이 작업에 자금을 제공 한 수막염 신탁과 MRC에 감사드립니다.

1. SOE-PCR23 에 의한 돌연변이 앰플리콘의 생성 및 스펙티노마이신 카세트의 증폭
<ol><li>균주 519/43에서 플라이 유전자의 측면 영역의 상동성 팔(각각 ply 5'(488bp) 및 ply3'(715bp))의 증폭을 위해 PCR을 수행하는 것으로 시작합니다. 프라이머 plyFw1_NOTI(TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), ply5'R1_BamHI(CGAAATATAGACCAAAGGACGCGGATCC AGAACCAAACTTGACCTTGA), ply3'F1_BamHI(TCAAGGTCAAGTTTGGTTCT GGATCCCCTTTGGTCTATATTTCG) 및 plyRv2_NotI(TTTGCGGCCGCCATTTTCTACCTTATCCTCTACC)를 사용합니다.</li>
	<li>ply5'에 대해 다음 PCR 조건을 사용하십시오: 94°C에서 60초 동안 변성, 2단계: 94°C에서 30초 동안 변성, 3단계: 58°C에서 30초 동안 어닐링, 4단계: 72°C에서 30초 동안 연장, 5단계: 2단계로 돌아가서 35주기 동안 반복, 6단계: 72°C에서 30초 동안 최종 확장.<ol><li>3초여야 하는 4단계와 6단계의 연장 시간을 제외하고 ply60'에 대해 동일한 PCR 조건을 사용합니다.</li>
	</ol></li>
	<li>겔 전기영동으로 PCR 산물을 분석하고 겔에서 앰플리콘을 절제합니다.</li>
	<li>PCR 정제amp제조업체의 지침(재료 표)에 설명된 프로토콜에 따라 licons.</li>
	<li>SOE-PCR에서 두 상동성 암의 등몰량을 템플릿으로 사용합니다. 프라이머 plyFw1_ NOTI(TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG) 및 plyRv2_NotI(TTTGCGGCCGCCATTTTCTACCTTATCCTCTACC)를 사용하여 두 앰플리콘을 융합합니다.</li>
	<li>다음 SOE-PCR 조건을 사용합니다(1단계: 94°C에서 2분 동안 변성, 2단계: 94°C에서 30초 동안 변성, 3단계: 58°C에서 30초 동안 어닐링, 4단계: 68°C에서 60초 동안 연장, 5단계: 2단계로 돌아가서 25주기 반복, 6단계: 68°C에서 90초 동안 최종 확장).</li>
	<li>겔 전기영동으로 SOE-PCR 산물을 분석합니다. 젤 추출 키트를 사용하여 젤에서 절제하고 제공된 지침을 따르십시오.</li>
	<li>다음 PCR 조건을 사용하여 플라스미드 pR412로부터 스펙티노마이신 카세트를 증폭한다: 단계 1: 94°C에서 60초 동안 변성, 단계 2: 94°C에서 30초 동안 변성, 단계 3: 55°C에서 30초 동안 어닐링, 단계 4: 68°C에서 60초 동안 연장, 5단계: 단계 2로 돌아가서 25사이클 동안 반복하고, 6단계: 68°C에서 60초 동안 최종 연장.<ol><li>프라이머 BamHI_SP2F2(GGATCC, CTA, GAA, CTA, GTG, GAT, CCC, CC) 및 BamHI_SP2R2(GGATCC, AA, TCT, GCA, GAT, TTT, AC, ATG, ATC)를 사용합니다. 플라스미드 pR412는 Marc PrudHomme 박사(CNRS-Universite Paul Sabatier Toulouse France)로부터 입수하였다.</li>
	</ol></li>
	<li>겔 전기영동으로 PCR 앰플리콘을 분석합니다. 생성된 PCR 앰플리콘을 상기와 같이 소비하고 정제한다.</li>
</ol>2. 플라스미드 pSD1의 생성 및 대장균 Dh5α의 화학적 형질전환
<ol><li>pGEMT-easy 시스템 I 제조업체 지침(재료 표)에 따라 결찰을 수행합니다. 미세 원심분리기 튜브에서 5μL의 2x 결찰 완충액, 1μL의 pGEMTeasy, 2μL의 ply_SOE 생성물, 1μL의 T4 DNA 리가제 및 물을 총 부피 20μL에 추가합니다. 4°C에서 하룻밤 동안 배양합니다. 이것은 플라스미드 pSD1을 생성한다.</li>
	<li>화학적으로 유능한 대장균 Dh5α를 pSD1로 변형시킵니다. 얼음에서 15분 동안 화학적으로 유능한 대장균 Dh5α 50μL와 pSD1 결찰 반응 3μL을 배양하는 것으로 시작합니다. 그런 다음 세포를 열 충격(42°C, 30초)에 노출시켜 계속합니다. 세포를 얼음 위에 2분 동안 두십시오.</li>
	<li>얼음에서 세포를 제거하고 350 μL의 S.O.C 배지를 추가합니다. 배양액을 37°C, 120 rpm에서 2시간 동안 배양한다.</li>
	<li>0.4mM IPTG, 청색/백색 선택을 위한 0.24mg/mL X-Gal 및 100μg/mL 암피실린이 보충된 Luria Bertani Agar(LBA)에서 형질전환을 플레이트하여 플레이트에서 성장하는 모든 콜로니가 플라스미드 골격을 갖도록 합니다. 백색 콜로니는 pSD1을 함유한다.</li>
