Gostaríamos de agradecer ao Meningitis Trust e ao MRC por fornecerem financiamento para este trabalho.

1. Geração do amplificador mutante por SOE-PCR23 e amplificação do de espectinomicina
<ol><li>Comece realizando a PCR para a amplificação dos braços de homologia (ply 5' (488 pb) e ply3' (715 bp) respectivamente) das regiões de flanco do gene da camada da cepa 519/43. Use primers plyFw1_NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), ply5'R1_BamHI (CGAAATATAGACCAAAGGACCC GGATCC AGAACCAAACTTGACCTTGA), ply3'F1_BamHI (TCAAGGTCAAGTTTGGTTCTCTGGATCC GCGTCCTTTGGTCTATATTTCG) e plyRv2_NotI (TTTGCGGCCCCATTTTCTCTATTCTATTCTATTCTATTCTATTCTCTCT).</li>
	<li>Utilizar as seguintes condições de PCR para a ply5': desnaturação a 94 °C durante 60 s, passo 2: desnaturação a 94 °C durante 30 s, passo 3: recozimento a 58 °C durante 30 s, passo 4: extensão a 72 °C durante 30 s, passo 5: voltar ao passo 2 e repetir durante 35 ciclos, passo 6: extensão final a 72°C durante 30 s.<ol><li>Use as mesmas condições de PCR para ply3', com exceção do tempo de extensão na etapa 4 e na etapa 6, onde deve ser de 60 s.</li>
	</ol></li>
	<li>Analise os produtos de PCR por eletroforese em gel e extirpe o amplificão do gel.</li>
	<li>Purificar os amplificadores de PCR seguindo o protocolo descrito nas instruções do fabricante (Tabela de Materiais).</li>
	<li>Use quantidades equimolares de ambos os braços de homologia como modelos no SOE-PCR. Fundir os dois amplificadores usando primers plyFw1_ NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG) e plyRv2_NotI (TTTGCGGCCCCATTTTCTACCTTATCCTCTACC).</li>
	<li>Utilize as seguintes condições SOE-PCR (passo 1: desnaturação a 94 °C durante 2 min, passo 2: desnaturação a 94 °C durante 30 s, passo 3: recozimento a 58 °C durante 30 s, Passo 4: extensão a 68 °C durante 60 s, passo 5: voltar ao passo 2 e repetir durante 25 ciclos, passo 6: extensão final a 68 °C durante 90 s).</li>
	<li>Analisar o produto SOE-PCR por eletroforese em gel. Retire-o do gel usando um kit de extração de gel e siga as instruções fornecidas.</li>
	<li>Amplificar o de espectinomicina do plasmídeo pR412 utilizando as seguintes condições de PCR: passo 1: desnaturação a 94 °C durante 60 s, passo 2: desnaturação a 94 °C durante 30 s, passo 3: recozimento a 55 °C durante 30 s, passo 4: extensão a 68 °C durante 60 s, passo 5: voltar ao passo 2 e repetir durante 25 ciclos, passo 6: extensão final a 68 °C durante 60 s.<ol><li>Use primers BamHI_SP2F2 (GGATCC CTA GAA CTA GTG GAT CCC CC) e BamHI_SP2R2 (GGATCC AAT TCT GCA GAT TTT AC ATG ATC). O Plasmid pR412 foi adquirido do Dr. Marc PrudHomme (CNRS-Universite Paul Sabatier Toulouse França).</li>
	</ol></li>
	<li>Analisar os amplificadores de PCR por eletroforese em gel. Aumentar e purificar o amplificador de PCR resultante, conforme descrito acima.</li>
</ol>2. Geração de plasmídeo pSD1 e Transformação química de E. coli Dh5α
<ol><li>Realizar uma ligadura seguindo as instruções do fabricante do sistema pGEMT I (Tabela de Materiais). Em um tubo de microcentrífuga, adicione 5 μL de tampão de ligadura 2x, 1 μL de pGEMTeasy, 2 μL do produto ply_SOE, 1 μL de ligase de DNA T4 e água a um volume total de 20 μL. Incubar durante a noite a 4 °C. Isso gera o plasmídeo pSD1.</li>
	<li>Transformar E. coli Dh5α quimicamente competente com pSD1. Comece incubando 50 μL de E. coli Dh5α quimicamente competente com 3 μL de reação de ligadura pSD1 por 15 min no gelo. Em seguida, continue expondo as células ao choque térmico (42 °C, 30 s). Coloque as células no gelo por 2 min.</li>
	<li>Remova as células do gelo e adicione 350 μL de meio S.O.C. Incubar a cultura por 2 h a 37 °C, 120 rpm.</li>
	<li>Placa de transformação em ágar Luria Bertani (LBA) suplementado com 0,4 mM IPTG, 0,24 mg/mL X-Gal para seleção azul/branca e 100 μg/mL de ampicilina para garantir que todas as colônias que crescem na placa tenham a espinha dorsal do plasmídeo. As colônias brancas contêm pSD1.</li>
