, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((African+meningitis+belt+pneumococcal+disease+epidemiology+indicates+a+need+for+an+effective+serotype+1+containing+vaccine%2C+including+for+older+children+and+adults%5BTitle%5D)+AND+%22BMC+Infectious+Diseases%22%5BJournal%5D)">African meningitis belt pneumococcal disease epidemiology indicates a need for an effective serotype 1 containing vaccine, including for older children and adults.</a> BMC Infectious Diseases. 10 (1), 22(2010).</li>
<li>Hill, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nasopharyngeal+carriage+of+Streptococcus+pneumoniae+in+Gambian+infants%3A+a+longitudinal+study%5BTitle%5D)+AND+%22Clinical+Infectious+Diseases%22%5BJournal%5D)">Nasopharyngeal carriage of Streptococcus pneumoniae in Gambian infants: a longitudinal study.</a> Clinical Infectious Diseases. 46 (6), 807-814 (2008).</li>
<li>Ebruke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Temporal+changes+in+nasopharyngeal+carriage+of+Streptococcus+pneumoniae+serotype+1+genotypes+in+healthy+Gambians+before+and+after+the+7-valent+pneumococcal+conjugate+vaccine%5BTitle%5D)+AND+%22PeerJ%22%5BJournal%5D)">Temporal changes in nasopharyngeal carriage of Streptococcus pneumoniae serotype 1 genotypes in healthy Gambians before and after the 7-valent pneumococcal conjugate vaccine.</a> PeerJ. 3, 90(2015).</li>
<li>Adegbola, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Serotype+and+antimicrobial+susceptibility+patterns+of+isolates+of+Streptococcus+pneumoniae+causing+invasive+disease+in+The+Gambia+1996-2003%5BTitle%5D)+AND+%22Tropical+Medicine+and+International+Health%22%5BJournal%5D)">Serotype and antimicrobial susceptibility patterns of isolates of Streptococcus pneumoniae causing invasive disease in The Gambia 1996-2003.</a> Tropical Medicine and International Health. 11 (7), 1128-1135 (2006).</li>
<li>Marks, L. R., Reddinger, R. M., Hakansson, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High+Levels+of+Genetic+Recombination+during+Nasopharyngeal+Carriage+and+Biofilm+Formation+in+Streptococcus+pneumoniae%5BTitle%5D)+AND+%22mBio%22%5BJournal%5D)">High Levels of Genetic Recombination during Nasopharyngeal Carriage and Biofilm Formation in Streptococcus pneumoniae.</a> mBio. 3 (5), (2012).</li>
<li>Ritchie, N. D., Mitchell, T. J., Evans, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((What+is+different+about+serotype+1+pneumococci%5BTitle%5D)+AND+%22Future+Microbiology%22%5BJournal%5D)">What is different about serotype 1 pneumococci.</a> Future Microbiology. 7 (1), 33-46 (2012).</li>
<li>Harvey, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+variable+region+of+pneumococcal+pathogenicity+island+1+is+responsible+for+unusually+high+virulence+of+a+serotype+1+isolate%5BTitle%5D)+AND+%22Infection+and+Immunity%22%5BJournal%5D)">The variable region of pneumococcal pathogenicity island 1 is responsible for unusually high virulence of a serotype 1 isolate.</a> Infection and Immunity. 84 (3), 822-832 (2016).</li>