	<li>3개의 흰색 콜로니를 선택하고 100μg/mL 암피실린이 보충된 10mL의 LB에서 하룻밤 동안 성장하도록 설정합니다. 진탕과 함께 37°C에서 하룻밤 동안 배양물을 배양한다.</li>
	<li>다음날 배양물을 3,082 x g 에서 원심분리하고 플라스미드 추출을 위해 펠릿을 사용합니다.</li>
</ol>3. 플라스미드 DNA 추출, pSD1 및 스펙티노마이신 유전자의 제한 소화 및 pSD2 조립
<ol><li>상용 키트(Table of Materials)와 함께 제공된 지침에 따라 플라스미드 DNA를 추출합니다.</li>
	<li>pSD1 플라스미드와 이전에 증폭 및 정제된 스펙티노마이신 카세트 모두에 대해 BamHI 제한 분해를 설정합니다. 표 1에 설명된 다음 조건 및 수량을 사용하십시오.</li>
	<li>제한 소화 반응 및 대조군을 37°C에서 3시간 동안 배양합니다.</li>
	<li>전기영동에 의해 제한 소화를 분석하고, 밴드를 절제하고, 상용 키트와 함께 제공된 지침에 따라 정제합니다(재료 표).</li>
	<li>다음에, BamHI-분해된 pSD1 및 스펙티노마이신(단계 3.2로부터)을 사용하여 제조사 지침(Table of Materials)에 따라 결찰 반응을 준비한다. 미세 원심분리 튜브에 다음 반응 성분을 첨가하십시오: 5 μL의 2x 결찰 완충액, 2 μL pSD1, 2 μL의 스펙티노마이신 카세트, 1 μL의 T4 DNA 리가아제를 첨가하고 4°C에서 밤새 배양합니다. 이것은 플라스미드 pSD2를 생성한다.</li>
	<li>플라스미드 pSD2를 단계 2.2에 기재된 바와 같이 화학적으로 유능한 대장균 Dh5α로 형질전환시킨다.</li>
	<li>100μg/mL의 스펙티노마이신 및 암피실린이 보충된 LBA에서 성장하는 능력에 따라 플라스미드 pSD2를 운반하는 형질전환체를 선택합니다.</li>
	<li>플라스미드 DNA 추출(pSD2)을 상기와 같이 수행하고 제조업체의 지침(μL)에 따라 수행합니다.</li>
</ol>4. S. pneumoniae 균주의 변형 519/43
<ol><li>BHI에서 S. pneumoniae 519/43의 하룻밤 배양액을 준비하고 37°C, 5%CO2에서 정적으로 성장하도록 합니다.</li>
	<li>다음날 배양물을 1:50 및 1:100의 신선한 BHI 브로스 10mL에 희석합니다. OD595nm 가 0.05 내지 0.1 사이가 될 때까지 37°C에서 정적으로 배양물을 배양한다(0.1 OD에 가까운 DNA의 최적 획득).</li>
	<li>OD가 0.1에 도달하면 860 μL를 취하여 미세 원심 분리기 튜브로 옮깁니다. 동일한 미세 원심분리 튜브에 100μL의 100mM NaOH, 10μL의 20%(w/v) BSA, 10μL의 100mM CaCl2, 2μL의 50ng/mL CSP124 및 500ng의pSD2를 추가합니다.</li>
	<li>반응을 37°C에서 3시간 동안 정적으로 배양합니다.</li>
	<li>330 μL를 100 μg/mL 스펙티노마이신이 보충된 5% 혈액 한천 플레이트(BA)에 3시간 동안 매시간 플레이트합니다.</li>
	<li>플레이트를 37°C, 5%CO2에서 밤새 인큐베이션한다. 스펙티노마이신 내성 콜로니를 100μg/mL 스펙티노마이신이 보충된 다른 BA 플레이트와 100μg/mL의 암피실린이 보충된 BA 플레이트에 패치합니다. 위에 명시된 조건에서 두 세트의 플레이트를 하룻밤 동안 배양하십시오. 암피실린 플레이트는 플라스미드 골격의 존재를 시험하기 위한 것이다.</li>
	<li>프라이머 plyFw1_ NOTI(TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG) 및 SPEC_REV(TAATTCCTCTAAGTCATAATTTCCG)를 사용하여 PCR로 스펙티노마이신 카세트의 존재를 확인합니다. 돌연변이 부위 외부에 부착되는 프라이머 plySCN1(CCAATGGAAATCGCTAGGCAAGAGATAA)과 plySCN2(ATTACTTAGTCCAACCACGGCTGAT)를 이용하여 PCR로 돌연변이를 확인한다.</li>
	<li>프라이머 plySCN1(CCAATGGAAATCGCTAGGCAAGAGATAA), plySCN2(ATTACTTAGTCCAACCACGGCTGAT) 및 스펙티노마이신 카세트 sqr1(CCTGATCCAAACATGTAAGTACCACC), sqf2(CGTAGTTATCTTGGAGAGAATA) spec_sqf1(GGTACTTACATGTTTGGATCAGG) 및 spec_sqr2 TATTCTCTCCAAGATAACTACG에 결합 부위가 있는 프라이머를 사용하여 시퀀싱하여 게놈의 올바른 위치에 통합을 확인합니다.</li>
</ol>