	<li>Escolher três colónias brancas e estabelecer crescimentos durante a noite em 10 ml de LB, suplementados com 100 μg/ml de ampicilina. Incubar as culturas durante a noite a 37 °C com agitação.</li>
	<li>No dia seguinte, centrifugar as culturas a 3.082 x g e usar o pellet para extração de plasmídeos.</li>
</ol>3. Extração de DNA plasmídico, digestão de restrição de pSD1 e gene de espectinomicina e montagem de pSD2
<ol><li>Extraia o DNA plasmídico seguindo as instruções fornecidas com o kit comercial (Tabela de Materiais).</li>
	<li>Configure uma digestão de restrição de BamHI para o plasmídeo pSD1 e o de espectinomicina previamente amplificado e purificado. Utilizar as seguintes condições e quantidades descritas no quadro 1.</li>
	<li>Incubar as reações de digestão de restrição e os controles a 37 °C por 3 h.</li>
	<li>Analisar o digesto de restrição por eletroforese, extirpar a banda e purificar seguindo as instruções fornecidas com o kit comercial (Tabela de Materiais).</li>
	<li>Em seguida, prepare uma reação de ligadura seguindo as instruções do fabricante (Tabela de Materiais) usando o pSD1 digerido por BamHI e a espectinomicina (a partir da etapa 3.2). Num tubo de microcentrífuga, adicionar os seguintes componentes de reacção: 5 μL de tampão de ligadura 2x, 2 μL pSD1, 2 μL de de espectinomicina, 1 μL de DNA ligase T4 e incubar durante a noite a 4 °C. Isso gera o plasmídeo pSD2.</li>
	<li>Transformar o plasmídeo pSD2 em E. coli Dh5α quimicamente competente, conforme descrito no passo 2.2.</li>
	<li>Selecione os transformadores portadores de plasmídeo pSD2 com base em sua capacidade de crescer em LBA suplementado com 100 μg/mL de espectinomicina e ampicilina.</li>
	<li>Realizar uma extração de DNA plasmídico (pSD2) conforme descrito acima e seguindo as instruções do fabricante (μL).</li>
</ol>4. Transformação da estirpe 519/43 de S. pneumoniae
<ol><li>Preparar uma cultura noturna de S. pneumoniae 519/43 em BHI e permitir que ela cresça estaticamente a 37 °C, 5% de CO2.</li>
	<li>No dia seguinte, diluir as culturas 1:50 e 1:100 em 10 mL de caldo BHI fresco. Incubar as culturas estaticamente a 37 °C até que a OD595nm esteja entre 0,05 e 0,1 (aquisição ótima de DNA mais próxima de 0,1 OD).</li>
	<li>Uma vez que uma OD de 0,1 é atingida, pegue 860 μL e transfira para um tubo de microcentrífuga. Neste mesmo tubo de microcentrífuga adicionar: 100 μL de 100 mM de NaOH, 10 μL de 20% (p/v) BSA, 10 μL de 100 mM CaCl 2,2 μL de 50 ng/mL CSP124 e 500 ng de pSD2.</li>
	<li>Incubar a reacção estaticamente a 37 °C durante 3 h.</li>
	<li>Placa de 330 μL em placas de ágar sangue (BA) a 5% suplementadas com 100 μg/mL de espectinomicina, a cada hora durante as 3 horas de incubação.</li>
	<li>Incubar as placas durante a noite a 37 °C, 5% de CO2. Colomendo colônias resistentes à espectromicina em outra placa de BA suplementada com 100 μg/mL de espectinomicina, bem como em placas de BA suplementadas com 100 μg/mL de ampicilina. Incubar ambos os conjuntos de placas durante a noite sob as condições indicadas acima. As placas de ampicilina devem testar a presença da espinha dorsal do plasmídeo.</li>
	<li>Confirmar a presença do de espectinomicina por PCR utilizando primers plyFw1_ NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG) e SPEC_REV (TAATTCCTCTAAGTCATAATTTCCG). Confirme a mutação por PCR usando os primers plySCN1 (CCAATGGAAATCGCTAGGCAAGAGATAA) e plySCN2 (ATTACTTAGTCCAACCACGGCTGAT) que se ligam fora da região mutada.</li>
	<li>Confirmar a integração na localização correta do genoma por sequenciamento usando primers plySCN1 (CCAATGGAAATCGCTAGGCAAGAGATAA), plySCN2 (ATTACTTAGTCCAACCACGGCTGAT), bem como primers com seu local de ligação no de espectinomicina sqr1 (CCTGATCCAAACATGTAAGTACC) sqf2 (CGTAGTTATCTTGGAGAGAATA) spec_sqf1 (GGTACTTACATGTTTGGATCAGG ) e spec_sqr2 TATTCTCTCCAAGATAACTACG.</li>
</ol>