<li>Horton, R. M., Cai, Z. L., Ho, S. N., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Gene+splicing+by+overlap+extension%3A+tailor-made+genes+using+the+polymerase+chain+reaction%5BTitle%5D)+AND+%22BioTechniques%22%5BJournal%5D)">Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.</a> BioTechniques. 8 (5), 528-535 (1990).</li>
<li>Alioing, G., Granadel, C., Morrison, D. A., Claverys, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Competence+pheromone%2C+oligopeptide+permease%2C+and+induction+of+competence+in+Streptococcus+pneumoniae%5BTitle%5D)+AND+%22Molecular+Microbiology%22%5BJournal%5D)">Competence pheromone, oligopeptide permease, and induction of competence in Streptococcus pneumoniae.</a> Molecular Microbiology. 21 (3), 471-478 (1996).</li>
<li>Lund, E. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aLund%2C+E+%22Enumeration+and+description+of+the+strains+belonging+to+the+State+Serum+Institute%2C+Copenhagen+Denmark%22">Enumeration and description of the strains belonging to the State Serum Institute, Copenhagen Denmark</a>. , (1951).</li>
<li>Barany, F., Tomasz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genetic+transformation+of+Streptococcus+pneumoniae+by+heterologous+plasmid+deoxyribonucleic+acid%5BTitle%5D)+AND+%22Journal+of+Bacteriology%22%5BJournal%5D)">Genetic transformation of Streptococcus pneumoniae by heterologous plasmid deoxyribonucleic acid.</a> Journal of Bacteriology. 144 (2), 698-709 (1980).</li>
<li>Terra, V. S., Homer, K. A., Rao, S. G., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Characterization+of+novel+%CE%B2-galactosidase+activity+that+contributes+to+glycoprotein+degradation+and+virulence+in+Streptococcus+pneumoniae%5BTitle%5D)+AND+%22Infection+and+Immunity%22%5BJournal%5D)">Characterization of novel β-galactosidase activity that contributes to glycoprotein degradation and virulence in Streptococcus pneumoniae.</a> Infection and Immunity. 78 (1), (2010).</li>
<li>Terra, V. S., Zhi, X., Kahya, H. F., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Pneumococcal+6-phospho-%CE%B2-glucosidase+%28BglA3%29+is+involved+in+virulence+and+nutrient+metabolism%5BTitle%5D)+AND+%22Infection+and+Immunity%22%5BJournal%5D)">Pneumococcal 6-phospho-β-glucosidase (BglA3) is involved in virulence and nutrient metabolism.</a> Infection and Immunity. 84 (1), (2015).</li>
<li>Harvey, R. M., Ogunniyi, A. D., Chen, A. Y., Paton, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Pneumolysin+with+Low+Hemolytic+Activity+Confers+an+Early+Growth+Advantage+to+Streptococcus+pneumoniae+in+the+Blood%5BTitle%5D)+AND+%22Infection+and+Immunity%22%5BJournal%5D)">Pneumolysin with Low Hemolytic Activity Confers an Early Growth Advantage to Streptococcus pneumoniae in the Blood.</a> Infection and Immunity. 79 (10), 4122(2011).</li>
<li>Terra, V. S., Plumptre, C. D., Wall, E. C., Brown, J. S., Wren, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Construction+of+a+pneumolysin+deficient+mutant+in+Streptococcus+pneumoniae+serotype+1+strain+519%2F43+and+phenotypic+characterisation%5BTitle%5D)+AND+%22Microbial+Pathogenesis%22%5BJournal%5D)">Construction of a pneumolysin deficient mutant in Streptococcus pneumoniae serotype 1 strain 519/43 and phenotypic characterisation.</a> Microbial Pathogenesis. 141, 103999(2020).</li>
</ol>