<ol>
	<li>Bentley, S. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Analysis+of+the+Capsular+Biosynthetic+Locus+from+All+90+Pneumococcal+Serotypes.">Genetic Analysis of the Capsular Biosynthetic Locus from All 90 Pneumococcal Serotypes.</a> PLoS Genetics. 2 (3), 31 (2006).</li><li>Calix, J. J., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+pneumococcal+serotype,+11E,+has+a+variably+inactivated+wcjE+gene.">A new pneumococcal serotype, 11E, has a variably inactivated wcjE gene.</a> The Journal of Infectious Diseases. 202 (1), 29-38 (2010).</li><li>Park, I. H., Pritchard, D. G., Cartee, R., Brandao, A., Brandileone, M. C. C., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+a+New+Capsular+Serotype+(6C)+within+Serogroup+6+of+Streptococcus+pneumoniae.">Discovery of a New Capsular Serotype (6C) within Serogroup 6 of Streptococcus pneumoniae.</a> Journal of Clinical Microbiology. 45 (4), 1225-1233 (2007).</li><li>Jin, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First+Report+of+Putative+Streptococcus+pneumoniae+Serotype+6D+among+Nasopharyngeal+Isolates+from+Fijian+Children.">First Report of Putative Streptococcus pneumoniae Serotype 6D among Nasopharyngeal Isolates from Fijian Children.</a> The Journal of Infectious Diseases. 200 (9), 1375-1380 (2009).</li><li>Oliver, M. B., vander Linden, M. P. G., K&#252;ntzel, S. A., Saad, J. S., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+Streptococcus+pneumoniae+Serotype+6+Variants+with+Glycosyltransferases+Synthesizing+Two+Differing+Repeating+Units.">Discovery of Streptococcus pneumoniae Serotype 6 Variants with Glycosyltransferases Synthesizing Two Differing Repeating Units.</a> Journal of Biological Chemistry. 288 (36), 25976-25985 (2013).</li><li>Calix, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serological+Characterization+of+Two+Capsule+Subtypes+among+Streptococcus+pneumoniae+Serotype+20+Strains.">Serological Characterization of Two Capsule Subtypes among Streptococcus pneumoniae Serotype 20 Strains.</a> Journal of Biological Chemistry. 287 (33), 27885-27894 (2012).</li><li>Park, I. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=and+Serological+Characterization+of+a+New+Pneumococcal+Serotype,+6H,+and+Generation+of+a+Pneumococcal+Strain+Producing+Three+Different+Capsular+Repeat+Units.">and Serological Characterization of a New Pneumococcal Serotype, 6H, and Generation of a Pneumococcal Strain Producing Three Different Capsular Repeat Units.</a> Clinical and Vaccine Immunology. 22 (3), 313-318 (2015).</li><li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> The Lancet. 374 (9693), 893-902 (2009).</li><li>Henriques-Normark, B., Tuomanen, E. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pneumococcus:+Epidemiology,+Microbiology,+and+Pathogenesis.">The Pneumococcus: Epidemiology, Microbiology, and Pathogenesis.</a> Cold Spring Harbor Perspectives in Medicine. 3 (7), 010215 (2013).</li><li>Leimkugel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Outbreak+of+Serotype+1+Streptococcus+pneumoniae+Meningitis+in+Northern+Ghana+with+Features+That+Are+Characteristic+of+Neisseria+meningitidis+Meningitis+Epidemics.">An Outbreak of Serotype 1 Streptococcus pneumoniae Meningitis in Northern Ghana with Features That Are Characteristic of Neisseria meningitidis Meningitis Epidemics.</a> The Journal of Infectious Diseases. 192 (2), 192-199 (2005).</li><li>Yaro, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiological+and+Molecular+Characteristics+of+a+Highly+Lethal+Pneumococcal+Meningitis+Epidemic+in+Burkina+Faso.">Epidemiological and Molecular Characteristics of a Highly Lethal Pneumococcal Meningitis Epidemic in Burkina Faso.</a> Clinical Infectious Diseases. 43 (6), 693-700 (2006).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+epidemiology+of+pneumococci+obtained+from+Gambian+children+aged+2-29+months+with+invasive+pneumococcal+disease+during+a+trial+of+a+9-valent+pneumococcal+conjugate+vaccine.">Molecular epidemiology of pneumococci obtained from Gambian children aged 2-29 months with invasive pneumococcal disease during a trial of a 9-valent pneumococcal conjugate vaccine.</a> BMC Infectious Diseases. 8 (1), 81 (2008).</li><li>Kwambana-Adams, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+outbreak+of+pneumococcal+meningitis+among+older+children+(&#8805;5+years)+and+adults+after+the+implementation+of+an+infant+vaccination+programme+with+the+13-valent+pneumococcal+conjugate+vaccine+in+Ghana.">An outbreak of pneumococcal meningitis among older children (&#8805;5 years) and adults after the implementation of an infant vaccination programme with the 13-valent pneumococcal conjugate vaccine in Ghana.</a> BMC Infectious Diseases. 16 (1), 575 (2016).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seasonality+and+outbreak+of+a+predominant+Streptococcus+pneumoniae+serotype+1+clone+from+The+Gambia:+Expansion+of+ST217+hypervirulent+clonal+complex+in+West+Africa.">Seasonality and outbreak of a predominant Streptococcus pneumoniae serotype 1 clone from The Gambia: Expansion of ST217 hypervirulent clonal complex in West Africa.</a> BMC Microbiology. 8 (1), 198 (2008).</li><li>Staples, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+of+an+Australian+serotype+1+Streptococcus+pneumoniae+outbreak.">Molecular characterization of an Australian serotype 1 Streptococcus pneumoniae outbreak.