Wir danken dem Meningitis Trust und dem MRC für die Finanzierung dieser Arbeit.

1. Erzeugung des mutierenden Amplikons mittels SOE-PCR23 und Amplifikation der Spectinomycin-Kassette
<ol><li>Beginnen Sie mit der Durchführung einer PCR zur Amplifikation der Homologiearme (Ply 5' (488 bp) bzw. Ply3' (715 bp)) der flankierenden Regionen des Ply-Gens aus dem Stamm 519/43. Verwenden Sie die Primer plyFw1_NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), ply5'R1_BamHI (CGAAATATAGACCAAAGGACGC GGATCC AGAACCAAACTTGACCTTGA), ply3'F1_BamHI (TCAAGGTCAAGTTTGGTTCTCTGGATCC GCGTCCTTTGGTCTATATTTCG) und plyRv2_NotI (TTTGCGGCCGCCATTTTCTCTCTTATCCTCTACC).</li>
	<li>Verwenden Sie die folgenden PCR-Bedingungen für Schicht5': Denaturierung bei 94 °C für 60 s, Schritt 2: Denaturierung bei 94 °C für 30 s, Schritt 3: Glühen bei 58 °C für 30 s, Schritt 4: Verlängerung bei 72 °C für 30 s, Schritt 5: Zurück zu Schritt 2 und Wiederholung für 35 Zyklen, Schritt 6: endgültige Verlängerung bei 72 °C für 30 s.<ol><li>Verwenden Sie die gleichen PCR-Bedingungen für ply3' mit Ausnahme der Verlängerungszeit in Schritt 4 und Schritt 6, wo sie 60 s betragen sollte.</li>
	</ol></li>
	<li>Analysieren Sie die PCR-Produkte durch Gelelektrophorese und entfernen Sie das Amplikon aus dem Gel.</li>
	<li>Reinigen Sie die PCR-Amplikons gemäß dem Protokoll, das in den Anweisungen des Herstellers (Materialtabelle) beschrieben ist.</li>
	<li>Verwenden Sie äquimolare Mengen beider Homologiearme als Vorlagen in der SOE-PCR. Verschmelzen Sie die beiden Amplikons mit den Primern plyFw1_ NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG) und plyRv2_NotI (TTTGCGGCCGCCATTTTCTCTCTCTTATCCTCTACC).</li>
	<li>Verwenden Sie die folgenden SOE-PCR-Bedingungen (Schritt 1: Denaturierung bei 94 °C für 2 min, Schritt 2: Denaturierung bei 94 °C für 30 s, Schritt 3: Glühen bei 58 °C für 30 s, Schritt 4: Verlängerung bei 68 °C für 60 s, Schritt 5: Zurück zu Schritt 2 und Wiederholung für 25 Zyklen, Schritt 6: endgültige Verlängerung bei 68 °C für 90 s).</li>
	<li>Analysieren Sie das SOE-PCR-Produkt durch Gelelektrophorese. Entfernen Sie es mit einem Gel-Extraktionskit aus dem Gel und befolgen Sie die Anweisungen.</li>
	<li>Amplifizieren Sie die Spectinomycin-Kassette aus dem Plasmid pR412 unter den folgenden PCR-Bedingungen: Schritt 1: Denaturierung bei 94 °C für 60 s, Schritt 2: Denaturierung bei 94 °C für 30 s, Schritt 3: Glühen bei 55 °C für 30 s, Schritt 4: Verlängerung bei 68 °C für 60 s, Schritt 5: Gehen Sie zurück zu Schritt 2 und wiederholen Sie den Vorgang für 25 Zyklen, Schritt 6: Endverlängerung bei 68 °C für 60 s.<ol><li>Verwenden Sie die Primer BamHI_SP2F2 (GGATCC, CTA, GAA, CTA, GTG, GAT, CCC, CC) und BamHI_SP2R2 (GGATCC, AA, TCT, TCT, GCA, GAT, TTT, AC, ATG, ATC, ATC). Das Plasmid pR412 wurde von Dr. Marc PrudHomme (CNRS-Université Paul Sabatier, Toulouse, Frankreich) erworben.</li>
	</ol></li>
	<li>Analysieren Sie die PCR-Amplikons durch Gelelektrophorese. Das resultierende PCR-Amplikon wird wie oben beschrieben entfernt und gereinigt.</li>
</ol>2. Erzeugung des Plasmids pSD1 und chemische Umwandlung von E. coli Dh5α
<ol><li>Führen Sie eine Ligatur gemäß den Herstellerangaben des pGEMT-easy system I (Materialtabelle) durch. In einem Mikrozentrifugenröhrchen werden 5 μl 2x Ligationspuffer, 1 μl pGEMTeasy, 2 μl des ply_SOE Produkts, 1 μl T4-DNA-Ligase und Wasser zu einem Gesamtvolumen von 20 μl gegeben. Über Nacht bei 4 °C inkubieren. Dadurch entsteht das Plasmid pSD1.</li>
	<li>Transformieren Sie chemisch kompetente E. coli Dh5α mit pSD1. Beginnen Sie mit der Inkubation von 50 μl chemisch kompetentem E. coli Dh5α mit 3 μl pSD1-Ligationsreaktion für 15 Minuten auf Eis. Anschließend werden die Zellen einem thermischen Schock (42 °C, 30 s) ausgesetzt. Legen Sie die Zellen für 2 Minuten auf Eis.</li>
	<li>Entfernen Sie die Zellen aus dem Eis und fügen Sie 350 μl S.O.C.-Medien hinzu. Inkubation der Kultur für 2 h bei 37 °C, 120 U/min.</li>
	<li>Platte der Transformation auf Luria Bertani Agar (LBA) ergänzt mit 0,4 mM IPTG, 0,24 mg/ml X-Gal für die Blau/Weiß-Selektion und 100 μg/ml Ampicillin, um sicherzustellen, dass alle in der Platte wachsenden Kolonien das Plasmid-Rückgrat haben. Weiße Kolonien enthalten pSD1.</li>
