We would like to thank the Meningitis Trust and the MRC for providing funding for this work.

1. Generation of the mutating amplicon by SOE-PCR23 and amplification of the spectinomycin cassette
<ol>
	<li>Start by performing PCR for the amplification of the homology arms (ply 5&#8217; (488 bp) and ply3&#8217; (715 bp) respectively) of the flanking regions of the ply gene from strain 519/43. Use primers plyFw1_NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), ply5&#8217;R1_BamHI (CGAAATATAGACCAAAGGACGCGGATCC AGAACCAAACTTGACCTTGA), ply3&#8217;F1_BamHI (TCAAGGTCAAGTTTGGTTCTGGATCC GCGTCCTTTGGTCTATATTTCG) and plyRv2_NotI (TTTGCGGCCGCCATTTTCTACCTTATCCTCTACC).</li>
	<li>Use the following PCR conditions for ply5&#8217;: denaturing at 94 &#176;C for 60 s, step 2: denaturing at 94 &#176;C for 30 s, step 3: annealing at 58 &#176;C for 30 s, step 4: extension at 72 &#176;C for 30 s, step 5: go back to step 2 and repeat for 35 cycles, step 6: final extension at 72&#176;C for 30 s.
	<ol>
		<li>Use the same PCR conditions for ply3&#8217; with the exception of the extension time on step 4 and step 6 where it should be 60 s.</li>
	</ol>
	</li>
	<li>Analyze the PCR products by gel electrophoresis and excise the amplicon from the gel.</li>
	<li>Purify the PCR amplicons following the protocol described in the manufacturer&#8217;s instructions (Table of Materials).</li>
	<li>Use equimolar amounts of both homology arms as templates in the SOE-PCR. Fuse the two amplicons using primers plyFw1_ NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), and plyRv2_NotI (TTTGCGGCCGCCATTTTCTACCTTATCCTCTACC).</li>
	<li>Use the following SOE-PCR conditions (step1: denaturing at 94 &#176;C for 2 min, step 2: denaturing at 94 &#176;C for 30 s, step 3: annealing 58 &#176;C for 30 s, Step 4: extension at 68 &#176;C for 60 s, step 5: go back to step 2 and repeat for 25 cycles, step 6: final extension at 68 &#176;C for 90 s).</li>
	<li>Analyze the SOE-PCR product by gel electrophoresis. Excise it from the gel using a gel extraction kit and follow the instructions provided.</li>
	<li>Amplify the spectinomycin cassette from plasmid pR412 using the following PCR conditions: step 1: denaturing at 94 &#176;C for 60 s, step 2: denaturing at 94 &#176;C for 30 s, step 3: annealing at 55 &#176;C for 30 s, step 4: extension at 68 &#176;C for 60 s, step 5: go back to step 2 and repeat for 25 cycles, step 6: final extension at 68 &#176;C for 60 s.
	<ol>
		<li>Use primers BamHI_SP2F2 (GGATCC CTA GAA CTA GTG GAT CCC CC) and BamHI_SP2R2 (GGATCC AAT TCT GCA GAT TTT AC ATG ATC). Plasmid pR412 was acquired from Dr Marc PrudHomme (CNRS-Universite Paul Sabatier Toulouse France).</li>
	</ol>
	</li>
	<li>Analyze the PCR amplicons by gel electrophoresis. Excise and purify the resulting PCR amplicon as described above.</li>
</ol>
2. Generation of plasmid pSD1 and Chemical transformation of E. coli Dh5&#945;
<ol>
	<li>Perform a ligation following the pGEMT-easy system I manufacturer instructions (Table of Materials). In a microcentrifuge tube, add 5 &#181;L of 2x ligation buffer, 1 &#181;L of pGEMTeasy, 2 &#181;L of the ply_SOE product, 1 &#181;L of T4 DNA ligase and water to a 20 &#181;L total volume. Incubate overnight at 4 &#176;C. This generates plasmid pSD1.</li>
	<li>Transform chemically competent E. coli Dh5&#945; with pSD1. Start by incubating 50 &#181;L of chemically competent E. coli Dh5&#945; with 3 &#181;L of pSD1 ligation reaction for 15 min on ice. Then continue by exposing the cells to thermic shock (42 &#176;C, 30 s). Place the cells on ice for 2 min.</li>
	<li>Remove the cells from ice and add 350 &#181;L of S.O.C media. Incubate the culture for 2 h at 37 &#176;C, 120 rpm.</li>
	<li>Plate the transformation on Luria Bertani Agar (LBA) supplemented with 0.4 mM IPTG, 0.24 mg/mL X-Gal for blue/white selection and 100 &#181;g/mL ampicillin to ensure all colonies growing in the plate have the plasmid backbone. White colonies contain pSD1.</li>