</a> Epidemiology and Infection. 143 (2), 325-333 (2015).</li><li>Gessner, B. D., Mueller, J. E., Yaro, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=African+meningitis+belt+pneumococcal+disease+epidemiology+indicates+a+need+for+an+effective+serotype+1+containing+vaccine,+including+for+older+children+and+adults.">African meningitis belt pneumococcal disease epidemiology indicates a need for an effective serotype 1 containing vaccine, including for older children and adults.</a> BMC Infectious Diseases. 10 (1), 22 (2010).</li><li>Hill, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nasopharyngeal+carriage+of+Streptococcus+pneumoniae+in+Gambian+infants:+a+longitudinal+study.">Nasopharyngeal carriage of Streptococcus pneumoniae in Gambian infants: a longitudinal study.</a> Clinical Infectious Diseases. 46 (6), 807-814 (2008).</li><li>Ebruke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+changes+in+nasopharyngeal+carriage+of+Streptococcus+pneumoniae+serotype+1+genotypes+in+healthy+Gambians+before+and+after+the+7-valent+pneumococcal+conjugate+vaccine.">Temporal changes in nasopharyngeal carriage of Streptococcus pneumoniae serotype 1 genotypes in healthy Gambians before and after the 7-valent pneumococcal conjugate vaccine.</a> PeerJ. 3, 90 (2015).</li><li>Adegbola, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+and+antimicrobial+susceptibility+patterns+of+isolates+of+Streptococcus+pneumoniae+causing+invasive+disease+in+The+Gambia+1996-2003.">Serotype and antimicrobial susceptibility patterns of isolates of Streptococcus pneumoniae causing invasive disease in The Gambia 1996-2003.</a> Tropical Medicine and International Health. 11 (7), 1128-1135 (2006).</li><li>Marks, L. R., Reddinger, R. M., Hakansson, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Levels+of+Genetic+Recombination+during+Nasopharyngeal+Carriage+and+Biofilm+Formation+in+Streptococcus+pneumoniae.">High Levels of Genetic Recombination during Nasopharyngeal Carriage and Biofilm Formation in Streptococcus pneumoniae.</a> mBio. 3 (5), (2012).</li><li>Ritchie, N. D., Mitchell, T. J., Evans, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+is+different+about+serotype+1+pneumococci.">What is different about serotype 1 pneumococci.</a> Future Microbiology. 7 (1), 33-46 (2012).</li><li>Harvey, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+variable+region+of+pneumococcal+pathogenicity+island+1+is+responsible+for+unusually+high+virulence+of+a+serotype+1+isolate.">The variable region of pneumococcal pathogenicity island 1 is responsible for unusually high virulence of a serotype 1 isolate.</a> Infection and Immunity. 84 (3), 822-832 (2016).</li><li>Horton, R. M., Cai, Z. L., Ho, S. N., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+splicing+by+overlap+extension:+tailor-made+genes+using+the+polymerase+chain+reaction.">Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.</a> BioTechniques. 8 (5), 528-535 (1990).</li><li>Alioing, G., Granadel, C., Morrison, D. A., Claverys, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Competence+pheromone,+oligopeptide+permease,+and+induction+of+competence+in+Streptococcus+pneumoniae.">Competence pheromone, oligopeptide permease, and induction of competence in Streptococcus pneumoniae.</a> Molecular Microbiology. 21 (3), 471-478 (1996).</li><li>Lund, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Enumeration and description of the strains belonging to the State Serum Institute, Copenhagen Denmark. , (1951).</li><li>Barany, F., Tomasz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+pneumoniae+by+heterologous+plasmid+deoxyribonucleic+acid.">Genetic transformation of Streptococcus pneumoniae by heterologous plasmid deoxyribonucleic acid.</a> Journal of Bacteriology. 144 (2), 698-709 (1980).</li><li>Terra, V. S., Homer, K. A., Rao, S. G., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+novel+&#946;-galactosidase+activity+that+contributes+to+glycoprotein+degradation+and+virulence+in+Streptococcus+pneumoniae.">Characterization of novel &#946;-galactosidase activity that contributes to glycoprotein degradation and virulence in Streptococcus pneumoniae.</a> Infection and Immunity. 78 (1), (2010).</li><li>Terra, V. S., Zhi, X., Kahya, H. F., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumococcal+6-phospho-&#946;-glucosidase+(BglA3)+is+involved+in+virulence+and+nutrient+metabolism.">Pneumococcal 6-phospho-&#946;-glucosidase (BglA3) is involved in virulence and nutrient metabolism.</a> Infection and Immunity. 84 (1), (2015).</li><li>Harvey, R. M., Ogunniyi, A. D., Chen, A. Y., Paton, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumolysin+with+Low+Hemolytic+Activity+Confers+an+Early+Growth+Advantage+to+Streptococcus+pneumoniae+in+the+Blood.">Pneumolysin with Low Hemolytic Activity Confers an Early Growth Advantage to Streptococcus pneumoniae in the Blood.</a> Infection and Immunity. 79 (10), 4122 (2011).</li><li>Terra, V. S., Plumptre, C. D., Wall, E. C., Brown, J. S., Wren, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+pneumolysin+deficient+mutant+in+Streptococcus+pneumoniae+serotype+1+strain+519/43+and+phenotypic+characterisation.">Construction of a pneumolysin deficient mutant in Streptococcus pneumoniae serotype 1 strain 519/43 and phenotypic characterisation.</a> Microbial Pathogenesis. 141, 103999 (2020).</li></ol>