	<li>Wählen Sie drei weiße Kolonien und richten Sie über Nacht ein Wachstum in 10 ml LB ein, ergänzt mit 100 μg/ml Ampicillin. Die Kulturen werden über Nacht bei 37 °C unter Schütteln inkubiert.</li>
	<li>Am nächsten Tag zentrifugieren Sie die Kulturen bei 3.082 x g und verwenden Sie das Pellet zur Plasmidextraktion.</li>
</ol>3. Plasmid-DNA-Extraktion, Restriktionsverdau von pSD1 und Spectinomycin-Gen und Assemblierung von pSD2
<ol><li>Extrahieren Sie die Plasmid-DNA gemäß den Anweisungen, die mit dem kommerziellen Kit geliefert werden (Materialtabelle).</li>
	<li>Richten Sie einen BamHI-Restriktionsaufschluss sowohl für das pSD1-Plasmid als auch für die zuvor amplifizierte und gereinigte Spectinomycin-Kassette ein. Verwenden Sie die folgenden Bedingungen und Mengen, die in Tabelle 1 beschrieben sind.</li>
	<li>Inkubation der Restriktionsaufschlussreaktionen und Kontrollen bei 37 °C für 3 h.</li>
	<li>Analysieren Sie den Restriktionsaufschluss durch Elektrophorese, entfernen Sie die Bande und reinigen Sie sie gemäß den Anweisungen, die mit dem handelsüblichen Kit geliefert werden (Materialtabelle).</li>
	<li>Als nächstes bereiten Sie eine Ligationsreaktion gemäß den Anweisungen des Herstellers (Materialtabelle) unter Verwendung des BamHI-verdauten pSD1 und Spectinomycin (aus Schritt 3.2) vor. In einem Mikrozentrifugenröhrchen die folgenden Reaktionskomponenten zugeben: 5 μl 2x Ligationspuffer, 2 μL pSD1, 2 μl Spectinomycin-Kassette, 1 μl T4-DNA-Ligase und über Nacht bei 4 °C inkubieren. Dadurch entsteht das Plasmid pSD2.</li>
	<li>Umwandlung des Plasmids pSD2 in chemisch kompetentes E. coli Dh5α, wie in Schritt 2.2 beschrieben.</li>
	<li>Wählen Sie die Transformanten, die das Plasmid pSD2 tragen, basierend auf ihrer Fähigkeit aus, in LBA zu wachsen, das mit 100 μg/ml Spectinomycin und Ampicillin ergänzt wird.</li>
	<li>Führen Sie eine Plasmid-DNA-Extraktion (pSD2) wie oben beschrieben und gemäß den Anweisungen des Herstellers (μl) durch.</li>
</ol>4. Transformation des Stammes 519/43 von S. pneumoniae
<ol><li>Bereiten Sie eine Nachtkultur von S. pneumoniae 519/43 in BHI vor und lassen Sie sie bei 37 °C, 5% CO2 statisch wachsen.</li>
	<li>Am nächsten Tag werden die Kulturen 1:50 und 1:100 in 10 ml frischer BHI-Brühe verdünnt. Inkubieren Sie die Kulturen statisch bei 37 °C, bis der OD595 nm zwischen 0,05 und 0,1 liegt (optimale DNA-Erfassung näher an 0,1 OD).</li>
	<li>Sobald ein OD von 0,1 erreicht ist, nehmen Sie 860 μl und füllen Sie es in ein Mikrozentrifugenröhrchen um. In dasselbe Mikrozentrifugenröhrchen geben Sie: 100 μl 100 mM NaOH, 10 μl 20% (w/v) BSA, 10 μl 100 mM CaCl 2,2 μl 50 ng/ml CSP124 und 500 ng pSD2.</li>
	<li>Die Reaktion wird statisch bei 37 °C für 3 h inkubiert.</li>
	<li>Platte 330 μl auf 5% Blutagarplatten (BA), ergänzt mit 100 μg/ml Spectinomycin, stündlich über die 3 Inkubationsstunden.</li>
	<li>Inkubation der Platten über Nacht bei 37 °C, 5% CO2. Patchen Sie Spectinomycin-resistente Kolonien auf eine andere BA-Platte, die mit 100 μg/ml Spectinomycin ergänzt wurde, sowie auf BA-Platten, die mit 100 μg/ml Ampicillin ergänzt wurden. Inkubieren Sie beide Plattensätze über Nacht unter den oben genannten Bedingungen. Die Ampicillinplatten sollen auf das Vorhandensein des Plasmidrückgrats getestet werden.</li>
	<li>Bestätigen Sie das Vorhandensein der Spectinomycin-Kassette durch PCR unter Verwendung der Primer plyFw1_ NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG) und SPEC_REV (TAATTCCTCTAAGTCATAATTTCCG). Bestätigen Sie die Mutation durch PCR mit den Primern plySCN1 (CCAATGGAAATCGCTAGGCAAGAGATAA) und plySCN2 (ATTACTTAGTCCAACCACCCTGAT), die außerhalb der mutierten Region anhaften.</li>
	<li>Bestätigen Sie die Integration an der richtigen Stelle des Genoms durch Sequenzierung mit den Primern plySCN1 (CCAATGGAAATCGCTAGGCAAGAGATAA), plySCN2 (ATTACTTAGTCCAACCACGGCTGAT) sowie Primern mit ihrer Bindungsstelle in der Spectinomycin-Kassette sqr1 (CCTGATCCAAACATGTAAGTACCACC), sqf2 (CGTAGTTATCTTGGAGAGAATA) spec_sqf1 (GGTACTTACATGTTTGGATCAGG) und spec_sqr2 TATTCTCTCCAAGATAACTACG.</li>
</ol>