The authors have nothing to disclose.

Streptococcus pneumoniae, in particular serotype 1, continues to be a global threat causing invasive pneumococcal disease and meningitis. Despite the introduction of various vaccines that should be protective against serotype 1, in Africa, this serotype is still capable of causing outbreaks that lead to high morbidity and mortality13. The ability to genetically manipulate this serotype is of critical importance because of its clinical relevance. The method described in this study allows t...

Streptococcus pneumoniae (S. pneumoniae, the pneumococcus) is one of the principal causes of morbidity and mortality globally. Up until recently, close to 100 serotypes of S. pneumoniae have been discovered1,2,3,4,5,6,7. Yearly, invasive pneumococcal disease (IPD) claims around 700,000 deaths, of children younger than 5 years old8. S. pneumoniae is the major cause of bacterial pneumonia, otitis media, meningitis and septicaemia worldwide9.
In the African meningitis belt, serotype 1 is responsible for meningitis outbreaks, where sequence type (ST) ST217, an extremely virulent sequence type, is dominant10,11,12,13,14,15. Its importance in meningitis pathology has been likened to that of Neisseria meningitidis in the African meningitis belt16. Serotype 1 is often the main cause of IPD; however, it is very rarely found in carriage. In fact, in the Gambia, this serotype is accountable for 20% of all invasive disease, but it was only found in 0.5% of healthy carriers14,17,18,19. Genetic exchange and recombination in competent pneumococci occurs generally in carriage rather than in invasive disease20. Furthermore, serotype 1 has been shown to have one of the shortest carriage rates described amongst pneumococci (only 9 days). Therefore, it has been proposed that this serotype might have a much lower recombination rate than others21.
In depth studies are necessary to understand the reason behind serotype 1 strains&#8217; low rate of carriage and its importance in invasive disease in sub-Saharan Africa.
Here we report a protocol that allows genome-wide mutagenesis of a particular serotype 1 strain, 519/43. This strain can easily acquire and recombine new DNA into its genome. This method is not yet inter-strain, but it is very efficient when done in 519/43 background (other targets have been mutated, manuscripts in preparation). By simply using 519/43 strain, and exploit its natural competence, as well as substituting the way that the exogenous DNA is provided, we were able to mutate the pneumolysin gene (ply) in this serotype 1 strain. This method represents an improvement on the one presented by Harvey et al.22 as it is done in one-step without the need to passage the DNA through a different serotype. Nevertheless, and due to inter-strain variability, no method has been standardized to all strains. The ability to mutate specific genes and observe its effects will allow a profound understanding of serotype 1 S. pneumoniae strains and it will provide answers for the role of these strains in meningitis in sub-Saharan Africa.

<table><tbody><tr><td>AccuPrime &lt;em&gt;Pfx&lt;/em&gt; DNA polymerase</td><td>Invitrogen</td><td>12344024</td><td>Used for amplification of the fragments</td></tr><tr><td>Ampicillin sodium salt</td><td>Sigma Aldrich</td><td>A9518</td><td>Used for bacterial selection on stage 1(pSD1)</td></tr><tr><td>Blood Agar Base</td><td>Oxoid</td><td>CM0055</td><td>Used to plate &lt;em&gt;S. pneumoniae&lt;/em&gt; transformants</td></tr><tr><td>Bovine Serum Albumine</td><td>sigma</td><td>55470</td><td>used for &lt;em&gt;S. pneumoniae&lt;/em&gt; Transformation</td></tr><tr><td>Brain Heart Infusion</td><td>Oxoid</td><td>CM1135</td><td>used to grow &lt;em&gt;S. pneumoniae&lt;/em&gt; cells</td></tr><tr><td>Calcium Chloride Cacl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>449709</td><td>used for &lt;em&gt;S. pneumoniae&lt;/em&gt; Transformation</td></tr><tr><td>Competence stimulating peptide 1</td><td>AnaSpec</td><td>AS-63779</td><td>used for &lt;em&gt;S. pneumoniae&lt;/em&gt; Transformation</td></tr><tr><td>Luria Broth Agar</td><td>Gibco</td><td>22700025</td><td>used for plating and selection of pSD1 and pSD2</td></tr><tr><td>Luria Broth Base (Miller&#039;s formulation)</td><td>Gibco</td><td>12795027</td><td>used for plating and selection of pSD1 and pSD2</td></tr><tr><td>Monarch Gel Extraction Kit</td><td>NEB</td><td>T1020S</td><td>Used to extract the bands from the DNA gel</td></tr><tr><td>Monarch Plasmid Miniprep Kit</td><td>NEB</td><td>T1010S</td><td>Used to extract plasmid from the cells</td></tr><tr><td>pGEM T-easy</td><td>Promega</td><td>A1360</td><td>used as suicide plasmid</td></tr><tr><td>S.O.C.</td><td>Invitrogen</td><td>15544034</td><td>used for recovery of cells after transformation</td></tr><tr><td>Sodium Hydroxide (NaOH)</td><td>Sigma</td><td>S0899</td><td>used for &lt;em&gt;S.pneumoniae&lt;/em&gt; Transformation</td></tr><tr><td>Spectinomycin Hydrochloride</td><td>SigmaAldrich</td><td>PHR1426</td><td>Used for bacterial selection</td></tr><tr><td>Subcloning Efficiency DH5&amp;alpha; Competent Cells</td><td>Invitrogen</td><td>18265017</td><td>used for the creation of pSD1 and pSD2</td></tr></tbody></table>