	<li>Pick three white colonies and set up overnight growths in 10 mL of LB, supplemented with 100 &#181;g/mL ampicillin. Incubate the cultures overnight at 37 &#176;C with shaking.</li>
	<li>The next day centrifuge the cultures at 3,082 x g and use the pellet for plasmid extraction.</li>
</ol>
3. Plasmid DNA extraction, restriction digestion of pSD1 and spectinomycin gene and assembly of pSD2
<ol>
	<li>Extract the plasmid DNA following the instructions provided with the commercial kit (Table of Materials).</li>
	<li>Set up a BamHI-restriction digestion for both pSD1 plasmid and the spectinomycin cassette previously amplified and purified. Use the following conditions and quantities described in Table 1.</li>
	<li>Incubate the restriction digestion reactions and controls at 37 &#176;C for 3 h.</li>
	<li>Analyze the restriction digest by electrophoresis, excise the band and purify following the instructions provided with the commercial kit (Table of Materials).</li>
	<li>Next, prepare a ligation reaction following the manufacturer instructions (Table of Materials) using the BamHI- digested pSD1 and spectinomycin (from step 3.2). In a microcentrifuge tube, add the following reaction components: 5 &#181;L of 2x ligation buffer, 2 &#181;L pSD1, 2 &#181;L of spectinomycin cassette, 1 &#181;L of T4 DNA ligase and incubate overnight at 4 &#176;C. This generates plasmid pSD2.</li>
	<li>Transform plasmid pSD2 into chemically competent E. coli Dh5&#945; as described in step 2.2.</li>
	<li>Select the transformants carrying plasmid pSD2 based on their ability to grow in LBA supplemented with 100 &#181;g/mL of spectinomycin and ampicillin.</li>
	<li>Perform a plasmid DNA extraction (pSD2) as described above and following the manufacturer&#8217;s instructions (&#181;L).</li>
</ol>
4. Transformation of S. pneumoniae strain 519/43
<ol>
	<li>Prepare an overnight culture of S. pneumoniae 519/43 in BHI and allow it to grow statically at 37 &#176;C, 5% CO2.</li>
	<li>The following day dilute the cultures 1:50 and 1:100 in 10 mL of fresh BHI broth. Incubate the cultures statically at 37 &#176;C until the OD595nm is between 0.05 and 0.1 (optimal acquisition of DNA closer to 0.1 OD).</li>
	<li>Once an OD of 0.1 is reached, take 860 &#181;L and transfer into a microcentrifuge tube. In this same microcentrifuge tube add: 100 &#181;L of 100 mM NaOH, 10 &#181;L of 20% (w/v) BSA, 10 &#181;L of 100 mM CaCl2, 2 &#181;L of 50 ng/mL CSP124 and 500 ng of pSD2.</li>
	<li>Incubate the reaction statically at 37 &#176;C for 3 h.</li>
	<li>Plate 330 &#181;L onto 5% blood agar plates (BA) supplemented with 100 &#956;g/mL spectinomycin, every hour over the 3 incubation hours.</li>
	<li>Incubate plates overnight at 37 &#176;C, 5% CO2. Patch spectinomycin resistant colonies onto another BA plate supplemented with 100 &#956;g/mL spectinomycin as well as onto BA plates supplemented with 100 &#956;g/mL of ampicillin. Incubate both sets of plates overnight under the conditions stated above. The ampicillin plates are to test for the presence of the plasmid backbone.</li>
	<li>Confirm the presence of the spectinomycin cassette by PCR using primers plyFw1_ NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG) and SPEC_REV (TAATTCCTCTAAGTCATAATTTCCG). Confirm the mutation by PCR using primers plySCN1 (CCAATGGAAATCGCTAGGCAAGAGATAA) and plySCN2 (ATTACTTAGTCCAACCACGGCTGAT) which attach outside of the mutated region.</li>
	<li>Confirm the integration in the correct location of the genome by sequencing using primers plySCN1 (CCAATGGAAATCGCTAGGCAAGAGATAA), plySCN2 (ATTACTTAGTCCAACCACGGCTGAT), as well as primers with their binding site in the spectinomycin cassette sqr1 (CCTGATCCAAACATGTAAGTACC) sqf2 (CGTAGTTATCTTGGAGAGAATA) spec_sqf1 (GGTACTTACATGTTTGGATCAGG ) and spec_sqr2 TATTCTCTCCAAGATAACTACG.</li>
</ol>