<ol>
	<li>Bentley, S. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Analysis+of+the+Capsular+Biosynthetic+Locus+from+All+90+Pneumococcal+Serotypes.">Genetic Analysis of the Capsular Biosynthetic Locus from All 90 Pneumococcal Serotypes.</a> PLoS Genetics. 2 (3), 31 (2006).</li><li>Calix, J. J., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+pneumococcal+serotype,+11E,+has+a+variably+inactivated+wcjE+gene.">A new pneumococcal serotype, 11E, has a variably inactivated wcjE gene.</a> The Journal of Infectious Diseases. 202 (1), 29-38 (2010).</li><li>Park, I. H., Pritchard, D. G., Cartee, R., Brandao, A., Brandileone, M. C. C., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+a+New+Capsular+Serotype+(6C)+within+Serogroup+6+of+Streptococcus+pneumoniae.">Discovery of a New Capsular Serotype (6C) within Serogroup 6 of Streptococcus pneumoniae.</a> Journal of Clinical Microbiology. 45 (4), 1225-1233 (2007).</li><li>Jin, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First+Report+of+Putative+Streptococcus+pneumoniae+Serotype+6D+among+Nasopharyngeal+Isolates+from+Fijian+Children.">First Report of Putative Streptococcus pneumoniae Serotype 6D among Nasopharyngeal Isolates from Fijian Children.</a> The Journal of Infectious Diseases. 200 (9), 1375-1380 (2009).</li><li>Oliver, M. B., vander Linden, M. P. G., K&#252;ntzel, S. A., Saad, J. S., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+Streptococcus+pneumoniae+Serotype+6+Variants+with+Glycosyltransferases+Synthesizing+Two+Differing+Repeating+Units.">Discovery of Streptococcus pneumoniae Serotype 6 Variants with Glycosyltransferases Synthesizing Two Differing Repeating Units.</a> Journal of Biological Chemistry. 288 (36), 25976-25985 (2013).</li><li>Calix, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serological+Characterization+of+Two+Capsule+Subtypes+among+Streptococcus+pneumoniae+Serotype+20+Strains.">Serological Characterization of Two Capsule Subtypes among Streptococcus pneumoniae Serotype 20 Strains.</a> Journal of Biological Chemistry. 287 (33), 27885-27894 (2012).</li><li>Park, I. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=and+Serological+Characterization+of+a+New+Pneumococcal+Serotype,+6H,+and+Generation+of+a+Pneumococcal+Strain+Producing+Three+Different+Capsular+Repeat+Units.">and Serological Characterization of a New Pneumococcal Serotype, 6H, and Generation of a Pneumococcal Strain Producing Three Different Capsular Repeat Units.</a> Clinical and Vaccine Immunology. 22 (3), 313-318 (2015).</li><li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> The Lancet. 374 (9693), 893-902 (2009).</li><li>Henriques-Normark, B., Tuomanen, E. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pneumococcus:+Epidemiology,+Microbiology,+and+Pathogenesis.">The Pneumococcus: Epidemiology, Microbiology, and Pathogenesis.</a> Cold Spring Harbor Perspectives in Medicine. 3 (7), 010215 (2013).</li><li>Leimkugel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Outbreak+of+Serotype+1+Streptococcus+pneumoniae+Meningitis+in+Northern+Ghana+with+Features+That+Are+Characteristic+of+Neisseria+meningitidis+Meningitis+Epidemics.">An Outbreak of Serotype 1 Streptococcus pneumoniae Meningitis in Northern Ghana with Features That Are Characteristic of Neisseria meningitidis Meningitis Epidemics.</a> The Journal of Infectious Diseases. 192 (2), 192-199 (2005).</li><li>Yaro, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiological+and+Molecular+Characteristics+of+a+Highly+Lethal+Pneumococcal+Meningitis+Epidemic+in+Burkina+Faso.">Epidemiological and Molecular Characteristics of a Highly Lethal Pneumococcal Meningitis Epidemic in Burkina Faso.</a> Clinical Infectious Diseases. 43 (6), 693-700 (2006).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+epidemiology+of+pneumococci+obtained+from+Gambian+children+aged+2-29+months+with+invasive+pneumococcal+disease+during+a+trial+of+a+9-valent+pneumococcal+conjugate+vaccine.">Molecular epidemiology of pneumococci obtained from Gambian children aged 2-29 months with invasive pneumococcal disease during a trial of a 9-valent pneumococcal conjugate vaccine.</a> BMC Infectious Diseases. 8 (1), 81 (2008).</li><li>Kwambana-Adams, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+outbreak+of+pneumococcal+meningitis+among+older+children+(&#8805;5+years)+and+adults+after+the+implementation+of+an+infant+vaccination+programme+with+the+13-valent+pneumococcal+conjugate+vaccine+in+Ghana.">An outbreak of pneumococcal meningitis among older children (&#8805;5 years) and adults after the implementation of an infant vaccination programme with the 13-valent pneumococcal conjugate vaccine in Ghana.</a> BMC Infectious Diseases. 16 (1), 575 (2016).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seasonality+and+outbreak+of+a+predominant+Streptococcus+pneumoniae+serotype+1+clone+from+The+Gambia:+Expansion+of+ST217+hypervirulent+clonal+complex+in+West+Africa.">Seasonality and outbreak of a predominant Streptococcus pneumoniae serotype 1 clone from The Gambia: Expansion of ST217 hypervirulent clonal complex in West Africa.</a> BMC Microbiology. 8 (1), 198 (2008).</li><li>Staples, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+of+an+Australian+serotype+1+Streptococcus+pneumoniae+outbreak.">Molecular characterization of an Australian serotype 1 Streptococcus pneumoniae outbreak.