constructing mutants in serotype 1 streptococcus pneumoniae strain 519/43

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, studies in this serotype have been hindered by the lack of genetic tools to modify it. In this study, we describe a method to genetically modify a serotype 1 clinical isolate (strain 519/43). Interestingly, this was achieved by exploiting the Pneumococcus&#8217; ability to naturally acquire DNA. However, unlike most pneumococci, the use of linear DNA was not successful; to mutate this important strain, a suicide plasmid had to be used. This methodology has provided the means for a deeper understanding of this elusive serotype, both in terms of its biology and pathogenicity. To validate the method, the major known pneumococcal toxin, pneumolysin, was mutated because it has a well-known and easy to follow phenotype. We showed that the mutant, as expected, lost its ability to lyse red blood cells. By being able to mutate an important gene in the serotype of interest, we were able to observe different phenotypes for loss of function mutants upon intraperitoneal and intranasal infections from the ones observed for other serotypes. In summary, this study proves that strain 519/43 (serotype 1) can be genetically modified.

The protocol described here starts by using PCR to amplify the left and right homology arms, whilst simultaneously deleting 191 bp from the middle region of the ply gene. While performing the PCR a BamHI site is introduced at the 3&#8217; of the left homology arm and at the 5&#8217; end of the right homology arm (Figure 1A). This is followed by PCR-SOE where left and right homology arms are fused into one amplicon (Figure 1B). This SOE-PCR amplicon is t...

Watch this Scientific Journal Video about Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43 at JoVE.com

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Here, we describe a S. pneumoniae serotype 1 strain 519/43 that can be genetically modified by using its ability to naturally acquire DNA and a suicide-plasmid. As proof of principle, an isogenic mutant in the pneumolysin (ply) gene was made.

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, ...

constructing-mutants-serotype-1-streptococcus-pneumoniae-strain

Research

JoVE Journal

Immunology and Infection

1.7K Views.  London School of Hygiene and Tropical Medicine. Hier beschrijven we een S. pneumoniae serotype 1 stam 519/43 die genetisch kan worden gemodificeerd door gebruik te maken van zijn vermogen om op natuurlijke wijze DNA en een zelfmoordplasmide te verkrijgen. Als proof of principle werd een isogene mutant in het pneumolysine (ply) gen gemaakt.

Video: Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in which the gene of interest has been disrupted. A gene-disruption DNA construct containing a suitable antibiotic resistance marker gene is useful for the generation of gene-disrupted strains in bacteria. However, conventional construction methods, which require gene cloning steps, involve complex and time-consuming protocols. Here, a relatively facile, rapid, and cost-effective method for targeted gene disruption in Streptococcus mutans is described. The method utilizes a 2-step fusion polymerase chain reaction (PCR) to generate the disruption construct and electroporation for genetic transformation. This method does not require an enzymatic reaction, other than PCR, and additionally offers greater flexibility in terms of the design of the disruption construct. Employment of electroporation facilitates the preparation of competent cells and improves the transformation efficiency. The present method may be adapted for the generation of gene-disrupted strains of various species.