<ol>
	<li>Bentley, S. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Analysis+of+the+Capsular+Biosynthetic+Locus+from+All+90+Pneumococcal+Serotypes.">Genetic Analysis of the Capsular Biosynthetic Locus from All 90 Pneumococcal Serotypes.</a> PLoS Genetics. 2 (3), 31 (2006).</li><li>Calix, J. J., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+pneumococcal+serotype,+11E,+has+a+variably+inactivated+wcjE+gene.">A new pneumococcal serotype, 11E, has a variably inactivated wcjE gene.</a> The Journal of Infectious Diseases. 202 (1), 29-38 (2010).</li><li>Park, I. H., Pritchard, D. G., Cartee, R., Brandao, A., Brandileone, M. C. C., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+a+New+Capsular+Serotype+(6C)+within+Serogroup+6+of+Streptococcus+pneumoniae.">Discovery of a New Capsular Serotype (6C) within Serogroup 6 of Streptococcus pneumoniae.</a> Journal of Clinical Microbiology. 45 (4), 1225-1233 (2007).</li><li>Jin, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First+Report+of+Putative+Streptococcus+pneumoniae+Serotype+6D+among+Nasopharyngeal+Isolates+from+Fijian+Children.">First Report of Putative Streptococcus pneumoniae Serotype 6D among Nasopharyngeal Isolates from Fijian Children.</a> The Journal of Infectious Diseases. 200 (9), 1375-1380 (2009).</li><li>Oliver, M. B., vander Linden, M. P. G., K&#252;ntzel, S. A., Saad, J. S., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+Streptococcus+pneumoniae+Serotype+6+Variants+with+Glycosyltransferases+Synthesizing+Two+Differing+Repeating+Units.">Discovery of Streptococcus pneumoniae Serotype 6 Variants with Glycosyltransferases Synthesizing Two Differing Repeating Units.</a> Journal of Biological Chemistry. 288 (36), 25976-25985 (2013).</li><li>Calix, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serological+Characterization+of+Two+Capsule+Subtypes+among+Streptococcus+pneumoniae+Serotype+20+Strains.">Serological Characterization of Two Capsule Subtypes among Streptococcus pneumoniae Serotype 20 Strains.</a> Journal of Biological Chemistry. 287 (33), 27885-27894 (2012).</li><li>Park, I. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=and+Serological+Characterization+of+a+New+Pneumococcal+Serotype,+6H,+and+Generation+of+a+Pneumococcal+Strain+Producing+Three+Different+Capsular+Repeat+Units.">and Serological Characterization of a New Pneumococcal Serotype, 6H, and Generation of a Pneumococcal Strain Producing Three Different Capsular Repeat Units.</a> Clinical and Vaccine Immunology. 22 (3), 313-318 (2015).</li><li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> The Lancet. 374 (9693), 893-902 (2009).</li><li>Henriques-Normark, B., Tuomanen, E. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pneumococcus:+Epidemiology,+Microbiology,+and+Pathogenesis.">The Pneumococcus: Epidemiology, Microbiology, and Pathogenesis.</a> Cold Spring Harbor Perspectives in Medicine. 3 (7), 010215 (2013).</li><li>Leimkugel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Outbreak+of+Serotype+1+Streptococcus+pneumoniae+Meningitis+in+Northern+Ghana+with+Features+That+Are+Characteristic+of+Neisseria+meningitidis+Meningitis+Epidemics.">An Outbreak of Serotype 1 Streptococcus pneumoniae Meningitis in Northern Ghana with Features That Are Characteristic of Neisseria meningitidis Meningitis Epidemics.</a> The Journal of Infectious Diseases. 192 (2), 192-199 (2005).</li><li>Yaro, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiological+and+Molecular+Characteristics+of+a+Highly+Lethal+Pneumococcal+Meningitis+Epidemic+in+Burkina+Faso.">Epidemiological and Molecular Characteristics of a Highly Lethal Pneumococcal Meningitis Epidemic in Burkina Faso.</a> Clinical Infectious Diseases. 43 (6), 693-700 (2006).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+epidemiology+of+pneumococci+obtained+from+Gambian+children+aged+2-29+months+with+invasive+pneumococcal+disease+during+a+trial+of+a+9-valent+pneumococcal+conjugate+vaccine.">Molecular epidemiology of pneumococci obtained from Gambian children aged 2-29 months with invasive pneumococcal disease during a trial of a 9-valent pneumococcal conjugate vaccine.</a> BMC Infectious Diseases. 8 (1), 81 (2008).</li><li>Kwambana-Adams, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+outbreak+of+pneumococcal+meningitis+among+older+children+(&#8805;5+years)+and+adults+after+the+implementation+of+an+infant+vaccination+programme+with+the+13-valent+pneumococcal+conjugate+vaccine+in+Ghana.">An outbreak of pneumococcal meningitis among older children (&#8805;5 years) and adults after the implementation of an infant vaccination programme with the 13-valent pneumococcal conjugate vaccine in Ghana.</a> BMC Infectious Diseases. 16 (1), 575 (2016).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seasonality+and+outbreak+of+a+predominant+Streptococcus+pneumoniae+serotype+1+clone+from+The+Gambia:+Expansion+of+ST217+hypervirulent+clonal+complex+in+West+Africa.">Seasonality and outbreak of a predominant Streptococcus pneumoniae serotype 1 clone from The Gambia: Expansion of ST217 hypervirulent clonal complex in West Africa.</a> BMC Microbiology. 8 (1), 198 (2008).</li><li>Staples, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+of+an+Australian+serotype+1+Streptococcus+pneumoniae+outbreak.">Molecular characterization of an Australian serotype 1 Streptococcus pneumoniae outbreak.