</a> Epidemiology and Infection. 143 (2), 325-333 (2015).</li><li>Gessner, B. D., Mueller, J. E., Yaro, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=African+meningitis+belt+pneumococcal+disease+epidemiology+indicates+a+need+for+an+effective+serotype+1+containing+vaccine,+including+for+older+children+and+adults.">African meningitis belt pneumococcal disease epidemiology indicates a need for an effective serotype 1 containing vaccine, including for older children and adults.</a> BMC Infectious Diseases. 10 (1), 22 (2010).</li><li>Hill, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nasopharyngeal+carriage+of+Streptococcus+pneumoniae+in+Gambian+infants:+a+longitudinal+study.">Nasopharyngeal carriage of Streptococcus pneumoniae in Gambian infants: a longitudinal study.</a> Clinical Infectious Diseases. 46 (6), 807-814 (2008).</li><li>Ebruke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+changes+in+nasopharyngeal+carriage+of+Streptococcus+pneumoniae+serotype+1+genotypes+in+healthy+Gambians+before+and+after+the+7-valent+pneumococcal+conjugate+vaccine.">Temporal changes in nasopharyngeal carriage of Streptococcus pneumoniae serotype 1 genotypes in healthy Gambians before and after the 7-valent pneumococcal conjugate vaccine.</a> PeerJ. 3, 90 (2015).</li><li>Adegbola, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+and+antimicrobial+susceptibility+patterns+of+isolates+of+Streptococcus+pneumoniae+causing+invasive+disease+in+The+Gambia+1996-2003.">Serotype and antimicrobial susceptibility patterns of isolates of Streptococcus pneumoniae causing invasive disease in The Gambia 1996-2003.</a> Tropical Medicine and International Health. 11 (7), 1128-1135 (2006).</li><li>Marks, L. R., Reddinger, R. M., Hakansson, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Levels+of+Genetic+Recombination+during+Nasopharyngeal+Carriage+and+Biofilm+Formation+in+Streptococcus+pneumoniae.">High Levels of Genetic Recombination during Nasopharyngeal Carriage and Biofilm Formation in Streptococcus pneumoniae.</a> mBio. 3 (5), (2012).</li><li>Ritchie, N. D., Mitchell, T. J., Evans, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+is+different+about+serotype+1+pneumococci.">What is different about serotype 1 pneumococci.</a> Future Microbiology. 7 (1), 33-46 (2012).</li><li>Harvey, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+variable+region+of+pneumococcal+pathogenicity+island+1+is+responsible+for+unusually+high+virulence+of+a+serotype+1+isolate.">The variable region of pneumococcal pathogenicity island 1 is responsible for unusually high virulence of a serotype 1 isolate.</a> Infection and Immunity. 84 (3), 822-832 (2016).</li><li>Horton, R. M., Cai, Z. L., Ho, S. N., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+splicing+by+overlap+extension:+tailor-made+genes+using+the+polymerase+chain+reaction.">Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.</a> BioTechniques. 8 (5), 528-535 (1990).</li><li>Alioing, G., Granadel, C., Morrison, D. A., Claverys, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Competence+pheromone,+oligopeptide+permease,+and+induction+of+competence+in+Streptococcus+pneumoniae.">Competence pheromone, oligopeptide permease, and induction of competence in Streptococcus pneumoniae.</a> Molecular Microbiology. 21 (3), 471-478 (1996).</li><li>Lund, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Enumeration and description of the strains belonging to the State Serum Institute, Copenhagen Denmark. , (1951).</li><li>Barany, F., Tomasz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+pneumoniae+by+heterologous+plasmid+deoxyribonucleic+acid.">Genetic transformation of Streptococcus pneumoniae by heterologous plasmid deoxyribonucleic acid.</a> Journal of Bacteriology. 144 (2), 698-709 (1980).</li><li>Terra, V. S., Homer, K. A., Rao, S. G., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+novel+&#946;-galactosidase+activity+that+contributes+to+glycoprotein+degradation+and+virulence+in+Streptococcus+pneumoniae.">Characterization of novel &#946;-galactosidase activity that contributes to glycoprotein degradation and virulence in Streptococcus pneumoniae.</a> Infection and Immunity. 78 (1), (2010).</li><li>Terra, V. S., Zhi, X., Kahya, H. F., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumococcal+6-phospho-&#946;-glucosidase+(BglA3)+is+involved+in+virulence+and+nutrient+metabolism.">Pneumococcal 6-phospho-&#946;-glucosidase (BglA3) is involved in virulence and nutrient metabolism.</a> Infection and Immunity. 84 (1), (2015).</li><li>Harvey, R. M., Ogunniyi, A. D., Chen, A. Y., Paton, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumolysin+with+Low+Hemolytic+Activity+Confers+an+Early+Growth+Advantage+to+Streptococcus+pneumoniae+in+the+Blood.">Pneumolysin with Low Hemolytic Activity Confers an Early Growth Advantage to Streptococcus pneumoniae in the Blood.</a> Infection and Immunity. 79 (10), 4122 (2011).</li><li>Terra, V. S., Plumptre, C. D., Wall, E. C., Brown, J. S., Wren, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+pneumolysin+deficient+mutant+in+Streptococcus+pneumoniae+serotype+1+strain+519/43+and+phenotypic+characterisation.">Construction of a pneumolysin deficient mutant in Streptococcus pneumoniae serotype 1 strain 519/43 and phenotypic characterisation.</a> Microbial Pathogenesis. 141, 103999 (2020).</li></ol>