저자는 공개 할 것이 없습니다.

폐렴 연쇄상 구균, 특히 혈청형 1은 침습성 폐렴구균 질환 및 수막염을 유발하는 세계적인 위협이 되고 있습니다. 혈청형 1을 예방해야 하는 다양한 백신이 도입되었음에도 불구하고, 아프리카에서는 이 혈청형이 여전히 높은 이환율과 사망률을 초래하는 발병을 일으킬 수 있다13. 이 혈청형을 유전적으로 조작하는 능력은 임상적 관련성 때문에 매우 중요합니다. 이 연구?...

폐렴 연쇄상 구균 (S. pneumoniae, 폐렴 구균)은 전 세계적으로 이환율과 사망률의 주요 원인 중 하나입니다. 최근까지 100개에 가까운 S. pneumoniae의 혈청형이 발견되었다 1,2,3,4,5,6,7. 매년 침습성 폐렴구균성 질환(IPD)으로 인해 약 700,000명이 사망하고 5세 미만 어린이가사망한다 8. S. pneumoniae는 전 세계적으로 세균성 폐렴, 중이염, 수막염 및 패혈증의 주요 원인이다9.
아프리카 수막염 벨트에서 혈청형 1은 수막염 발병의 원인이 되며, 여기서 매우 독성이 강한 서열형인 서열형(ST) ST217이 우세합니다 10,11,12,13,14,15. 수막염 병리학에서의 중요성은 아프리카 수막염 벨트의 Neisseria meningitidis의 중요성에 비유되었습니다16. 혈청형 1은 종종 IPD의 주요 원인입니다. 그러나 마차에서는 거의 발견되지 않습니다. 사실, 감비아에서는 이 혈청형이 모든 침습성 질환의 20%를 차지하지만 건강한 보균자의 0.5%에서만 발견되었습니다14,17,18,19. 유능한 폐렴구균에서의 유전자 교환 및 재조합은 일반적으로 침습성 질환보다는 보균에서 발생한다20. 또한, 혈청형 1은 폐렴구균 중에서 가장 짧은 보균률(단 9일) 중 하나인 것으로 나타났습니다. 그러므로, 이 혈청형은 다른 혈청형보다 훨씬 낮은 재조합률을 가질 수 있다고 제안되었다21.
혈청형 1 균주의 낮은 운반률의 이유와 사하라 사막 이남 아프리카의 침습성 질병에서의 중요성을 이해하기 위해서는 심층 연구가 필요합니다.
여기에서 우리는 특정 혈청형 1 균주, 519/43의 게놈 전체 돌연변이 유발을 허용하는 프로토콜을 보고합니다. 이 균주는 새로운 DNA를 쉽게 획득하여 게놈으로 재결합할 수 있습니다. 이 방법은 아직 변형되지 않았지만 519/43 배경에서 수행될 때 매우 효율적입니다(다른 표적은 돌연변이가 발생했으며 원고는 준비 중입니다). 단순히 519/43 균주를 사용하고 그 타고난 능력을 활용하고 외인성 DNA가 제공되는 방식을 대체함으로써 우리는 이 혈청형 1 균주에서 뉴몰리신 유전자(ply)를 돌연변이시킬 수 있었습니다. 이 방법은 Harvey et al.22 가 제시한 방법에 대한 개선을 나타내며, 다른 혈청형을 통해 DNA를 통과시킬 필요 없이 한 단계로 수행됩니다. 그럼에도 불구하고, 균주 간 가변성으로 인해, 모든 균주에 대해 표준화된 방법은 없다. 특정 유전자를 돌연변이시키고 그 효과를 관찰하는 능력은 혈청형 1 S. pneumoniae 균주에 대한 심오한 이해를 가능하게 할 것이며 사하라 사막 이남 아프리카의 수막염에서 이러한 균주의 역할에 대한 답을 제공할 것입니다.

<table>
	<tbody>
		<tr>
			<td>AccuPrime Pfx DNA polymerase</td>
			<td>Invitrogen</td>
			<td>12344024</td>
			<td>Used for amplification of the fragments</td>
		</tr>
		<tr>
			<td>Ampicillin sodium salt</td>
			<td>Sigma Aldrich</td>
			<td>A9518</td>
			<td>Used for bacterial selection on stage 1(pSD1)</td>
		</tr>
		<tr>
			<td>Blood Agar Base</td>
			<td>Oxoid</td>
			<td>CM0055</td>
			<td>Used to plate S. pneumoniae transformants</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumine</td>
			<td>sigma</td>
			<td>55470</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Brain Heart Infusion</td>
			<td>Oxoid</td>
			<td>CM1135</td>
			<td>used to grow S. pneumoniae cells</td>
		</tr>
		<tr>
			<td>Calcium Chloride Cacl2</td>
			<td>Sigma</td>
			<td>449709</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Competence stimulating peptide 1</td>
			<td>AnaSpec</td>
			<td>AS-63779</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Luria Broth Agar</td>
			<td>Gibco</td>
			<td>22700025</td>
			<td>used for plating and selection of pSD1 and pSD2</td>
		</tr>
		<tr>
			<td>Luria Broth Base (Miller&#39;s formulation)</td>
			<td>Gibco</td>
			<td>12795027</td>
			<td>used for plating and selection of pSD1 and pSD2</td>
		</tr>
		<tr>
			<td>Monarch Gel Extraction Kit</td>
			<td>NEB</td>
			<td>T1020S</td>
			<td>Used to extract the bands from the DNA gel</td>
		</tr>
		<tr>
			<td>Monarch Plasmid Miniprep Kit</td>
			<td>NEB</td>
			<td>T1010S</td>
			<td>Used to extract plasmid from the cells</td>
		</tr>
		<tr>
			<td>pGEM T-easy</td>
			<td>Promega</td>
			<td>A1360</td>
			<td>used as suicide plasmid</td>
		</tr>
		<tr>
			<td>S.O.C.</td>
			<td>Invitrogen</td>
			<td>15544034</td>
			<td>used for recovery of cells after transformation</td>
		</tr>
		<tr>
			<td>Sodium Hydroxide (NaOH)</td>
			<td>Sigma</td>
			<td>S0899</td>
			<td>used for S.pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Spectinomycin Hydrochloride</td>
			<td>SigmaAldrich</td>
			<td>PHR1426</td>
			<td>Used for bacterial selection</td>
		</tr>
		<tr>
			<td>Subcloning Efficiency DH5&#945; Competent Cells</td>
			<td>Invitrogen</td>
			<td>18265017</td>
			<td>used for the creation of pSD1 and pSD2</td>
		</tr>
	</tbody>
</table>