<ol>
	<li>Bentley, S. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Analysis+of+the+Capsular+Biosynthetic+Locus+from+All+90+Pneumococcal+Serotypes.">Genetic Analysis of the Capsular Biosynthetic Locus from All 90 Pneumococcal Serotypes.</a> PLoS Genetics. 2 (3), 31 (2006).</li><li>Calix, J. J., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+pneumococcal+serotype,+11E,+has+a+variably+inactivated+wcjE+gene.">A new pneumococcal serotype, 11E, has a variably inactivated wcjE gene.</a> The Journal of Infectious Diseases. 202 (1), 29-38 (2010).</li><li>Park, I. H., Pritchard, D. G., Cartee, R., Brandao, A., Brandileone, M. C. C., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+a+New+Capsular+Serotype+(6C)+within+Serogroup+6+of+Streptococcus+pneumoniae.">Discovery of a New Capsular Serotype (6C) within Serogroup 6 of Streptococcus pneumoniae.</a> Journal of Clinical Microbiology. 45 (4), 1225-1233 (2007).</li><li>Jin, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First+Report+of+Putative+Streptococcus+pneumoniae+Serotype+6D+among+Nasopharyngeal+Isolates+from+Fijian+Children.">First Report of Putative Streptococcus pneumoniae Serotype 6D among Nasopharyngeal Isolates from Fijian Children.</a> The Journal of Infectious Diseases. 200 (9), 1375-1380 (2009).</li><li>Oliver, M. B., vander Linden, M. P. G., K&#252;ntzel, S. A., Saad, J. S., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+Streptococcus+pneumoniae+Serotype+6+Variants+with+Glycosyltransferases+Synthesizing+Two+Differing+Repeating+Units.">Discovery of Streptococcus pneumoniae Serotype 6 Variants with Glycosyltransferases Synthesizing Two Differing Repeating Units.</a> Journal of Biological Chemistry. 288 (36), 25976-25985 (2013).</li><li>Calix, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serological+Characterization+of+Two+Capsule+Subtypes+among+Streptococcus+pneumoniae+Serotype+20+Strains.">Serological Characterization of Two Capsule Subtypes among Streptococcus pneumoniae Serotype 20 Strains.</a> Journal of Biological Chemistry. 287 (33), 27885-27894 (2012).</li><li>Park, I. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=and+Serological+Characterization+of+a+New+Pneumococcal+Serotype,+6H,+and+Generation+of+a+Pneumococcal+Strain+Producing+Three+Different+Capsular+Repeat+Units.">and Serological Characterization of a New Pneumococcal Serotype, 6H, and Generation of a Pneumococcal Strain Producing Three Different Capsular Repeat Units.</a> Clinical and Vaccine Immunology. 22 (3), 313-318 (2015).</li><li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> The Lancet. 374 (9693), 893-902 (2009).</li><li>Henriques-Normark, B., Tuomanen, E. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pneumococcus:+Epidemiology,+Microbiology,+and+Pathogenesis.">The Pneumococcus: Epidemiology, Microbiology, and Pathogenesis.</a> Cold Spring Harbor Perspectives in Medicine. 3 (7), 010215 (2013).</li><li>Leimkugel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Outbreak+of+Serotype+1+Streptococcus+pneumoniae+Meningitis+in+Northern+Ghana+with+Features+That+Are+Characteristic+of+Neisseria+meningitidis+Meningitis+Epidemics.">An Outbreak of Serotype 1 Streptococcus pneumoniae Meningitis in Northern Ghana with Features That Are Characteristic of Neisseria meningitidis Meningitis Epidemics.</a> The Journal of Infectious Diseases. 192 (2), 192-199 (2005).</li><li>Yaro, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiological+and+Molecular+Characteristics+of+a+Highly+Lethal+Pneumococcal+Meningitis+Epidemic+in+Burkina+Faso.">Epidemiological and Molecular Characteristics of a Highly Lethal Pneumococcal Meningitis Epidemic in Burkina Faso.</a> Clinical Infectious Diseases. 43 (6), 693-700 (2006).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+epidemiology+of+pneumococci+obtained+from+Gambian+children+aged+2-29+months+with+invasive+pneumococcal+disease+during+a+trial+of+a+9-valent+pneumococcal+conjugate+vaccine.">Molecular epidemiology of pneumococci obtained from Gambian children aged 2-29 months with invasive pneumococcal disease during a trial of a 9-valent pneumococcal conjugate vaccine.</a> BMC Infectious Diseases. 8 (1), 81 (2008).</li><li>Kwambana-Adams, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+outbreak+of+pneumococcal+meningitis+among+older+children+(&#8805;5+years)+and+adults+after+the+implementation+of+an+infant+vaccination+programme+with+the+13-valent+pneumococcal+conjugate+vaccine+in+Ghana.">An outbreak of pneumococcal meningitis among older children (&#8805;5 years) and adults after the implementation of an infant vaccination programme with the 13-valent pneumococcal conjugate vaccine in Ghana.</a> BMC Infectious Diseases. 16 (1), 575 (2016).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seasonality+and+outbreak+of+a+predominant+Streptococcus+pneumoniae+serotype+1+clone+from+The+Gambia:+Expansion+of+ST217+hypervirulent+clonal+complex+in+West+Africa.">Seasonality and outbreak of a predominant Streptococcus pneumoniae serotype 1 clone from The Gambia: Expansion of ST217 hypervirulent clonal complex in West Africa.</a> BMC Microbiology. 8 (1), 198 (2008).</li><li>Staples, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+of+an+Australian+serotype+1+Streptococcus+pneumoniae+outbreak.">Molecular characterization of an Australian serotype 1 Streptococcus pneumoniae outbreak.