</a> Epidemiology and Infection. 143 (2), 325-333 (2015).</li><li>Gessner, B. D., Mueller, J. E., Yaro, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=African+meningitis+belt+pneumococcal+disease+epidemiology+indicates+a+need+for+an+effective+serotype+1+containing+vaccine,+including+for+older+children+and+adults.">African meningitis belt pneumococcal disease epidemiology indicates a need for an effective serotype 1 containing vaccine, including for older children and adults.</a> BMC Infectious Diseases. 10 (1), 22 (2010).</li><li>Hill, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nasopharyngeal+carriage+of+Streptococcus+pneumoniae+in+Gambian+infants:+a+longitudinal+study.">Nasopharyngeal carriage of Streptococcus pneumoniae in Gambian infants: a longitudinal study.</a> Clinical Infectious Diseases. 46 (6), 807-814 (2008).</li><li>Ebruke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+changes+in+nasopharyngeal+carriage+of+Streptococcus+pneumoniae+serotype+1+genotypes+in+healthy+Gambians+before+and+after+the+7-valent+pneumococcal+conjugate+vaccine.">Temporal changes in nasopharyngeal carriage of Streptococcus pneumoniae serotype 1 genotypes in healthy Gambians before and after the 7-valent pneumococcal conjugate vaccine.</a> PeerJ. 3, 90 (2015).</li><li>Adegbola, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+and+antimicrobial+susceptibility+patterns+of+isolates+of+Streptococcus+pneumoniae+causing+invasive+disease+in+The+Gambia+1996-2003.">Serotype and antimicrobial susceptibility patterns of isolates of Streptococcus pneumoniae causing invasive disease in The Gambia 1996-2003.</a> Tropical Medicine and International Health. 11 (7), 1128-1135 (2006).</li><li>Marks, L. R., Reddinger, R. M., Hakansson, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Levels+of+Genetic+Recombination+during+Nasopharyngeal+Carriage+and+Biofilm+Formation+in+Streptococcus+pneumoniae.">High Levels of Genetic Recombination during Nasopharyngeal Carriage and Biofilm Formation in Streptococcus pneumoniae.</a> mBio. 3 (5), (2012).</li><li>Ritchie, N. D., Mitchell, T. J., Evans, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+is+different+about+serotype+1+pneumococci.">What is different about serotype 1 pneumococci.</a> Future Microbiology. 7 (1), 33-46 (2012).</li><li>Harvey, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+variable+region+of+pneumococcal+pathogenicity+island+1+is+responsible+for+unusually+high+virulence+of+a+serotype+1+isolate.">The variable region of pneumococcal pathogenicity island 1 is responsible for unusually high virulence of a serotype 1 isolate.</a> Infection and Immunity. 84 (3), 822-832 (2016).</li><li>Horton, R. M., Cai, Z. L., Ho, S. N., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+splicing+by+overlap+extension:+tailor-made+genes+using+the+polymerase+chain+reaction.">Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.</a> BioTechniques. 8 (5), 528-535 (1990).</li><li>Alioing, G., Granadel, C., Morrison, D. A., Claverys, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Competence+pheromone,+oligopeptide+permease,+and+induction+of+competence+in+Streptococcus+pneumoniae.">Competence pheromone, oligopeptide permease, and induction of competence in Streptococcus pneumoniae.</a> Molecular Microbiology. 21 (3), 471-478 (1996).</li><li>Lund, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Enumeration and description of the strains belonging to the State Serum Institute, Copenhagen Denmark. , (1951).</li><li>Barany, F., Tomasz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+pneumoniae+by+heterologous+plasmid+deoxyribonucleic+acid.">Genetic transformation of Streptococcus pneumoniae by heterologous plasmid deoxyribonucleic acid.</a> Journal of Bacteriology. 144 (2), 698-709 (1980).</li><li>Terra, V. S., Homer, K. A., Rao, S. G., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+novel+&#946;-galactosidase+activity+that+contributes+to+glycoprotein+degradation+and+virulence+in+Streptococcus+pneumoniae.">Characterization of novel &#946;-galactosidase activity that contributes to glycoprotein degradation and virulence in Streptococcus pneumoniae.</a> Infection and Immunity. 78 (1), (2010).</li><li>Terra, V. S., Zhi, X., Kahya, H. F., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumococcal+6-phospho-&#946;-glucosidase+(BglA3)+is+involved+in+virulence+and+nutrient+metabolism.">Pneumococcal 6-phospho-&#946;-glucosidase (BglA3) is involved in virulence and nutrient metabolism.</a> Infection and Immunity. 84 (1), (2015).</li><li>Harvey, R. M., Ogunniyi, A. D., Chen, A. Y., Paton, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumolysin+with+Low+Hemolytic+Activity+Confers+an+Early+Growth+Advantage+to+Streptococcus+pneumoniae+in+the+Blood.">Pneumolysin with Low Hemolytic Activity Confers an Early Growth Advantage to Streptococcus pneumoniae in the Blood.</a> Infection and Immunity. 79 (10), 4122 (2011).</li><li>Terra, V. S., Plumptre, C. D., Wall, E. C., Brown, J. S., Wren, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+pneumolysin+deficient+mutant+in+Streptococcus+pneumoniae+serotype+1+strain+519/43+and+phenotypic+characterisation.">Construction of a pneumolysin deficient mutant in Streptococcus pneumoniae serotype 1 strain 519/43 and phenotypic characterisation.</a> Microbial Pathogenesis. 141, 103999 (2020).</li></ol>