Die Autoren haben nichts zu offenbaren.

Streptococcus pneumoniae, insbesondere Serotyp 1, ist nach wie vor eine globale Bedrohung, die invasive Pneumokokkenerkrankungen und Meningitis verursacht. Trotz der Einführung verschiedener Impfstoffe, die vor Serotyp 1 schützen sollten, ist dieser Serotyp in Afrika immer noch in der Lage, Ausbrüche zu verursachen, die zu einer hohen Morbidität und Mortalität führen13. Die Fähigkeit, diesen Serotyp genetisch zu manipulieren, ist aufgrund seiner klinischen Relevanz von entscheidend...

Streptococcus pneumoniae (S. pneumoniae, der Pneumokokkus) ist weltweit eine der Hauptursachen für Morbidität und Mortalität. Bis vor kurzem wurden fast 100 Serotypen von S. pneumoniae entdeckt 1,2,3,4,5,6,7. Jährlich sterben rund 700.000 Kinder unter 5 Jahrenan der invasiven Pneumokokkenerkrankung (IPD) 8. S. pneumoniae ist weltweit die Hauptursache für bakterielle Pneumonie, Mittelohrentzündung, Meningitis und Septikämie9.
Im afrikanischen Meningitis-Gürtel ist Serotyp 1 für Meningitis-Ausbrüche verantwortlich, bei denen der Sequenztyp (ST) ST217, ein extrem virulenter Sequenztyp, 10,11,12,13,14,15 dominant ist. Seine Bedeutung in der Meningitis-Pathologie wurde mit der von Neisseria meningitidis im afrikanischen Meningitis-Gürtelverglichen 16. Serotyp 1 ist oft die Hauptursache für IPD; Es ist jedoch sehr selten in der Kutsche zu finden. Tatsächlich ist dieser Serotyp in Gambia für 20% aller invasiven Erkrankungen verantwortlich, wurde jedoch nur bei 0,5% der gesunden Träger gefunden14,17,18,19. Genetischer Austausch und Rekombination in kompetenten Pneumokokken erfolgt im Allgemeinen eher bei der Beförderung als bei invasiven Erkrankungen20. Darüber hinaus wurde gezeigt, dass Serotyp 1 eine der kürzesten Trageraten aufweist, die bei Pneumokokken beschrieben wurden (nur 9 Tage). Daher wurde vorgeschlagen, dass dieser Serotyp eine viel niedrigere Rekombinationsrate aufweisen könnte als andere21.
Eingehende Studien sind notwendig, um den Grund für die niedrige Beförderungsrate von Serotyp-1-Stämmen und ihre Bedeutung für invasive Erkrankungen in Afrika südlich der Sahara zu verstehen.
Hier berichten wir über ein Protokoll, das eine genomweite Mutagenese eines bestimmten Serotyp-1-Stammes ermöglicht, 519/43. Dieser Stamm kann leicht neue DNA erwerben und in sein Genom rekombinieren. Diese Methode ist noch nicht übergreifend, aber sie ist sehr effizient, wenn sie im 519/43-Hintergrund durchgeführt wird (andere Ziele wurden mutiert, Manuskripte sind in Vorbereitung). Durch die einfache Verwendung des 519/43-Stammes und die Nutzung seiner natürlichen Kompetenz sowie die Substitution der Art und Weise, wie die exogene DNA bereitgestellt wird, konnten wir das Pneumolysin-Gen (ply) in diesem Serotyp-1-Stamm mutieren. Diese Methode stellt eine Verbesserung gegenüber der von Harvey et al.22 vorgestellten Methode dar, da sie in einem Schritt durchgeführt wird, ohne dass die DNA durch einen anderen Serotyp geleitet werden muss. Nichtsdestotrotz und aufgrund der Variabilität zwischen den Stämmen wurde keine Methode für alle Stämme standardisiert. Die Fähigkeit, bestimmte Gene zu mutieren und ihre Auswirkungen zu beobachten, wird ein tiefgreifendes Verständnis der Serotyp 1 S. pneumoniae-Stämme ermöglichen und Antworten auf die Rolle dieser Stämme bei Meningitis in Afrika südlich der Sahara liefern.

<table>
	<tbody>
		<tr>
			<td>AccuPrime Pfx DNA polymerase</td>
			<td>Invitrogen</td>
			<td>12344024</td>
			<td>Used for amplification of the fragments</td>
		</tr>
		<tr>
			<td>Ampicillin sodium salt</td>
			<td>Sigma Aldrich</td>
			<td>A9518</td>
			<td>Used for bacterial selection on stage 1(pSD1)</td>
		</tr>
		<tr>
			<td>Blood Agar Base</td>
			<td>Oxoid</td>
			<td>CM0055</td>
			<td>Used to plate S. pneumoniae transformants</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumine</td>
			<td>sigma</td>
			<td>55470</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Brain Heart Infusion</td>
			<td>Oxoid</td>
			<td>CM1135</td>
			<td>used to grow S. pneumoniae cells</td>
		</tr>
		<tr>
			<td>Calcium Chloride Cacl2</td>
			<td>Sigma</td>
			<td>449709</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Competence stimulating peptide 1</td>
			<td>AnaSpec</td>
			<td>AS-63779</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Luria Broth Agar</td>
			<td>Gibco</td>
			<td>22700025</td>
			<td>used for plating and selection of pSD1 and pSD2</td>
		</tr>
		<tr>
			<td>Luria Broth Base (Miller&#39;s formulation)</td>
			<td>Gibco</td>
			<td>12795027</td>
			<td>used for plating and selection of pSD1 and pSD2</td>
		</tr>
		<tr>
			<td>Monarch Gel Extraction Kit</td>
			<td>NEB</td>
			<td>T1020S</td>
			<td>Used to extract the bands from the DNA gel</td>
		</tr>
		<tr>
			<td>Monarch Plasmid Miniprep Kit</td>
			<td>NEB</td>
			<td>T1010S</td>
			<td>Used to extract plasmid from the cells</td>
		</tr>
		<tr>
			<td>pGEM T-easy</td>
			<td>Promega</td>
			<td>A1360</td>
			<td>used as suicide plasmid</td>
		</tr>
		<tr>
			<td>S.O.C.</td>
			<td>Invitrogen</td>
			<td>15544034</td>
			<td>used for recovery of cells after transformation</td>
		</tr>
		<tr>
			<td>Sodium Hydroxide (NaOH)</td>
			<td>Sigma</td>
			<td>S0899</td>
			<td>used for S.pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Spectinomycin Hydrochloride</td>
			<td>SigmaAldrich</td>
			<td>PHR1426</td>
			<td>Used for bacterial selection</td>
		</tr>
		<tr>
			<td>Subcloning Efficiency DH5&#945; Competent Cells</td>
			<td>Invitrogen</td>
			<td>18265017</td>
			<td>used for the creation of pSD1 and pSD2</td>
		</tr>
	</tbody>
</table>