</a> Epidemiology and Infection. 143 (2), 325-333 (2015).</li><li>Gessner, B. D., Mueller, J. E., Yaro, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=African+meningitis+belt+pneumococcal+disease+epidemiology+indicates+a+need+for+an+effective+serotype+1+containing+vaccine,+including+for+older+children+and+adults.">African meningitis belt pneumococcal disease epidemiology indicates a need for an effective serotype 1 containing vaccine, including for older children and adults.</a> BMC Infectious Diseases. 10 (1), 22 (2010).</li><li>Hill, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nasopharyngeal+carriage+of+Streptococcus+pneumoniae+in+Gambian+infants:+a+longitudinal+study.">Nasopharyngeal carriage of Streptococcus pneumoniae in Gambian infants: a longitudinal study.</a> Clinical Infectious Diseases. 46 (6), 807-814 (2008).</li><li>Ebruke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+changes+in+nasopharyngeal+carriage+of+Streptococcus+pneumoniae+serotype+1+genotypes+in+healthy+Gambians+before+and+after+the+7-valent+pneumococcal+conjugate+vaccine.">Temporal changes in nasopharyngeal carriage of Streptococcus pneumoniae serotype 1 genotypes in healthy Gambians before and after the 7-valent pneumococcal conjugate vaccine.</a> PeerJ. 3, 90 (2015).</li><li>Adegbola, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+and+antimicrobial+susceptibility+patterns+of+isolates+of+Streptococcus+pneumoniae+causing+invasive+disease+in+The+Gambia+1996-2003.">Serotype and antimicrobial susceptibility patterns of isolates of Streptococcus pneumoniae causing invasive disease in The Gambia 1996-2003.</a> Tropical Medicine and International Health. 11 (7), 1128-1135 (2006).</li><li>Marks, L. R., Reddinger, R. M., Hakansson, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Levels+of+Genetic+Recombination+during+Nasopharyngeal+Carriage+and+Biofilm+Formation+in+Streptococcus+pneumoniae.">High Levels of Genetic Recombination during Nasopharyngeal Carriage and Biofilm Formation in Streptococcus pneumoniae.</a> mBio. 3 (5), (2012).</li><li>Ritchie, N. D., Mitchell, T. J., Evans, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+is+different+about+serotype+1+pneumococci.">What is different about serotype 1 pneumococci.</a> Future Microbiology. 7 (1), 33-46 (2012).</li><li>Harvey, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+variable+region+of+pneumococcal+pathogenicity+island+1+is+responsible+for+unusually+high+virulence+of+a+serotype+1+isolate.">The variable region of pneumococcal pathogenicity island 1 is responsible for unusually high virulence of a serotype 1 isolate.</a> Infection and Immunity. 84 (3), 822-832 (2016).</li><li>Horton, R. M., Cai, Z. L., Ho, S. N., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+splicing+by+overlap+extension:+tailor-made+genes+using+the+polymerase+chain+reaction.">Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.</a> BioTechniques. 8 (5), 528-535 (1990).</li><li>Alioing, G., Granadel, C., Morrison, D. A., Claverys, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Competence+pheromone,+oligopeptide+permease,+and+induction+of+competence+in+Streptococcus+pneumoniae.">Competence pheromone, oligopeptide permease, and induction of competence in Streptococcus pneumoniae.</a> Molecular Microbiology. 21 (3), 471-478 (1996).</li><li>Lund, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Enumeration and description of the strains belonging to the State Serum Institute, Copenhagen Denmark. , (1951).</li><li>Barany, F., Tomasz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+pneumoniae+by+heterologous+plasmid+deoxyribonucleic+acid.">Genetic transformation of Streptococcus pneumoniae by heterologous plasmid deoxyribonucleic acid.</a> Journal of Bacteriology. 144 (2), 698-709 (1980).</li><li>Terra, V. S., Homer, K. A., Rao, S. G., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+novel+&#946;-galactosidase+activity+that+contributes+to+glycoprotein+degradation+and+virulence+in+Streptococcus+pneumoniae.">Characterization of novel &#946;-galactosidase activity that contributes to glycoprotein degradation and virulence in Streptococcus pneumoniae.</a> Infection and Immunity. 78 (1), (2010).</li><li>Terra, V. S., Zhi, X., Kahya, H. F., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumococcal+6-phospho-&#946;-glucosidase+(BglA3)+is+involved+in+virulence+and+nutrient+metabolism.">Pneumococcal 6-phospho-&#946;-glucosidase (BglA3) is involved in virulence and nutrient metabolism.</a> Infection and Immunity. 84 (1), (2015).</li><li>Harvey, R. M., Ogunniyi, A. D., Chen, A. Y., Paton, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumolysin+with+Low+Hemolytic+Activity+Confers+an+Early+Growth+Advantage+to+Streptococcus+pneumoniae+in+the+Blood.">Pneumolysin with Low Hemolytic Activity Confers an Early Growth Advantage to Streptococcus pneumoniae in the Blood.</a> Infection and Immunity. 79 (10), 4122 (2011).</li><li>Terra, V. S., Plumptre, C. D., Wall, E. C., Brown, J. S., Wren, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+pneumolysin+deficient+mutant+in+Streptococcus+pneumoniae+serotype+1+strain+519/43+and+phenotypic+characterisation.">Construction of a pneumolysin deficient mutant in Streptococcus pneumoniae serotype 1 strain 519/43 and phenotypic characterisation.</a> Microbial Pathogenesis. 141, 103999 (2020).</li></ol>