constructing mutants in serotype 1 streptococcus pneumoniae strain 519/43

Streptococcus pneumoniae 혈청형 1은 저소득 및 중간 소득 국가, 특히 사하라 사막 이남 아프리카에서 여전히 큰 문제로 남아 있습니다. 그 중요성에도 불구하고, 이 혈청형에 대한 연구는 그것을 변형시키는 유전적 도구의 부족으로 인해 방해를 받았습니다. 이 연구에서 우리는 혈청형 1 임상 분리주(균주 519/43)를 유전적으로 변형시키는 방법을 설명합니다. 흥미롭게도 이것은 자연적으로 DNA를 획득하는 폐렴 구균의 능력을 이용하여 달성되었습니다. 그러나 대부분의 폐렴 구균과 달리 선형 DNA의 사용은 성공적이지 못했습니다. 이 중요한 균주를 돌연변이시키기 위해서는 자살 플라스미드를 사용해야 했습니다. 이 방법론은 생물학과 병원성 측면에서 이 파악하기 어려운 혈청형을 더 깊이 이해할 수 있는 수단을 제공했습니다. 이 방법을 검증하기 위해 알려진 주요 폐렴구균 독소인 뉴몰리신은 잘 알려져 있고 따르기 쉬운 표현형을 가지고 있기 때문에 돌연변이되었습니다. 우리는 예상대로 돌연변이가 적혈구를 용해시키는 능력을 상실했음을 보여주었습니다. 관심 혈청형에서 중요한 유전자를 돌연변이시킬 수 있게 됨으로써, 우리는 복강내 및 비강내 감염 시 기능 상실 돌연변이에 대해 다른 혈청형에 대해 관찰된 표현형과 다른 표현형을 관찰할 수 있었습니다. 요약하면, 이 연구는 균주 519/43(혈청형 1)이 유전자 변형될 수 있음을 증명합니다.

여기에 설명된 프로토콜은 PCR을 사용하여 왼쪽 및 오른쪽 상동성 아암을 증폭하는 동시에 플라이 유전자의 중간 영역에서 191bp를 삭제하는 것으로 시작합니다. PCR을 수행하는 동안 BamHI 부위는 왼쪽 상동성 암의 3'와 오른쪽 상동성 암의 5' 말단에 도입됩니다(그림 1A). 그 다음에는 왼쪽 및 오른쪽 상동성 암이 하나의 앰플리콘으로 융합되는 PCR-SOE가 이어집니다(<strong cl...

Watch this Scientific Journal Video about Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43 at JoVE.com

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

여기에서 우리는 DNA와 자살 플라스미드를 자연적으로 획득하는 능력을 사용하여 유전자 변형될 수 있는 S. pneumoniae 혈청형 1 균주 519/43에 대해 설명합니다. 원리의 증거로서, pneumolysin (ply) 유전자의 동종 돌연변이가 만들어졌다.

혈청형 1 Streptococcus pneumoniae 균주 519/43에서 돌연변이 구성

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, ...

constructing-mutants-serotype-1-streptococcus-pneumoniae-strain

Research

JoVE Journal

Immunology and Infection

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

1.6K 조회수.  London School of Hygiene and Tropical Medicine. 여기에서 우리는 DNA와 자살 플라스미드를 자연적으로 획득하는 능력을 사용하여 유전자 변형될 수 있는 S. pneumoniae 혈청형 1 균주 519/43에 대해 설명합니다. 원리의 증거로서, pneumolysin (ply) 유전자의 동종 돌연변이가 만들어졌다.

비디오: Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

During the 1918 influenza virus pandemic, which killed approximately 50 million people worldwide, the majority of fatalities were not the result of infection with influenza virus alone. Instead, most individuals are thought to have succumbed to a secondary bacterial infection, predominately caused by the bacterium Streptococcus pneumoniae (the pneumococcus). The synergistic relationship between infections caused by influenza virus and the pneumococcus has subsequently been observed during the 1957 Asian influenza virus pandemic, as well as during seasonal outbreaks of the virus (reviewed in 1, 2). Here, we describe a protocol used to investigate the mechanism(s) that may be involved in increased morbidity as a result of concurrent influenza A virus and S. pneumoniae infection. We have developed an infant murine model to reliably and reproducibly demonstrate the effects of influenza virus infection of mice colonised with S. pneumoniae. Using this protocol, we have provided the first insight into the kinetics of pneumococcal transmission between co-housed, neonatal mice using in vivo imaging 3.

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

A concurrent infection with influenza A virus is one of the factors implicated in the induction of invasive pneumococcal disease during asymptomatic Streptococcus pneumoniae carriage. Here we describe a mixed infection method using infant mice to investigate the synergism between these two respiratory pathogens.

사이 Synergism을 맡은 이후로 발광 생물 이미징을 사용하여 연쇄상 구균 pneumoniae</em유아 마우스에서>와 인플루엔자 바이러스

During the 1918 influenza virus pandemic, which killed approximately 50 million people worldwide, the majority of fatalities were not the result of ...