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

We describe a facile, rapid, and relatively inexpensive method for the generation of gene-disrupted Streptococcus mutans strains; this technique may be adapted for the generation of gene-disrupted strains of various species.

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

Genetics

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing the mucosal surface of the nasopharynx, where it can reside, multiply and eventually overcome host defences to invade to other tissues of the host. Establishment of an infection in the normally lower respiratory tract results in pneumonia. Alternatively, the bacteria can disseminate into the bloodstream causing bacteraemia, which is associated with high mortality rates2, or else lead directly to the development of pneumococcal meningitis. Understanding the kinetics of, and immune responses to, nasopharyngeal colonization is an important aspect of S. pneumoniae infection models.
Our mouse model of intranasal colonization is adapted from human models3 and has been used by multiple research groups in the study of host-pathogen responses in the nasopharynx4-7. In the first part of the model, we use a clinical isolate of S. pneumoniae to establish a self-limiting bacterial colonization that is similar to carriage events in human adults. The procedure detailed herein involves preparation of a bacterial inoculum, followed by the establishment of a colonization event through delivery of the inoculum via an intranasal route of administration. Resident macrophages are the predominant cell type in the nasopharynx during the steady state. Typically, there are few lymphocytes present in uninfected mice8, however mucosal colonization will lead to low- to high-grade inflammation (depending on the virulence of the bacterial species and strain) that will result in an immune response and the subsequent recruitment of host immune cells. These cells can be isolated by a lavage of the tracheal contents through the nares, and correlated to the density of colonization bacteria to better understand the kinetics of the infection.

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Colonization of the murine nasopharynx with Streptococcus pneumoniae and the subsequent extraction of adherent or recruited cells is described. This technique involves flushing the nasopharynx and collection of the fluid through the nares and is adaptable for various readouts, including differential cell quantification and analysis of mRNA expression in situ.

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing ...

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. Despite advances in knowledge of this illness, the availability of intensive care units (ICU), and the use of potent antimicrobial agents and effective vaccines, the mortality rates remain high1. Streptococcus pneumoniae is the leading pathogen of community-acquired pneumonia (CAP) and one of the most common causes of bacteremia in humans. This pathogen is equipped with an armamentarium of surface-exposed adhesins and virulence factors contributing to pneumonia and invasive pneumococcal disease (IPD). The assessment of the in vivo role of bacterial fitness or virulence factors is of utmost importance to unravel S. pneumoniae pathogenicity mechanisms. Murine models of pneumonia, bacteremia, and meningitis are being used to determine the impact of pneumococcal factors at different stages of the infection. Here we describe a protocol to monitor in real-time pneumococcal dissemination in mice after intranasal or intraperitoneal infections with bioluminescent bacteria. The results show the multiplication and dissemination of pneumococci in the lower respiratory tract and blood, which can be visualized and evaluated using an imaging system and the accompanying analysis software.

Streptococcus pneumoniae is the leading pathogen causing severe community-acquired pneumonia and responsible for over 2&#160;million deaths worldwide. The impact of bacterial factors implicated in fitness or virulence can be monitored in real-time in an acute mouse pneumonia or bacteremia model using bioluminescent bacteria.

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal epidemiology, capsular serotyping can provide useful information for vaccine efficacy and impact studies.&#160;The Quellung reaction is the gold standard method for pneumococcal capsular serotyping. The method involves testing a pneumococcal cell suspension with pooled and specific antisera directed against the capsular polysaccharide. The antigen-antibody reactions are observed microscopically. The protocol has three main steps: 1) preparation of a bacterial cell suspension, 2) mixing of cells and antisera on a glass slide, and 3) reading the Quellung reaction using a microscope. The Quellung reaction is reasonably simple to perform and can be applied wherever a suitable microscope and antisera are available.

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

The Quellung reaction is the gold standard technique for serotyping Streptococcus pneumoniae. This technique utilizes a microscope and specific pneumococcal antisera and is commonly used in reference and research laboratories worldwide.