constructing mutants in serotype 1 streptococcus pneumoniae strain 519/43

Streptococcus pneumoniae Serotyp 1 ist nach wie vor ein großes Problem in Ländern mit niedrigem und mittlerem Einkommen, insbesondere in Afrika südlich der Sahara. Trotz seiner Bedeutung wurden Studien zu diesem Serotyp durch den Mangel an genetischen Werkzeugen behindert, um ihn zu modifizieren. In dieser Studie beschreiben wir eine Methode zur genetischen Modifikation eines klinischen Serotyp-1-Isolats (Stamm 519/43). Interessanterweise wurde dies erreicht, indem die Fähigkeit der Pneumokokken ausgenutzt wurde, DNA auf natürliche Weise zu erwerben. Im Gegensatz zu den meisten Pneumokokken war die Verwendung von linearer DNA jedoch nicht erfolgreich; Um diesen wichtigen Stamm zu mutieren, musste ein Selbstmord-Plasmid verwendet werden. Diese Methodik hat die Mittel für ein tieferes Verständnis dieses schwer fassbaren Serotyps geschaffen, sowohl in Bezug auf seine Biologie als auch auf seine Pathogenität. Um die Methode zu validieren, wurde das wichtigste bekannte Pneumokokken-Toxin, Pneumolysin, mutiert, da es einen bekannten und leicht zu verfolgenden Phänotyp aufweist. Wir zeigten, dass die Mutante erwartungsgemäß ihre Fähigkeit verlor, rote Blutkörperchen zu lysieren. Indem wir in der Lage waren, ein wichtiges Gen im interessierenden Serotyp zu mutieren, konnten wir verschiedene Phänotypen für Funktionsverlustmutanten bei intraperitonealen und intranasalen Infektionen beobachten, die für andere Serotypen beobachtet wurden. Zusammenfassend belegt diese Studie, dass der Stamm 519/43 (Serotyp 1) genetisch verändert werden kann.

Das hier beschriebene Protokoll beginnt mit der Verwendung von PCR zur Amplifikation des linken und rechten Homologiearms, während gleichzeitig 191 bp aus der mittleren Region des Lagengens gelöscht werden. Während der Durchführung der PCR wird eine BamHI-Stelle am 3'-Ende des linken Homologiearms und am 5'-Ende des rechten Homologiearms eingeführt (Abbildung 1A). Darauf folgt die PCR-SOE, bei der linke und rechte Homologiearme zu einem Amplikon fusioniert werden (<strong class...

Watch this Scientific Journal Video about Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43 at JoVE.com

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Hier beschreiben wir einen S. pneumoniae Serotyp 1 Stamm 519/43, der genetisch verändert werden kann, indem er seine Fähigkeit nutzt, DNA und ein Suizid-Plasmid auf natürliche Weise zu erwerben. Als Prinzipienbeweis wurde eine isogene Mutante im Pneumolysin-Gen (Ply) hergestellt.

Konstruktion von Mutanten im Serotyp 1 Streptococcus pneumoniae Stamm 519/43

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, ...

constructing-mutants-serotype-1-streptococcus-pneumoniae-strain

Research

JoVE Journal

Immunology and Infection

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

1.6K Aufrufe.  London School of Hygiene and Tropical Medicine. Hier beschreiben wir einen S. pneumoniae Serotyp 1 Stamm 519/43, der genetisch verändert werden kann, indem er seine Fähigkeit nutzt, DNA und ein Suizid-Plasmid auf natürliche Weise zu erwerben. Als Prinzipienbeweis wurde eine isogene Mutante im Pneumolysin-Gen (Ply) hergestellt.

Serie: Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

During the 1918 influenza virus pandemic, which killed approximately 50 million people worldwide, the majority of fatalities were not the result of infection with influenza virus alone. Instead, most individuals are thought to have succumbed to a secondary bacterial infection, predominately caused by the bacterium Streptococcus pneumoniae (the pneumococcus). The synergistic relationship between infections caused by influenza virus and the pneumococcus has subsequently been observed during the 1957 Asian influenza virus pandemic, as well as during seasonal outbreaks of the virus (reviewed in 1, 2). Here, we describe a protocol used to investigate the mechanism(s) that may be involved in increased morbidity as a result of concurrent influenza A virus and S. pneumoniae infection. We have developed an infant murine model to reliably and reproducibly demonstrate the effects of influenza virus infection of mice colonised with S. pneumoniae. Using this protocol, we have provided the first insight into the kinetics of pneumococcal transmission between co-housed, neonatal mice using in vivo imaging 3.

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

A concurrent infection with influenza A virus is one of the factors implicated in the induction of invasive pneumococcal disease during asymptomatic Streptococcus pneumoniae carriage. Here we describe a mixed infection method using infant mice to investigate the synergism between these two respiratory pathogens.

Mit Bioluminescent Imaging, um Synergie von Untersuchen Streptococcus pneumoniae Und Influenza A Virus in Infant Mäuse

During the 1918 influenza virus pandemic, which killed approximately 50 million people worldwide, the majority of fatalities were not the result of ...