연구

면역학 및 감염병학

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

V3의 HIV - 1 Tropism의 Genotypic 추론 사용 인구를 기반 시퀀싱

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy

During the last few years scientists became increasingly aware that average data obtained from microbial population based experiments are not representative of the behavior, status or phenotype of single cells. Due to this new insight the number of single cell studies rises continuously (for recent reviews see 1,2,3). However, many of the single cell techniques applied do not allow monitoring the development and behavior of one specific single cell in time (e.g. flow cytometry or standard microscopy).
Here, we provide a detailed description of a microscopy method used in several recent studies 4, 5, 6, 7, which allows following and recording (fluorescence of) individual bacterial cells of Bacillus subtilis and Streptococcus pneumoniae through growth and division for many generations. The resulting movies can be used to construct phylogenetic lineage trees by tracing back the history of a single cell within a population that originated from one common ancestor. This time-lapse fluorescence microscopy method cannot only be used to investigate growth, division and differentiation of individual cells, but also to analyze the effect of cell history and ancestry on specific cellular behavior. Furthermore, time-lapse microscopy is ideally suited to examine gene expression dynamics and protein localization during the bacterial cell cycle. The method explains how to prepare the bacterial cells and construct the microscope slide to enable the outgrowth of single cells into a microcolony. In short, single cells are spotted on a semi-solid surface consisting of growth medium supplemented with agarose on which they grow and divide under a fluorescence microscope within a temperature controlled environmental chamber. Images are captured at specific intervals and are later analyzed using the open source software ImageJ.

Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy

This protocol provides a step-by-step procedure to monitor single cell behavior of different bacteria in time using automated fluorescence time-lapse microscopy. Furthermore, we provide guidelines how to analyze the microscopy images.

라이브 셀 이미징 바실러스 subtilis과 연쇄상 구균 pneumoniae 자동 시간 저속 현미경을 사용하여

During the last few years scientists became increasingly aware that average data obtained from microbial population based experiments are not ...

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing the mucosal surface of the nasopharynx, where it can reside, multiply and eventually overcome host defences to invade to other tissues of the host. Establishment of an infection in the normally lower respiratory tract results in pneumonia. Alternatively, the bacteria can disseminate into the bloodstream causing bacteraemia, which is associated with high mortality rates2, or else lead directly to the development of pneumococcal meningitis. Understanding the kinetics of, and immune responses to, nasopharyngeal colonization is an important aspect of S. pneumoniae infection models.
Our mouse model of intranasal colonization is adapted from human models3 and has been used by multiple research groups in the study of host-pathogen responses in the nasopharynx4-7. In the first part of the model, we use a clinical isolate of S. pneumoniae to establish a self-limiting bacterial colonization that is similar to carriage events in human adults. The procedure detailed herein involves preparation of a bacterial inoculum, followed by the establishment of a colonization event through delivery of the inoculum via an intranasal route of administration. Resident macrophages are the predominant cell type in the nasopharynx during the steady state. Typically, there are few lymphocytes present in uninfected mice8, however mucosal colonization will lead to low- to high-grade inflammation (depending on the virulence of the bacterial species and strain) that will result in an immune response and the subsequent recruitment of host immune cells. These cells can be isolated by a lavage of the tracheal contents through the nares, and correlated to the density of colonization bacteria to better understand the kinetics of the infection.

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Colonization of the murine nasopharynx with Streptococcus pneumoniae and the subsequent extraction of adherent or recruited cells is described. This technique involves flushing the nasopharynx and collection of the fluid through the nares and is adaptable for various readouts, including differential cell quantification and analysis of mRNA expression in situ.

연쇄상 구균 폐렴으로 비강 내 식민지 화 중 염증 반응의 특성화

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing ...

Monitoring Changes in Membrane Polarity, Membrane Integrity, and Intracellular Ion Concentrations in Streptococcus pneumoniae Using Fluorescent Dyes

Membrane depolarization and ion fluxes are events that have been studied extensively in biological systems due to their ability to profoundly impact cellular functions, including energetics and signal transductions. While both fluorescent and electrophysiological methods, including electrode usage and patch-clamping, have been well developed for measuring these events in eukaryotic cells, methodology for measuring similar events in microorganisms have proven more challenging to develop given their small size in combination with the more complex outer surface of bacteria shielding the membrane. During our studies of death-initiation in Streptococcus pneumoniae (pneumococcus), we wanted to elucidate the role of membrane events, including changes in polarity, integrity, and intracellular ion concentrations. Searching the literature, we found that very few studies exist. Other investigators had monitored radioisotope uptake or equilibrium to measure ion fluxes and membrane potential and a limited number of studies, mostly in Gram-negative organisms, had seen some success using carbocyanine or oxonol fluorescent dyes to measure membrane potential, or loading bacteria with cell-permeant acetoxymethyl (AM) ester versions of ion-sensitive fluorescent indicator dyes. We therefore established and optimized protocols for measuring membrane potential, rupture, and ion-transport in the Gram-positive organism S. pneumoniae. We developed protocols using the bis-oxonol dye DiBAC4(3) and the cell-impermeant dye propidium iodide to measure membrane depolarization and rupture, respectively, as well as methods to optimally load the pneumococci with the AM esters of the ratiometric dyes Fura-2, PBFI, and BCECF to detect changes in intracellular concentrations of Ca2+, K+, and H+, respectively, using a fluorescence-detection plate reader. These protocols are the first of their kind for the pneumococcus and the majority of these dyes have not been used in any other bacterial species. Though our protocols have been optimized for S. pneumoniae, we believe these approaches should form an excellent starting-point for similar studies in other bacterial species.

Monitoring Changes in Membrane Polarity, Membrane Integrity, and Intracellular Ion Concentrations in Streptococcus pneumoniae Using Fluorescent Dyes

Unlike that seen for eukaryotes, there is a paucity of studies that detail membrane depolarization and ion concentration changes in bacteria, primarily as their small size makes conventional methods of measurement difficult. Here, we detail protocols for monitoring such events in the significant Gram-positive pathogen Streptococcus pneumoniae utilizing fluorescence techniques.