The authors have nothing to disclose.

Streptococcus pneumoniae, in particular serotype 1, continues to be a global threat causing invasive pneumococcal disease and meningitis. Despite the introduction of various vaccines that should be protective against serotype 1, in Africa, this serotype is still capable of causing outbreaks that lead to high morbidity and mortality13. The ability to genetically manipulate this serotype is of critical importance because of its clinical relevance. The method described in this study allows t...

Streptococcus pneumoniae (S. pneumoniae, the pneumococcus) is one of the principal causes of morbidity and mortality globally. Up until recently, close to 100 serotypes of S. pneumoniae have been discovered1,2,3,4,5,6,7. Yearly, invasive pneumococcal disease (IPD) claims around 700,000 deaths, of children younger than 5 years old8. S. pneumoniae is the major cause of bacterial pneumonia, otitis media, meningitis and septicaemia worldwide9.
In the African meningitis belt, serotype 1 is responsible for meningitis outbreaks, where sequence type (ST) ST217, an extremely virulent sequence type, is dominant10,11,12,13,14,15. Its importance in meningitis pathology has been likened to that of Neisseria meningitidis in the African meningitis belt16. Serotype 1 is often the main cause of IPD; however, it is very rarely found in carriage. In fact, in the Gambia, this serotype is accountable for 20% of all invasive disease, but it was only found in 0.5% of healthy carriers14,17,18,19. Genetic exchange and recombination in competent pneumococci occurs generally in carriage rather than in invasive disease20. Furthermore, serotype 1 has been shown to have one of the shortest carriage rates described amongst pneumococci (only 9 days). Therefore, it has been proposed that this serotype might have a much lower recombination rate than others21.
In depth studies are necessary to understand the reason behind serotype 1 strains&#8217; low rate of carriage and its importance in invasive disease in sub-Saharan Africa.
Here we report a protocol that allows genome-wide mutagenesis of a particular serotype 1 strain, 519/43. This strain can easily acquire and recombine new DNA into its genome. This method is not yet inter-strain, but it is very efficient when done in 519/43 background (other targets have been mutated, manuscripts in preparation). By simply using 519/43 strain, and exploit its natural competence, as well as substituting the way that the exogenous DNA is provided, we were able to mutate the pneumolysin gene (ply) in this serotype 1 strain. This method represents an improvement on the one presented by Harvey et al.22 as it is done in one-step without the need to passage the DNA through a different serotype. Nevertheless, and due to inter-strain variability, no method has been standardized to all strains. The ability to mutate specific genes and observe its effects will allow a profound understanding of serotype 1 S. pneumoniae strains and it will provide answers for the role of these strains in meningitis in sub-Saharan Africa.

<table>
	<tbody>
		<tr>
			<td>AccuPrime Pfx DNA polymerase</td>
			<td>Invitrogen</td>
			<td>12344024</td>
			<td>Used for amplification of the fragments</td>
		</tr>
		<tr>
			<td>Ampicillin sodium salt</td>
			<td>Sigma Aldrich</td>
			<td>A9518</td>
			<td>Used for bacterial selection on stage 1(pSD1)</td>
		</tr>
		<tr>
			<td>Blood Agar Base</td>
			<td>Oxoid</td>
			<td>CM0055</td>
			<td>Used to plate S. pneumoniae transformants</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumine</td>
			<td>sigma</td>
			<td>55470</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Brain Heart Infusion</td>
			<td>Oxoid</td>
			<td>CM1135</td>
			<td>used to grow S. pneumoniae cells</td>
		</tr>
		<tr>
			<td>Calcium Chloride Cacl2</td>
			<td>Sigma</td>
			<td>449709</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Competence stimulating peptide 1</td>
			<td>AnaSpec</td>
			<td>AS-63779</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Luria Broth Agar</td>
			<td>Gibco</td>
			<td>22700025</td>
			<td>used for plating and selection of pSD1 and pSD2</td>
		</tr>
		<tr>
			<td>Luria Broth Base (Miller&#39;s formulation)</td>
			<td>Gibco</td>
			<td>12795027</td>
			<td>used for plating and selection of pSD1 and pSD2</td>
		</tr>
		<tr>
			<td>Monarch Gel Extraction Kit</td>
			<td>NEB</td>
			<td>T1020S</td>
			<td>Used to extract the bands from the DNA gel</td>
		</tr>
		<tr>
			<td>Monarch Plasmid Miniprep Kit</td>
			<td>NEB</td>
			<td>T1010S</td>
			<td>Used to extract plasmid from the cells</td>
		</tr>
		<tr>
			<td>pGEM T-easy</td>
			<td>Promega</td>
			<td>A1360</td>
			<td>used as suicide plasmid</td>
		</tr>
		<tr>
			<td>S.O.C.</td>
			<td>Invitrogen</td>
			<td>15544034</td>
			<td>used for recovery of cells after transformation</td>
		</tr>
		<tr>
			<td>Sodium Hydroxide (NaOH)</td>
			<td>Sigma</td>
			<td>S0899</td>
			<td>used for S.pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Spectinomycin Hydrochloride</td>
			<td>SigmaAldrich</td>
			<td>PHR1426</td>
			<td>Used for bacterial selection</td>
		</tr>
		<tr>
			<td>Subcloning Efficiency DH5&#945; Competent Cells</td>
			<td>Invitrogen</td>
			<td>18265017</td>
			<td>used for the creation of pSD1 and pSD2</td>
		</tr>
	</tbody>
</table>