Forschung

Immunologie und Infektion

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

Genotypische Inference von HIV-1 Tropismus mit Populations-basierte Sequenzierung von V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy

During the last few years scientists became increasingly aware that average data obtained from microbial population based experiments are not representative of the behavior, status or phenotype of single cells. Due to this new insight the number of single cell studies rises continuously (for recent reviews see 1,2,3). However, many of the single cell techniques applied do not allow monitoring the development and behavior of one specific single cell in time (e.g. flow cytometry or standard microscopy).
Here, we provide a detailed description of a microscopy method used in several recent studies 4, 5, 6, 7, which allows following and recording (fluorescence of) individual bacterial cells of Bacillus subtilis and Streptococcus pneumoniae through growth and division for many generations. The resulting movies can be used to construct phylogenetic lineage trees by tracing back the history of a single cell within a population that originated from one common ancestor. This time-lapse fluorescence microscopy method cannot only be used to investigate growth, division and differentiation of individual cells, but also to analyze the effect of cell history and ancestry on specific cellular behavior. Furthermore, time-lapse microscopy is ideally suited to examine gene expression dynamics and protein localization during the bacterial cell cycle. The method explains how to prepare the bacterial cells and construct the microscope slide to enable the outgrowth of single cells into a microcolony. In short, single cells are spotted on a semi-solid surface consisting of growth medium supplemented with agarose on which they grow and divide under a fluorescence microscope within a temperature controlled environmental chamber. Images are captured at specific intervals and are later analyzed using the open source software ImageJ.

Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy

This protocol provides a step-by-step procedure to monitor single cell behavior of different bacteria in time using automated fluorescence time-lapse microscopy. Furthermore, we provide guidelines how to analyze the microscopy images.

Live Cell Imaging von Bacillus subtilis Und Streptococcus pneumoniae Verwendung von Automated Zeitraffer-Mikroskopie

During the last few years scientists became increasingly aware that average data obtained from microbial population based experiments are not ...

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing the mucosal surface of the nasopharynx, where it can reside, multiply and eventually overcome host defences to invade to other tissues of the host. Establishment of an infection in the normally lower respiratory tract results in pneumonia. Alternatively, the bacteria can disseminate into the bloodstream causing bacteraemia, which is associated with high mortality rates2, or else lead directly to the development of pneumococcal meningitis. Understanding the kinetics of, and immune responses to, nasopharyngeal colonization is an important aspect of S. pneumoniae infection models.
Our mouse model of intranasal colonization is adapted from human models3 and has been used by multiple research groups in the study of host-pathogen responses in the nasopharynx4-7. In the first part of the model, we use a clinical isolate of S. pneumoniae to establish a self-limiting bacterial colonization that is similar to carriage events in human adults. The procedure detailed herein involves preparation of a bacterial inoculum, followed by the establishment of a colonization event through delivery of the inoculum via an intranasal route of administration. Resident macrophages are the predominant cell type in the nasopharynx during the steady state. Typically, there are few lymphocytes present in uninfected mice8, however mucosal colonization will lead to low- to high-grade inflammation (depending on the virulence of the bacterial species and strain) that will result in an immune response and the subsequent recruitment of host immune cells. These cells can be isolated by a lavage of the tracheal contents through the nares, and correlated to the density of colonization bacteria to better understand the kinetics of the infection.

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Colonization of the murine nasopharynx with Streptococcus pneumoniae and the subsequent extraction of adherent or recruited cells is described. This technique involves flushing the nasopharynx and collection of the fluid through the nares and is adaptable for various readouts, including differential cell quantification and analysis of mRNA expression in situ.

Charakterisierung von Entzündungsreaktionen während der intranasalen Kolonisation mit Streptococcus pneumoniae

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing ...

Monitoring Changes in Membrane Polarity, Membrane Integrity, and Intracellular Ion Concentrations in Streptococcus pneumoniae Using Fluorescent Dyes

Membrane depolarization and ion fluxes are events that have been studied extensively in biological systems due to their ability to profoundly impact cellular functions, including energetics and signal transductions. While both fluorescent and electrophysiological methods, including electrode usage and patch-clamping, have been well developed for measuring these events in eukaryotic cells, methodology for measuring similar events in microorganisms have proven more challenging to develop given their small size in combination with the more complex outer surface of bacteria shielding the membrane. During our studies of death-initiation in Streptococcus pneumoniae (pneumococcus), we wanted to elucidate the role of membrane events, including changes in polarity, integrity, and intracellular ion concentrations. Searching the literature, we found that very few studies exist. Other investigators had monitored radioisotope uptake or equilibrium to measure ion fluxes and membrane potential and a limited number of studies, mostly in Gram-negative organisms, had seen some success using carbocyanine or oxonol fluorescent dyes to measure membrane potential, or loading bacteria with cell-permeant acetoxymethyl (AM) ester versions of ion-sensitive fluorescent indicator dyes. We therefore established and optimized protocols for measuring membrane potential, rupture, and ion-transport in the Gram-positive organism S. pneumoniae. We developed protocols using the bis-oxonol dye DiBAC4(3) and the cell-impermeant dye propidium iodide to measure membrane depolarization and rupture, respectively, as well as methods to optimally load the pneumococci with the AM esters of the ratiometric dyes Fura-2, PBFI, and BCECF to detect changes in intracellular concentrations of Ca2+, K+, and H+, respectively, using a fluorescence-detection plate reader. These protocols are the first of their kind for the pneumococcus and the majority of these dyes have not been used in any other bacterial species. Though our protocols have been optimized for S. pneumoniae, we believe these approaches should form an excellent starting-point for similar studies in other bacterial species.

Monitoring Changes in Membrane Polarity, Membrane Integrity, and Intracellular Ion Concentrations in Streptococcus pneumoniae Using Fluorescent Dyes

Unlike that seen for eukaryotes, there is a paucity of studies that detail membrane depolarization and ion concentration changes in bacteria, primarily as their small size makes conventional methods of measurement difficult. Here, we detail protocols for monitoring such events in the significant Gram-positive pathogen Streptococcus pneumoniae utilizing fluorescence techniques.