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Visualization of Streptococcus pneumoniae within Cardiac Microlesions and Subsequent Cardiac Remodeling

During bacteremia Streptococcus pneumoniae can translocate across the vascular endothelium into the myocardium and form discrete bacteria-filled microscopic lesions (microlesions) that are remarkable due to the absence of infiltrating immune cells. Due to their release of cardiotoxic products, S. pneumoniae within microlesions are thought to contribute to the heart failure that is frequently observed during fulminate invasive pneumococcal disease in adults. Herein is demonstrated a protocol for experimental mouse infection that leads to reproducible cardiac microlesion formation within 30 hr. Instruction is provided on microlesion identification in hematoxylin &#38; eosin stained heart sections and the morphological distinctions between early and late microlesions are highlighted. Instruction is provided on a protocol for verification of S. pneumoniae within microlesions using antibodies against pneumococcal capsular polysaccharide and immunofluorescent microscopy. Last, a protocol for antibiotic intervention that rescues infected mice and for the detection and assessment of scar formation in the hearts of convalescent mice is provided. Together, these protocols will facilitate the investigation of the molecular mechanisms underlying pneumococcal cardiac invasion, cardiomyocyte death, cardiac remodeling as a result of exposure to S. pneumoniae, and the immune response to the pneumococci in the heart.

Visualization of Streptococcus pneumoniae within Cardiac Microlesions and Subsequent Cardiac Remodeling

Streptococcus pneumoniae forms discrete non-purulent microscopic lesions in the heart. Outlined is the protocol for a murine model of cardiac microlesion formation. Instruction is provided on microlesion visualization using microscopy, discrimination between early and late microlesions, and methods to detect cardiac remodeling in hearts of convalescent animals.

During bacteremia Streptococcus pneumoniae can translocate across the vascular endothelium into the myocardium and form discrete bacteria-filled ...

Medicine

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...

Homogeneous Glycoconjugate Produced by Combined Unnatural Amino Acid Incorporation and Click-Chemistry for Vaccine Purposes

Genetic code expansion is a powerful tool to introduce unnatural amino acids (UAAs) into proteins to modify their characteristics, to study or create new protein functions or to have access to protein conjugates. Stop codon suppression, in particular amber codon suppression, has emerged as the most popular method to genetically introduce UAAs at defined positions. This methodology is herein applied to the preparation of a carrier protein containing an UAA harboring a bioorthogonal functional group. This reactive handle can next be used to specifically and efficiently graft a synthetic oligosaccharide hapten to provide a homogeneous glycoconjugate vaccine. The protocol is limited to the synthesis of glycoconjugates in a 1:1 carbohydrate hapten/carrier protein ratio but amenable to numerous pairs of biorthogonal functional groups. Glycococonjugate vaccine homogeneity is an important criterion to ensure complete physico-chemical characterization, thereby, satisfying more and more demanding drug regulatory agency recommendations, a criterion which is unmet by classical conjugation strategies. Moreover, this protocol makes it possible to finely tune the structure of the actual conjugate vaccine, giving rise to tools to address structure-immunogenicity relationships.

Genetic code expansion is applied for the introduction of an unnatural amino acid bearing a biorthogonal functional group on a carrier protein at a defined site. The biorthogonal function is further used for the site-selective coupling of a carbohydrate antigen to provide a homogeneous glycoconjugate vaccine.

Genetic code expansion is a powerful tool to introduce unnatural amino acids (UAAs) into proteins to modify their characteristics, to study or create new ...

Bioengineering

Purification of a High Molecular Mass Protein in Streptococcus mutans

Elucidation of a gene&#39;s function typically involves comparison of phenotypic traits of wild-type strains and strains in which the gene of interest has been disrupted. Loss of function following gene disruption is subsequently restored by exogenous addition of the product of the disrupted gene. This helps to determine the function of the gene. A method previously described involves generating a gtfC gene-disrupted Streptococcus mutans strain. Here, an undemanding method is described for purifying the gtfC gene product from the newly generated S. mutans strain following the gene disruption. It involves the addition of a polyhistidine-coding sequence at the 3&#8242; end of the gene of interest, which allows simple purification of the gene product using immobilized metal affinity chromatography. No enzymatic reactions other than PCR are required for the genetic modification in this method. The restoration of the gene product by exogenous addition after gene disruption is an efficient method for determining gene function, which may also be adapted to different species.