constructing mutants in serotype 1 streptococcus pneumoniae strain 519/43

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, studies in this serotype have been hindered by the lack of genetic tools to modify it. In this study, we describe a method to genetically modify a serotype 1 clinical isolate (strain 519/43). Interestingly, this was achieved by exploiting the Pneumococcus&#8217; ability to naturally acquire DNA. However, unlike most pneumococci, the use of linear DNA was not successful; to mutate this important strain, a suicide plasmid had to be used. This methodology has provided the means for a deeper understanding of this elusive serotype, both in terms of its biology and pathogenicity. To validate the method, the major known pneumococcal toxin, pneumolysin, was mutated because it has a well-known and easy to follow phenotype. We showed that the mutant, as expected, lost its ability to lyse red blood cells. By being able to mutate an important gene in the serotype of interest, we were able to observe different phenotypes for loss of function mutants upon intraperitoneal and intranasal infections from the ones observed for other serotypes. In summary, this study proves that strain 519/43 (serotype 1) can be genetically modified.

The protocol described here starts by using PCR to amplify the left and right homology arms, whilst simultaneously deleting 191 bp from the middle region of the ply gene. While performing the PCR a BamHI site is introduced at the 3&#8217; of the left homology arm and at the 5&#8217; end of the right homology arm (Figure 1A). This is followed by PCR-SOE where left and right homology arms are fused into one amplicon (Figure 1B). This SOE-PCR amplicon is t...

Watch this Scientific Journal Video about Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43 at JoVE.com

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Here, we describe a S. pneumoniae serotype 1 strain 519/43 that can be genetically modified by using its ability to naturally acquire DNA and a suicide-plasmid. As proof of principle, an isogenic mutant in the pneumolysin (ply) gene was made.

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, ...

constructing-mutants-serotype-1-streptococcus-pneumoniae-strain

Research

JoVE Journal

Immunology and Infection

1.6K Views.  London School of Hygiene and Tropical Medicine. Here, we describe a S. pneumoniae serotype 1 strain 519/43 that can be genetically modified by using its ability to naturally acquire DNA and a suicide-plasmid. As proof of principle, an isogenic mutant in the pneumolysin (ply) gene was made.

Video: Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

During the 1918 influenza virus pandemic, which killed approximately 50 million people worldwide, the majority of fatalities were not the result of infection with influenza virus alone. Instead, most individuals are thought to have succumbed to a secondary bacterial infection, predominately caused by the bacterium Streptococcus pneumoniae (the pneumococcus). The synergistic relationship between infections caused by influenza virus and the pneumococcus has subsequently been observed during the 1957 Asian influenza virus pandemic, as well as during seasonal outbreaks of the virus (reviewed in 1, 2). Here, we describe a protocol used to investigate the mechanism(s) that may be involved in increased morbidity as a result of concurrent influenza A virus and S. pneumoniae infection. We have developed an infant murine model to reliably and reproducibly demonstrate the effects of influenza virus infection of mice colonised with S. pneumoniae. Using this protocol, we have provided the first insight into the kinetics of pneumococcal transmission between co-housed, neonatal mice using in vivo imaging 3.

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

A concurrent infection with influenza A virus is one of the factors implicated in the induction of invasive pneumococcal disease during asymptomatic Streptococcus pneumoniae carriage. Here we describe a mixed infection method using infant mice to investigate the synergism between these two respiratory pathogens.

During the 1918 influenza virus pandemic, which killed approximately 50 million people worldwide, the majority of fatalities were not the result of ...

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy

During the last few years scientists became increasingly aware that average data obtained from microbial population based experiments are not representative of the behavior, status or phenotype of single cells. Due to this new insight the number of single cell studies rises continuously (for recent reviews see 1,2,3). However, many of the single cell techniques applied do not allow monitoring the development and behavior of one specific single cell in time (e.g. flow cytometry or standard microscopy).
Here, we provide a detailed description of a microscopy method used in several recent studies 4, 5, 6, 7, which allows following and recording (fluorescence of) individual bacterial cells of Bacillus subtilis and Streptococcus pneumoniae through growth and division for many generations. The resulting movies can be used to construct phylogenetic lineage trees by tracing back the history of a single cell within a population that originated from one common ancestor. This time-lapse fluorescence microscopy method cannot only be used to investigate growth, division and differentiation of individual cells, but also to analyze the effect of cell history and ancestry on specific cellular behavior. Furthermore, time-lapse microscopy is ideally suited to examine gene expression dynamics and protein localization during the bacterial cell cycle. The method explains how to prepare the bacterial cells and construct the microscope slide to enable the outgrowth of single cells into a microcolony. In short, single cells are spotted on a semi-solid surface consisting of growth medium supplemented with agarose on which they grow and divide under a fluorescence microscope within a temperature controlled environmental chamber. Images are captured at specific intervals and are later analyzed using the open source software ImageJ.

Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy

This protocol provides a step-by-step procedure to monitor single cell behavior of different bacteria in time using automated fluorescence time-lapse microscopy. Furthermore, we provide guidelines how to analyze the microscopy images.

During the last few years scientists became increasingly aware that average data obtained from microbial population based experiments are not ...

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing the mucosal surface of the nasopharynx, where it can reside, multiply and eventually overcome host defences to invade to other tissues of the host. Establishment of an infection in the normally lower respiratory tract results in pneumonia. Alternatively, the bacteria can disseminate into the bloodstream causing bacteraemia, which is associated with high mortality rates2, or else lead directly to the development of pneumococcal meningitis. Understanding the kinetics of, and immune responses to, nasopharyngeal colonization is an important aspect of S. pneumoniae infection models.
Our mouse model of intranasal colonization is adapted from human models3 and has been used by multiple research groups in the study of host-pathogen responses in the nasopharynx4-7. In the first part of the model, we use a clinical isolate of S. pneumoniae to establish a self-limiting bacterial colonization that is similar to carriage events in human adults. The procedure detailed herein involves preparation of a bacterial inoculum, followed by the establishment of a colonization event through delivery of the inoculum via an intranasal route of administration. Resident macrophages are the predominant cell type in the nasopharynx during the steady state. Typically, there are few lymphocytes present in uninfected mice8, however mucosal colonization will lead to low- to high-grade inflammation (depending on the virulence of the bacterial species and strain) that will result in an immune response and the subsequent recruitment of host immune cells. These cells can be isolated by a lavage of the tracheal contents through the nares, and correlated to the density of colonization bacteria to better understand the kinetics of the infection.

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Colonization of the murine nasopharynx with Streptococcus pneumoniae and the subsequent extraction of adherent or recruited cells is described. This technique involves flushing the nasopharynx and collection of the fluid through the nares and is adaptable for various readouts, including differential cell quantification and analysis of mRNA expression in situ.

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing ...

Monitoring Changes in Membrane Polarity, Membrane Integrity, and Intracellular Ion Concentrations in Streptococcus pneumoniae Using Fluorescent Dyes

Membrane depolarization and ion fluxes are events that have been studied extensively in biological systems due to their ability to profoundly impact cellular functions, including energetics and signal transductions. While both fluorescent and electrophysiological methods, including electrode usage and patch-clamping, have been well developed for measuring these events in eukaryotic cells, methodology for measuring similar events in microorganisms have proven more challenging to develop given their small size in combination with the more complex outer surface of bacteria shielding the membrane. During our studies of death-initiation in Streptococcus pneumoniae (pneumococcus), we wanted to elucidate the role of membrane events, including changes in polarity, integrity, and intracellular ion concentrations. Searching the literature, we found that very few studies exist. Other investigators had monitored radioisotope uptake or equilibrium to measure ion fluxes and membrane potential and a limited number of studies, mostly in Gram-negative organisms, had seen some success using carbocyanine or oxonol fluorescent dyes to measure membrane potential, or loading bacteria with cell-permeant acetoxymethyl (AM) ester versions of ion-sensitive fluorescent indicator dyes. We therefore established and optimized protocols for measuring membrane potential, rupture, and ion-transport in the Gram-positive organism S. pneumoniae. We developed protocols using the bis-oxonol dye DiBAC4(3) and the cell-impermeant dye propidium iodide to measure membrane depolarization and rupture, respectively, as well as methods to optimally load the pneumococci with the AM esters of the ratiometric dyes Fura-2, PBFI, and BCECF to detect changes in intracellular concentrations of Ca2+, K+, and H+, respectively, using a fluorescence-detection plate reader. These protocols are the first of their kind for the pneumococcus and the majority of these dyes have not been used in any other bacterial species. Though our protocols have been optimized for S. pneumoniae, we believe these approaches should form an excellent starting-point for similar studies in other bacterial species.

Monitoring Changes in Membrane Polarity, Membrane Integrity, and Intracellular Ion Concentrations in Streptococcus pneumoniae Using Fluorescent Dyes

Unlike that seen for eukaryotes, there is a paucity of studies that detail membrane depolarization and ion concentration changes in bacteria, primarily as their small size makes conventional methods of measurement difficult. Here, we detail protocols for monitoring such events in the significant Gram-positive pathogen Streptococcus pneumoniae utilizing fluorescence techniques.