Überwachen von Änderungen in Membran-Polarity, Membrane Integrity und intrazelluläre Ionenkonzentrationen in<em&gt; Streptococcus pneumoniae</em&gt; Verwenden von Fluoreszenzfarbstoffen

Membrane depolarization and ion fluxes are events that have been studied extensively in biological systems due to their ability to profoundly impact ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal epidemiology, capsular serotyping can provide useful information for vaccine efficacy and impact studies.&#160;The Quellung reaction is the gold standard method for pneumococcal capsular serotyping. The method involves testing a pneumococcal cell suspension with pooled and specific antisera directed against the capsular polysaccharide. The antigen-antibody reactions are observed microscopically. The protocol has three main steps: 1) preparation of a bacterial cell suspension, 2) mixing of cells and antisera on a glass slide, and 3) reading the Quellung reaction using a microscope. The Quellung reaction is reasonably simple to perform and can be applied wherever a suitable microscope and antisera are available.

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

The Quellung reaction is the gold standard technique for serotyping Streptococcus pneumoniae. This technique utilizes a microscope and specific pneumococcal antisera and is commonly used in reference and research laboratories worldwide.

Kapsel Serotypisierung von<em&gt; Streptococcus pneumoniae</em&gt; Verwenden der Quellung Reaktion

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major cause of morbidity and mortality world-wide. Current vaccines target the pneumococcal capsule, and there are over 90 capsular serotypes. Serotyping pneumococcal isolates is therefore important for assessing the impact of vaccination programs and for epidemiological purposes. The World Health Organization has recommended latex agglutination as an alternative method to the &#8216;gold standard&#8217; Quellung test for serotyping pneumococci. Latex agglutination is a relatively simple, quick and inexpensive method; and is therefore suitable for resource-poor settings as well as laboratories with high-volume workloads. Latex agglutination reagents can be prepared in-house utilizing commercially-sourced antibodies that are passively attached to latex particles. This manuscript describes a method of production and quality control of latex agglutination reagents, and details a sequential testing approach which is time- and cost-effective. 
This method of production and quality control may also be suitable for other testing purposes.

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Latex agglutination testing is a simple, rapid and inexpensive method for serotyping Streptococcus pneumoniae, and has also been widely applied in diagnostic microbiology. This manuscript describes the in-house production of latex agglutination reagents, quality control procedures and the application of this technique to pneumococcal serotyping.

Kapsel Serotypisierung<em&gt; Streptococcus pneumoniae</em&gt; Durch Latexagglutination

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major ...

A Murine Model of Group B Streptococcus Vaginal Colonization

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of 10 - 30% of adults. In immune-compromised individuals, including neonates, pregnant women, and the elderly, GBS may switch to an invasive pathogen causing sepsis, arthritis, pneumonia, and meningitis. Because GBS is a leading bacterial pathogen of neonates, current prophylaxis is comprised of late gestation screening for GBS vaginal colonization and subsequent peripartum antibiotic treatment of GBS-positive mothers. Heavy GBS vaginal burden is a risk factor for both neonatal disease and colonization. Unfortunately, little is known about the host and bacterial factors that promote or permit GBS vaginal colonization. This protocol describes a technique for establishing persistent GBS vaginal colonization using a single &#946;-estradiol pre-treatment and daily sampling to determine bacterial load. It further details methods to administer additional therapies or reagents of interest and to collect vaginal lavage fluid and reproductive tract tissues. This mouse model will further the understanding of the GBS-host interaction within the vaginal environment, which will lead to potential therapeutic targets to control maternal vaginal colonization during pregnancy and to prevent transmission to the vulnerable newborn. It will also be of interest to increase our understanding of general bacterial-host interactions in the female vaginal tract.

A Murine Model of Group B Streptococcus Vaginal Colonization

The purpose of this protocol is to imitate human group B Streptococcus (GBS) vaginal colonization in a murine model. This method may be used to investigate host immune responses and bacterial factors contributing to GBS vaginal persistence, as well as to test therapeutic strategies.

Ein Mausmodell der Gruppe B<em&gt; Streptococcus</em&gt; Vaginal Colonization

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of ...

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or A. baumannii

Efficacy of candidate antibacterial treatments must be demonstrated in animal models of infection as part of the discovery and development process, preferably in models which mimic the intended clinical indication. A method for inducing robust lung infections in immunocompetent rats and mice is described which allows for the assessment of treatments in a model of serious pneumonia caused by S. pneumoniae, H. influenzae, P. aeruginosa, K. pneumoniae or A. baumannii. Animals are anesthetized, and an agar-based inoculum is deposited deep into the lung via nonsurgical intratracheal intubation. The resulting infection is consistent, reproducible, and stable for at least 48 h and up to 96 h for most isolates. Studies with marketed antibacterials have demonstrated good correlation between in vivo efficacy and in vitro susceptibility, and concordance between pharmacokinetic/pharmacodynamic targets determined in this model and clinically accepted targets has been observed. Although there is an initial time investment when learning the technique, it can be performed quickly and efficiently once proficiency is achieved. Benefits of the model include elimination of the neutropenic requirement, increased robustness and reproducibility, ability to study more pathogens and isolates, improved flexibility in study design and establishment of a challenging infection in an immunocompetent host.

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or  A. baumannii

A method for establishing lung infections in immunocompetent rodents is described. With proficiency, this method can be performed quickly and easily to induce stable infection with many isolates of S. pneumoniae, H. influenzae, P. aeruginosa, K. pneumoniae and A. baumannii.

A Robust Pneumonia Modell in intaktem Immunsystem Nagetiere zur Bewertung antibakterieller Wirksamkeit gegen<i&gt; S. pneumoniae</i&gt;,<i&gt; H. influenzae</i&gt;,<i&gt; K. pneumoniae</i&gt;,<em&gt; P. aeruginosa</em&gt; oder<em&gt; A. baumannii</em

Efficacy of candidate antibacterial treatments must be demonstrated in animal models of infection as part of the discovery and development process, ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

Replikation von bestellt, Nonredundant Bibliothek von Pseudomonas Aeruginosa Stamm PA14 Transposon Insertion Mutanten

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...