Os autores não têm nada a revelar.

O Streptococcus pneumoniae, em particular o sorotipo 1, continua a ser uma ameaça global que causa doença pneumocócica invasiva e meningite. Apesar da introdução de várias vacinas que deveriam ser protetoras contra o sorotipo 1, na África, esse sorotipo ainda é capaz de causar surtos que levam a alta morbidade e mortalidade13. A capacidade de manipular geneticamente este sorotipo é de importância crítica devido à sua relevância clínica. O método descrito neste estudo permit...

Streptococcus pneumoniae (S. pneumoniae, o pneumococo) é uma das principais causas de morbidade e mortalidade em todo o mundo. Até recentemente, cerca de 100 sorotipos de S. pneumoniae foram descobertos 1,2,3,4,5,6,7. Anualmente, a doença pneumocócica invasiva (DPI) reivindica cerca de 700.000 mortes, de crianças menores de 5 anos8. S. pneumoniae é a principal causa de pneumonia bacteriana, otite média, meningite e septicemia em todo o mundo9.
No cinturão africano de meningite, o sorotipo 1 é responsável por surtos de meningite, onde o tipo de sequência (ST) ST217, um tipo de sequência extremamente virulento, é dominante 10,11,12,13,14,15. Sua importância na patologia da meningite tem sido comparada à de Neisseria meningitidis no cinturão africano de meningite16. O sorotipo 1 é frequentemente a principal causa de DPI; no entanto, é muito raramente encontrado em carruagens. De fato, na Gâmbia, esse sorotipo é responsável por 20% de todas as doenças invasivas, mas só foi encontrado em 0,5% dos portadores saudáveis14,17,18,19. A troca genética e a recombinação em pneumococos competentes ocorrem geralmente no transporte e não na doença invasiva20. Além disso, o sorotipo 1 demonstrou ter uma das taxas de transporte mais curtas descritas entre os pneumococos (apenas 9 dias). Portanto, tem sido proposto que esse sorotipo pode ter uma taxa de recombinação muito menor do que outros21.
Estudos aprofundados são necessários para entender a razão por trás da baixa taxa de transporte das cepas do sorotipo 1 e sua importância na doença invasiva na África Subsaariana.
Aqui relatamos um protocolo que permite a mutagênese em todo o genoma de uma cepa específica do sorotipo 1, 519/43. Esta estirpe pode facilmente adquirir e recombinar novo ADN no seu genoma. Este método ainda não é inter-tensão, mas é muito eficiente quando feito em fundo 519/43 (outros alvos foram mutados, manuscritos em preparação). Simplesmente usando a cepa 519/43 e explorando sua competência natural, bem como substituindo a maneira como o DNA exógeno é fornecido, fomos capazes de mutar o gene da pneumolisina (ply) nesta cepa do sorotipo 1. Esse método representa uma melhoria em relação ao apresentado por Harvey et al.22 , pois é feito em uma única etapa, sem a necessidade de passar o DNA por um sorotipo diferente. No entanto, e devido à variabilidade entre as cepas, nenhum método foi padronizado para todas as cepas. A capacidade de mutar genes específicos e observar seus efeitos permitirá uma compreensão profunda das cepas de S. pneumoniae do sorotipo 1 e fornecerá respostas para o papel dessas cepas na meningite na África Subsaariana.

<table>
	<tbody>
		<tr>
			<td>AccuPrime Pfx DNA polymerase</td>
			<td>Invitrogen</td>
			<td>12344024</td>
			<td>Used for amplification of the fragments</td>
		</tr>
		<tr>
			<td>Ampicillin sodium salt</td>
			<td>Sigma Aldrich</td>
			<td>A9518</td>
			<td>Used for bacterial selection on stage 1(pSD1)</td>
		</tr>
		<tr>
			<td>Blood Agar Base</td>
			<td>Oxoid</td>
			<td>CM0055</td>
			<td>Used to plate S. pneumoniae transformants</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumine</td>
			<td>sigma</td>
			<td>55470</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Brain Heart Infusion</td>
			<td>Oxoid</td>
			<td>CM1135</td>
			<td>used to grow S. pneumoniae cells</td>
		</tr>
		<tr>
			<td>Calcium Chloride Cacl2</td>
			<td>Sigma</td>
			<td>449709</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Competence stimulating peptide 1</td>
			<td>AnaSpec</td>
			<td>AS-63779</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Luria Broth Agar</td>
			<td>Gibco</td>
			<td>22700025</td>
			<td>used for plating and selection of pSD1 and pSD2</td>
		</tr>
		<tr>
			<td>Luria Broth Base (Miller&#39;s formulation)</td>
			<td>Gibco</td>
			<td>12795027</td>
			<td>used for plating and selection of pSD1 and pSD2</td>
		</tr>
		<tr>
			<td>Monarch Gel Extraction Kit</td>
			<td>NEB</td>
			<td>T1020S</td>
			<td>Used to extract the bands from the DNA gel</td>
		</tr>
		<tr>
			<td>Monarch Plasmid Miniprep Kit</td>
			<td>NEB</td>
			<td>T1010S</td>
			<td>Used to extract plasmid from the cells</td>
		</tr>
		<tr>
			<td>pGEM T-easy</td>
			<td>Promega</td>
			<td>A1360</td>
			<td>used as suicide plasmid</td>
		</tr>
		<tr>
			<td>S.O.C.</td>
			<td>Invitrogen</td>
			<td>15544034</td>
			<td>used for recovery of cells after transformation</td>
		</tr>
		<tr>
			<td>Sodium Hydroxide (NaOH)</td>
			<td>Sigma</td>
			<td>S0899</td>
			<td>used for S.pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Spectinomycin Hydrochloride</td>
			<td>SigmaAldrich</td>
			<td>PHR1426</td>
			<td>Used for bacterial selection</td>
		</tr>
		<tr>
			<td>Subcloning Efficiency DH5&#945; Competent Cells</td>
			<td>Invitrogen</td>
			<td>18265017</td>
			<td>used for the creation of pSD1 and pSD2</td>
		</tr>
	</tbody>
</table>