막 극성, 멤브레인 무결성 및 세포 내 이온 농도의 모니터링 변경<em&gt; 폐렴 구균</em&gt; 형광 염료를 사용

Membrane depolarization and ion fluxes are events that have been studied extensively in biological systems due to their ability to profoundly impact ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal epidemiology, capsular serotyping can provide useful information for vaccine efficacy and impact studies.&#160;The Quellung reaction is the gold standard method for pneumococcal capsular serotyping. The method involves testing a pneumococcal cell suspension with pooled and specific antisera directed against the capsular polysaccharide. The antigen-antibody reactions are observed microscopically. The protocol has three main steps: 1) preparation of a bacterial cell suspension, 2) mixing of cells and antisera on a glass slide, and 3) reading the Quellung reaction using a microscope. The Quellung reaction is reasonably simple to perform and can be applied wherever a suitable microscope and antisera are available.

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

The Quellung reaction is the gold standard technique for serotyping Streptococcus pneumoniae. This technique utilizes a microscope and specific pneumococcal antisera and is commonly used in reference and research laboratories worldwide.

의 캡슐 혈청 형<em&gt; 폐렴 구균</em&gt; Quellung 반응을 이용하여

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major cause of morbidity and mortality world-wide. Current vaccines target the pneumococcal capsule, and there are over 90 capsular serotypes. Serotyping pneumococcal isolates is therefore important for assessing the impact of vaccination programs and for epidemiological purposes. The World Health Organization has recommended latex agglutination as an alternative method to the &#8216;gold standard&#8217; Quellung test for serotyping pneumococci. Latex agglutination is a relatively simple, quick and inexpensive method; and is therefore suitable for resource-poor settings as well as laboratories with high-volume workloads. Latex agglutination reagents can be prepared in-house utilizing commercially-sourced antibodies that are passively attached to latex particles. This manuscript describes a method of production and quality control of latex agglutination reagents, and details a sequential testing approach which is time- and cost-effective. 
This method of production and quality control may also be suitable for other testing purposes.

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Latex agglutination testing is a simple, rapid and inexpensive method for serotyping Streptococcus pneumoniae, and has also been widely applied in diagnostic microbiology. This manuscript describes the in-house production of latex agglutination reagents, quality control procedures and the application of this technique to pneumococcal serotyping.

의 캡슐 혈청 형<em&gt; 폐렴 구균</em&gt; 라텍스 응집에 의해

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major ...

A Murine Model of Group B Streptococcus Vaginal Colonization

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of 10 - 30% of adults. In immune-compromised individuals, including neonates, pregnant women, and the elderly, GBS may switch to an invasive pathogen causing sepsis, arthritis, pneumonia, and meningitis. Because GBS is a leading bacterial pathogen of neonates, current prophylaxis is comprised of late gestation screening for GBS vaginal colonization and subsequent peripartum antibiotic treatment of GBS-positive mothers. Heavy GBS vaginal burden is a risk factor for both neonatal disease and colonization. Unfortunately, little is known about the host and bacterial factors that promote or permit GBS vaginal colonization. This protocol describes a technique for establishing persistent GBS vaginal colonization using a single &#946;-estradiol pre-treatment and daily sampling to determine bacterial load. It further details methods to administer additional therapies or reagents of interest and to collect vaginal lavage fluid and reproductive tract tissues. This mouse model will further the understanding of the GBS-host interaction within the vaginal environment, which will lead to potential therapeutic targets to control maternal vaginal colonization during pregnancy and to prevent transmission to the vulnerable newborn. It will also be of interest to increase our understanding of general bacterial-host interactions in the female vaginal tract.

A Murine Model of Group B Streptococcus Vaginal Colonization

The purpose of this protocol is to imitate human group B Streptococcus (GBS) vaginal colonization in a murine model. This method may be used to investigate host immune responses and bacterial factors contributing to GBS vaginal persistence, as well as to test therapeutic strategies.

그룹 B의 쥐 모델<em&gt; 연쇄상 구균</em&gt; 질 식민

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of ...

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or A. baumannii

Efficacy of candidate antibacterial treatments must be demonstrated in animal models of infection as part of the discovery and development process, preferably in models which mimic the intended clinical indication. A method for inducing robust lung infections in immunocompetent rats and mice is described which allows for the assessment of treatments in a model of serious pneumonia caused by S. pneumoniae, H. influenzae, P. aeruginosa, K. pneumoniae or A. baumannii. Animals are anesthetized, and an agar-based inoculum is deposited deep into the lung via nonsurgical intratracheal intubation. The resulting infection is consistent, reproducible, and stable for at least 48 h and up to 96 h for most isolates. Studies with marketed antibacterials have demonstrated good correlation between in vivo efficacy and in vitro susceptibility, and concordance between pharmacokinetic/pharmacodynamic targets determined in this model and clinically accepted targets has been observed. Although there is an initial time investment when learning the technique, it can be performed quickly and efficiently once proficiency is achieved. Benefits of the model include elimination of the neutropenic requirement, increased robustness and reproducibility, ability to study more pathogens and isolates, improved flexibility in study design and establishment of a challenging infection in an immunocompetent host.

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or  A. baumannii

A method for establishing lung infections in immunocompetent rodents is described. With proficiency, this method can be performed quickly and easily to induce stable infection with many isolates of S. pneumoniae, H. influenzae, P. aeruginosa, K. pneumoniae and A. baumannii.

면역 적격 설치류에서 강력한 폐렴 모델에 대해 항균 효능을 평가하기<i&gt; S. 폐렴</i&gt;<i&gt; H. 인플루엔자</i&gt;<i&gt; K. 폐렴</i&gt;<em&gt; P. 녹농균</em&gt; 또는<em&gt;를했다. baumannii가</em

Efficacy of candidate antibacterial treatments must be demonstrated in animal models of infection as part of the discovery and development process, ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

주문, 녹 농 균 스트레인 PA14 Transposon 삽입 돌연변이의 비중복 라이브러리의 복제

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...