Purification of a High Molecular Mass Protein in Streptococcus mutans

Described here is a simple method for the purification of a gene product in Streptococcus mutans. This technique may be advantageous in the purification of proteins, especially membrane proteins and high molecular mass proteins, and can be used with various other bacterial species.

Elucidation of a gene&#39;s function typically involves comparison of phenotypic traits of wild-type strains and strains in which the gene of interest has ...

Inducing Meningococcal Meningitis Serogroup C in Mice via Intracisternal Delivery

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. Meningococcus is a transient colonizer of human nasopharynx of approximately 10% of healthy subject. In particular circumstances, it acquires an invasive ability to penetrate the mucosal barrier and invades the bloodstream causing septicaemia. In the latest case, fulminating sepsis could arise even without the consequent development of meningitis. Conversely, bacteria could poorly multiply in the bloodstream, cross the blood brain barrier, reach the central nervous system, leading to fulminant meningitis. The murine models of bacterial meningitis represent a useful tool to investigate the host-pathogen interactions and to analyze the pathogenetic mechanisms responsible for this lethal disease. Although, several experimental model systems have been evaluated over the last decades, none of these were able to reproduce the characteristic pathological events of meningococcal disease. In this experimental protocol, we describe a detailed procedure for the induction of meningococcal meningitis in a mouse model based on the intracisternal inoculation of bacteria. The peculiar signs of human meningitis were recorded in the murine host through the assessment of clinical parameters (e.g., temperature, body weight), evaluation of survival rate, microbiological analysis and histological examination of brain injury. When using intracisternal (i.cist.) inoculum, meningococci complete delivery directly into cisterna magna, leading to a very efficient meningococcal replication in the brain tissue. A 1,000-fold increase of viable count of bacteria is observed in about 18 h. Moreover, meningococci are also found in the spleen, and liver of infected mice, suggesting that the liver may represent a target organ for meningococcal replication.

Here, we describe a method to induce meningococcal meningitis through an intracisternal route of infection in adult mice. We present a step by step protocol of meningococcal infection from the preparation of inoculum to the intracisternal infection; then record the animal survival and evaluate the bacterial loads in murine tissues.

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. ...

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of these products are naturally produced by the organisms, other products require genetic engineering of the organism to increase the yields of production. Avirulent strains of Escherichia coli have traditionally been the preferred bacterial species for producing biopharmaceuticals; however, some products are difficult for E. coli to produce. Thus, avirulent strains of other bacterial species could provide useful alternatives for production of some commercial products. Pseudomonas aeruginosa is a common and well-studied Gram-negative bacterium that could provide a suitable alternative to E. coli. However, P. aeruginosa is an opportunistic human pathogen. Here, we detail a procedure that can be used to generate nonpathogenic strains of P. aeruginosa through sequential genomic deletions using the pEX100T-NotI plasmid. The main advantage of this method is to produce a marker-free strain. This method may be used to generate highly attenuated P. aeruginosa strains for the production of commercial products, or to design strains for other specific uses. We also describe a simple and reproducible mouse model of bacterial systemic infection via intraperitoneal injection of validated test strains to test the attenuation of the genetically engineered strain in comparison to the FDA-approved BL21 strain of E. coli.

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Here, we describe a simple and reproducible protocol of mouse model of infection to evaluate the attenuation of the genetically modified strains of Pseudomonas aeruginosa in comparison to the United States Food and Drug Administration (FDA)-approved Escherichia coli for commercial applications.

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of ...

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Samenvatting

Meer video's verkennen