constructing mutants in serotype 1 streptococcus pneumoniae strain 519/43

O sorotipo 1 do Streptococcus pneumoniae continua sendo um enorme problema em países de baixa e média renda, particularmente na África Subsaariana. Apesar de sua importância, os estudos nesse sorotipo têm sido dificultados pela falta de ferramentas genéticas para modificá-lo. Neste estudo, descrevemos um método para modificar geneticamente um isolado clínico do sorotipo 1 (cepa 519/43). Curiosamente, isso foi conseguido explorando a capacidade do pneumococo de adquirir DNA naturalmente. No entanto, ao contrário da maioria dos pneumococos, o uso de DNA linear não foi bem sucedido; para mutar essa importante cepa, um plasmídeo suicida teve que ser usado. Essa metodologia forneceu os meios para uma compreensão mais profunda desse sorotipo indescritível, tanto em termos de biologia quanto de patogenicidade. Para validar o método, a principal toxina pneumocócica conhecida, a pneumolisina, sofreu mutação por ter um fenótipo bem conhecido e fácil de seguir. Mostramos que o mutante, como esperado, perdeu sua capacidade de lisar glóbulos vermelhos. Ao sermos capazes de mutar um gene importante no sorotipo de interesse, pudemos observar fenótipos diferentes para a perda de função mutantes em infecções intraperitoneais e intranasais daqueles observados para outros sorotipos. Em resumo, este estudo prova que a estirpe 519/43 (serotipo 1) pode ser geneticamente modificada.

O protocolo descrito aqui começa usando a PCR para amplificar os braços de homologia esquerdo e direito, enquanto simultaneamente exclui 191 pb da região média do gene da dobra . Durante a realização da PCR, um sítio BamHI é introduzido no 3' do braço de homologia esquerdo e no final de 5' do braço de homologia direito (Figura 1A). Segue-se a PCR-SOE, onde os braços de homologia esquerdo e direito são fundidos em um amplicon (Figura 1B). Est...

Watch this Scientific Journal Video about Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43 at JoVE.com

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Aqui, descrevemos uma cepa 519/43 do sorotipo 1 de S. pneumoniae que pode ser geneticamente modificada usando sua capacidade de adquirir naturalmente DNA e um plasmídeo suicida. Como prova de princípio, um mutante isogênico no gene da pneumolisina (plys) foi feito.

Construindo Mutantes na Cepa 519/43 do Streptococcus pneumoniae do Serotipo 1

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, ...

constructing-mutants-serotype-1-streptococcus-pneumoniae-strain

Research

JoVE Journal

Immunology and Infection

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

1.6K visualizações.  London School of Hygiene and Tropical Medicine. Aqui, descrevemos uma cepa 519/43 do sorotipo 1 de S. pneumoniae que pode ser geneticamente modificada usando sua capacidade de adquirir naturalmente DNA e um plasmídeo suicida. Como prova de princípio, um mutante isogênico no gene da pneumolisina (plys) foi feito.

Vídeo: Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

During the 1918 influenza virus pandemic, which killed approximately 50 million people worldwide, the majority of fatalities were not the result of infection with influenza virus alone. Instead, most individuals are thought to have succumbed to a secondary bacterial infection, predominately caused by the bacterium Streptococcus pneumoniae (the pneumococcus). The synergistic relationship between infections caused by influenza virus and the pneumococcus has subsequently been observed during the 1957 Asian influenza virus pandemic, as well as during seasonal outbreaks of the virus (reviewed in 1, 2). Here, we describe a protocol used to investigate the mechanism(s) that may be involved in increased morbidity as a result of concurrent influenza A virus and S. pneumoniae infection. We have developed an infant murine model to reliably and reproducibly demonstrate the effects of influenza virus infection of mice colonised with S. pneumoniae. Using this protocol, we have provided the first insight into the kinetics of pneumococcal transmission between co-housed, neonatal mice using in vivo imaging 3.

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

A concurrent infection with influenza A virus is one of the factors implicated in the induction of invasive pneumococcal disease during asymptomatic Streptococcus pneumoniae carriage. Here we describe a mixed infection method using infant mice to investigate the synergism between these two respiratory pathogens.

Usando imagens Bioluminescent para Investigar sinergismo entre Streptococcus pneumoniae E Vírus da Influenza A em Ratos infantil

During the 1918 influenza virus pandemic, which killed approximately 50 million people worldwide, the majority of fatalities were not the result of ...

Imunologia e Infecção

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

Inferência genotípica do HIV-1 Tropismo Usando de base populacional de Seqüenciamento V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy

During the last few years scientists became increasingly aware that average data obtained from microbial population based experiments are not representative of the behavior, status or phenotype of single cells. Due to this new insight the number of single cell studies rises continuously (for recent reviews see 1,2,3). However, many of the single cell techniques applied do not allow monitoring the development and behavior of one specific single cell in time (e.g. flow cytometry or standard microscopy).
Here, we provide a detailed description of a microscopy method used in several recent studies 4, 5, 6, 7, which allows following and recording (fluorescence of) individual bacterial cells of Bacillus subtilis and Streptococcus pneumoniae through growth and division for many generations. The resulting movies can be used to construct phylogenetic lineage trees by tracing back the history of a single cell within a population that originated from one common ancestor. This time-lapse fluorescence microscopy method cannot only be used to investigate growth, division and differentiation of individual cells, but also to analyze the effect of cell history and ancestry on specific cellular behavior. Furthermore, time-lapse microscopy is ideally suited to examine gene expression dynamics and protein localization during the bacterial cell cycle. The method explains how to prepare the bacterial cells and construct the microscope slide to enable the outgrowth of single cells into a microcolony. In short, single cells are spotted on a semi-solid surface consisting of growth medium supplemented with agarose on which they grow and divide under a fluorescence microscope within a temperature controlled environmental chamber. Images are captured at specific intervals and are later analyzed using the open source software ImageJ.

Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy

This protocol provides a step-by-step procedure to monitor single cell behavior of different bacteria in time using automated fluorescence time-lapse microscopy. Furthermore, we provide guidelines how to analyze the microscopy images.

Imagens de células vivas de Bacillus subtilis E Streptococcus pneumoniae Usando Microscopia lapso de tempo Automated

During the last few years scientists became increasingly aware that average data obtained from microbial population based experiments are not ...

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing the mucosal surface of the nasopharynx, where it can reside, multiply and eventually overcome host defences to invade to other tissues of the host. Establishment of an infection in the normally lower respiratory tract results in pneumonia. Alternatively, the bacteria can disseminate into the bloodstream causing bacteraemia, which is associated with high mortality rates2, or else lead directly to the development of pneumococcal meningitis. Understanding the kinetics of, and immune responses to, nasopharyngeal colonization is an important aspect of S. pneumoniae infection models.
Our mouse model of intranasal colonization is adapted from human models3 and has been used by multiple research groups in the study of host-pathogen responses in the nasopharynx4-7. In the first part of the model, we use a clinical isolate of S. pneumoniae to establish a self-limiting bacterial colonization that is similar to carriage events in human adults. The procedure detailed herein involves preparation of a bacterial inoculum, followed by the establishment of a colonization event through delivery of the inoculum via an intranasal route of administration. Resident macrophages are the predominant cell type in the nasopharynx during the steady state. Typically, there are few lymphocytes present in uninfected mice8, however mucosal colonization will lead to low- to high-grade inflammation (depending on the virulence of the bacterial species and strain) that will result in an immune response and the subsequent recruitment of host immune cells. These cells can be isolated by a lavage of the tracheal contents through the nares, and correlated to the density of colonization bacteria to better understand the kinetics of the infection.

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Colonization of the murine nasopharynx with Streptococcus pneumoniae and the subsequent extraction of adherent or recruited cells is described. This technique involves flushing the nasopharynx and collection of the fluid through the nares and is adaptable for various readouts, including differential cell quantification and analysis of mRNA expression in situ.

Caracterização de Respostas Inflamatórias Durante Colonização Intranasal com Streptococcus pneumoniae

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing ...

Monitoring Changes in Membrane Polarity, Membrane Integrity, and Intracellular Ion Concentrations in Streptococcus pneumoniae Using Fluorescent Dyes

Membrane depolarization and ion fluxes are events that have been studied extensively in biological systems due to their ability to profoundly impact cellular functions, including energetics and signal transductions. While both fluorescent and electrophysiological methods, including electrode usage and patch-clamping, have been well developed for measuring these events in eukaryotic cells, methodology for measuring similar events in microorganisms have proven more challenging to develop given their small size in combination with the more complex outer surface of bacteria shielding the membrane. During our studies of death-initiation in Streptococcus pneumoniae (pneumococcus), we wanted to elucidate the role of membrane events, including changes in polarity, integrity, and intracellular ion concentrations. Searching the literature, we found that very few studies exist. Other investigators had monitored radioisotope uptake or equilibrium to measure ion fluxes and membrane potential and a limited number of studies, mostly in Gram-negative organisms, had seen some success using carbocyanine or oxonol fluorescent dyes to measure membrane potential, or loading bacteria with cell-permeant acetoxymethyl (AM) ester versions of ion-sensitive fluorescent indicator dyes. We therefore established and optimized protocols for measuring membrane potential, rupture, and ion-transport in the Gram-positive organism S. pneumoniae. We developed protocols using the bis-oxonol dye DiBAC4(3) and the cell-impermeant dye propidium iodide to measure membrane depolarization and rupture, respectively, as well as methods to optimally load the pneumococci with the AM esters of the ratiometric dyes Fura-2, PBFI, and BCECF to detect changes in intracellular concentrations of Ca2+, K+, and H+, respectively, using a fluorescence-detection plate reader. These protocols are the first of their kind for the pneumococcus and the majority of these dyes have not been used in any other bacterial species. Though our protocols have been optimized for S. pneumoniae, we believe these approaches should form an excellent starting-point for similar studies in other bacterial species.

Monitoring Changes in Membrane Polarity, Membrane Integrity, and Intracellular Ion Concentrations in Streptococcus pneumoniae Using Fluorescent Dyes

Unlike that seen for eukaryotes, there is a paucity of studies that detail membrane depolarization and ion concentration changes in bacteria, primarily as their small size makes conventional methods of measurement difficult. Here, we detail protocols for monitoring such events in the significant Gram-positive pathogen Streptococcus pneumoniae utilizing fluorescence techniques.

Acompanhamento da evolução das Membrane Polaridade, integridade de membrana e intracelulares Ion concentrações no<em&gt; Streptococcus pneumoniae</em&gt; Usando corantes fluorescentes

Membrane depolarization and ion fluxes are events that have been studied extensively in biological systems due to their ability to profoundly impact ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal epidemiology, capsular serotyping can provide useful information for vaccine efficacy and impact studies.&#160;The Quellung reaction is the gold standard method for pneumococcal capsular serotyping. The method involves testing a pneumococcal cell suspension with pooled and specific antisera directed against the capsular polysaccharide. The antigen-antibody reactions are observed microscopically. The protocol has three main steps: 1) preparation of a bacterial cell suspension, 2) mixing of cells and antisera on a glass slide, and 3) reading the Quellung reaction using a microscope. The Quellung reaction is reasonably simple to perform and can be applied wherever a suitable microscope and antisera are available.