Membrane depolarization and ion fluxes are events that have been studied extensively in biological systems due to their ability to profoundly impact ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal epidemiology, capsular serotyping can provide useful information for vaccine efficacy and impact studies.&#160;The Quellung reaction is the gold standard method for pneumococcal capsular serotyping. The method involves testing a pneumococcal cell suspension with pooled and specific antisera directed against the capsular polysaccharide. The antigen-antibody reactions are observed microscopically. The protocol has three main steps: 1) preparation of a bacterial cell suspension, 2) mixing of cells and antisera on a glass slide, and 3) reading the Quellung reaction using a microscope. The Quellung reaction is reasonably simple to perform and can be applied wherever a suitable microscope and antisera are available.

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

The Quellung reaction is the gold standard technique for serotyping Streptococcus pneumoniae. This technique utilizes a microscope and specific pneumococcal antisera and is commonly used in reference and research laboratories worldwide.

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major cause of morbidity and mortality world-wide. Current vaccines target the pneumococcal capsule, and there are over 90 capsular serotypes. Serotyping pneumococcal isolates is therefore important for assessing the impact of vaccination programs and for epidemiological purposes. The World Health Organization has recommended latex agglutination as an alternative method to the &#8216;gold standard&#8217; Quellung test for serotyping pneumococci. Latex agglutination is a relatively simple, quick and inexpensive method; and is therefore suitable for resource-poor settings as well as laboratories with high-volume workloads. Latex agglutination reagents can be prepared in-house utilizing commercially-sourced antibodies that are passively attached to latex particles. This manuscript describes a method of production and quality control of latex agglutination reagents, and details a sequential testing approach which is time- and cost-effective. 
This method of production and quality control may also be suitable for other testing purposes.

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Latex agglutination testing is a simple, rapid and inexpensive method for serotyping Streptococcus pneumoniae, and has also been widely applied in diagnostic microbiology. This manuscript describes the in-house production of latex agglutination reagents, quality control procedures and the application of this technique to pneumococcal serotyping.

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major ...

A Murine Model of Group B Streptococcus Vaginal Colonization

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of 10 - 30% of adults. In immune-compromised individuals, including neonates, pregnant women, and the elderly, GBS may switch to an invasive pathogen causing sepsis, arthritis, pneumonia, and meningitis. Because GBS is a leading bacterial pathogen of neonates, current prophylaxis is comprised of late gestation screening for GBS vaginal colonization and subsequent peripartum antibiotic treatment of GBS-positive mothers. Heavy GBS vaginal burden is a risk factor for both neonatal disease and colonization. Unfortunately, little is known about the host and bacterial factors that promote or permit GBS vaginal colonization. This protocol describes a technique for establishing persistent GBS vaginal colonization using a single &#946;-estradiol pre-treatment and daily sampling to determine bacterial load. It further details methods to administer additional therapies or reagents of interest and to collect vaginal lavage fluid and reproductive tract tissues. This mouse model will further the understanding of the GBS-host interaction within the vaginal environment, which will lead to potential therapeutic targets to control maternal vaginal colonization during pregnancy and to prevent transmission to the vulnerable newborn. It will also be of interest to increase our understanding of general bacterial-host interactions in the female vaginal tract.

A Murine Model of Group B Streptococcus Vaginal Colonization

The purpose of this protocol is to imitate human group B Streptococcus (GBS) vaginal colonization in a murine model. This method may be used to investigate host immune responses and bacterial factors contributing to GBS vaginal persistence, as well as to test therapeutic strategies.

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of ...

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or A. baumannii

Efficacy of candidate antibacterial treatments must be demonstrated in animal models of infection as part of the discovery and development process, preferably in models which mimic the intended clinical indication. A method for inducing robust lung infections in immunocompetent rats and mice is described which allows for the assessment of treatments in a model of serious pneumonia caused by S. pneumoniae, H. influenzae, P. aeruginosa, K. pneumoniae or A. baumannii. Animals are anesthetized, and an agar-based inoculum is deposited deep into the lung via nonsurgical intratracheal intubation. The resulting infection is consistent, reproducible, and stable for at least 48 h and up to 96 h for most isolates. Studies with marketed antibacterials have demonstrated good correlation between in vivo efficacy and in vitro susceptibility, and concordance between pharmacokinetic/pharmacodynamic targets determined in this model and clinically accepted targets has been observed. Although there is an initial time investment when learning the technique, it can be performed quickly and efficiently once proficiency is achieved. Benefits of the model include elimination of the neutropenic requirement, increased robustness and reproducibility, ability to study more pathogens and isolates, improved flexibility in study design and establishment of a challenging infection in an immunocompetent host.

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or  A. baumannii

A method for establishing lung infections in immunocompetent rodents is described. With proficiency, this method can be performed quickly and easily to induce stable infection with many isolates of S. pneumoniae, H. influenzae, P. aeruginosa, K. pneumoniae and A. baumannii.

Efficacy of candidate antibacterial treatments must be demonstrated in animal models of infection as part of the discovery and development process, ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...