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

The Quellung reaction is the gold standard technique for serotyping Streptococcus pneumoniae. This technique utilizes a microscope and specific pneumococcal antisera and is commonly used in reference and research laboratories worldwide.

A sorotipagem capsular de<em&gt; Streptococcus pneumoniae</em&gt; Usando o Reaction Quellung

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major cause of morbidity and mortality world-wide. Current vaccines target the pneumococcal capsule, and there are over 90 capsular serotypes. Serotyping pneumococcal isolates is therefore important for assessing the impact of vaccination programs and for epidemiological purposes. The World Health Organization has recommended latex agglutination as an alternative method to the &#8216;gold standard&#8217; Quellung test for serotyping pneumococci. Latex agglutination is a relatively simple, quick and inexpensive method; and is therefore suitable for resource-poor settings as well as laboratories with high-volume workloads. Latex agglutination reagents can be prepared in-house utilizing commercially-sourced antibodies that are passively attached to latex particles. This manuscript describes a method of production and quality control of latex agglutination reagents, and details a sequential testing approach which is time- and cost-effective. 
This method of production and quality control may also be suitable for other testing purposes.

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Latex agglutination testing is a simple, rapid and inexpensive method for serotyping Streptococcus pneumoniae, and has also been widely applied in diagnostic microbiology. This manuscript describes the in-house production of latex agglutination reagents, quality control procedures and the application of this technique to pneumococcal serotyping.

Capsular sorotipagem de<em&gt; Streptococcus pneumoniae</em&gt; Por aglutinação em látex

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major ...

A Murine Model of Group B Streptococcus Vaginal Colonization

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of 10 - 30% of adults. In immune-compromised individuals, including neonates, pregnant women, and the elderly, GBS may switch to an invasive pathogen causing sepsis, arthritis, pneumonia, and meningitis. Because GBS is a leading bacterial pathogen of neonates, current prophylaxis is comprised of late gestation screening for GBS vaginal colonization and subsequent peripartum antibiotic treatment of GBS-positive mothers. Heavy GBS vaginal burden is a risk factor for both neonatal disease and colonization. Unfortunately, little is known about the host and bacterial factors that promote or permit GBS vaginal colonization. This protocol describes a technique for establishing persistent GBS vaginal colonization using a single &#946;-estradiol pre-treatment and daily sampling to determine bacterial load. It further details methods to administer additional therapies or reagents of interest and to collect vaginal lavage fluid and reproductive tract tissues. This mouse model will further the understanding of the GBS-host interaction within the vaginal environment, which will lead to potential therapeutic targets to control maternal vaginal colonization during pregnancy and to prevent transmission to the vulnerable newborn. It will also be of interest to increase our understanding of general bacterial-host interactions in the female vaginal tract.

A Murine Model of Group B Streptococcus Vaginal Colonization

The purpose of this protocol is to imitate human group B Streptococcus (GBS) vaginal colonization in a murine model. This method may be used to investigate host immune responses and bacterial factors contributing to GBS vaginal persistence, as well as to test therapeutic strategies.

Um modelo murino de Grupo B<em&gt; Streptococcus</em&gt; Colonização Vaginal

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of ...

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or A. baumannii

Efficacy of candidate antibacterial treatments must be demonstrated in animal models of infection as part of the discovery and development process, preferably in models which mimic the intended clinical indication. A method for inducing robust lung infections in immunocompetent rats and mice is described which allows for the assessment of treatments in a model of serious pneumonia caused by S. pneumoniae, H. influenzae, P. aeruginosa, K. pneumoniae or A. baumannii. Animals are anesthetized, and an agar-based inoculum is deposited deep into the lung via nonsurgical intratracheal intubation. The resulting infection is consistent, reproducible, and stable for at least 48 h and up to 96 h for most isolates. Studies with marketed antibacterials have demonstrated good correlation between in vivo efficacy and in vitro susceptibility, and concordance between pharmacokinetic/pharmacodynamic targets determined in this model and clinically accepted targets has been observed. Although there is an initial time investment when learning the technique, it can be performed quickly and efficiently once proficiency is achieved. Benefits of the model include elimination of the neutropenic requirement, increased robustness and reproducibility, ability to study more pathogens and isolates, improved flexibility in study design and establishment of a challenging infection in an immunocompetent host.

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or  A. baumannii

A method for establishing lung infections in immunocompetent rodents is described. With proficiency, this method can be performed quickly and easily to induce stable infection with many isolates of S. pneumoniae, H. influenzae, P. aeruginosa, K. pneumoniae and A. baumannii.

Um Modelo Pneumonia robusta em imunocompetentes Roedores para avaliar antibacteriano Eficácia contra<i&gt; S. pneumoniae</i&gt;,<i&gt; H. influenzae</i&gt;,<i&gt; K. pneumoniae</i&gt;,<em&gt; P. aeruginosa</em&gt; ou<em&gt; A. baumannii</em

Efficacy of candidate antibacterial treatments must be demonstrated in animal models of infection as part of the discovery and development process, ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

Replicação do requisitado, biblioteca não redundante de estirpe Pseudomonas aeruginosa PA14 Transposon mutantes de inserção

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...