This work was partially supported by NIH R00HD082686. We thank the Endocrine Society Summer Research Fellowship to H.S.Z. We also thank Dr. Yuan Kang for breeding and maintaining the mouse colony.

All performed animal experiments followed the protocols approved by the Institutional Animal Care and Use Committees (IACUC) at Auburn University.
NOTE: The following protocol uses one testis (about 100 mg) at P28 from Gli1-CreERT2; NuTRAP mice (Mus musculus). Volumes of reagents may need to be adjusted based on the types of samples and the number of tissues.
1. Tissue collection
<ol>
	<li>Euthanize the mice using a CO2 chamber, sanitize the abdomen surface with 70% ethanol.</li>
	<li>Open the lower abdomen with scissors and remove the testes.&#160;Use liquid nitrogen&#160;(LN2) to snap-freeze the testes immediately.</li>
	<li>Store samples in the vapor phase of LN2 until use.</li>
</ol>
2. Reagents and beads preparation
<ol>
	<li>Prepare the homogenization stock solution: Add 50 mM Tris (pH 7.4), 12 mM MgCl2, 100 mM KCl, 1% NP-40, and 1 mg/mL heparin. Store the solution at 4 &#176;C until use (up to 1 month).</li>
	<li>Prepare the homogenization working buffer from the stock solution (step 2.1) freshly before use: Add DTT (final concentration: 1 mM), cycloheximide (final concentration: 100 &#181;g/mL), recombinant ribonuclease (final concentration: 200 units/mL), and protease inhibitor cocktail (final concentration: 1x) to the homogenization stock solution to make the required amount of the homogenization working buffer. Store the freshly prepared working buffer on ice until use.</li>
	<li>Prepare the low-salt and the high-salt wash buffers:
	<ol>
		<li>To prepare low-salt wash buffer mix 50 mM Tris (pH 7.4), 12 mM MgCl2, 100 mM KCl, and 1% NP-40. Add DTT (final concentration: 1 mM) and cycloheximide (final concentration: 100 &#181;g/mL) before use.</li>
		<li>To prepare high-salt wash buffer mix 50 mM Tris (pH 7.4), 12 mM MgCl2, 300 mM KCl, 1% NP-40. Add DTT (final concentration: 2 mM) and Cycloheximide (final concentration: 100 &#181;g/mL) before use.</li>
	</ol>
	</li>
	<li>Prepare protein G beads (Table of Materials):
	<ol>
		<li>Each sample will need 50 &#181;L of protein G beads. Place the required amount of beads in a 1.5 mL centrifuge tube and separate the beads from the solution using a magnetic rack by leaving the tube on the rack for 30-60 s.</li>
		<li>Remove the supernatant by pipetting. Wash the beads three times with 1 mL of ice-cold low-salt wash buffer each time.</li>
	</ol>
	</li>
</ol>
3. Tissue lysis and homogenization
<ol>
	<li>Add 2 mL of ice-cold homogenization working buffer (freshly prepared from step 2.2) to a glass tissue grinder set. Quickly place the frozen sample into the grinder and homogenize the tissue with 30 strokes on ice using a loose pestle.</li>
	<li>Transfer the homogenate to a 2 mL round-bottom tube and centrifuge at 12,000 x g for 10 min at 4 &#176;C.</li>
	<li>Transfer the supernatant to a new 2 mL tube. Save 100 &#181;L to a 1.5 mL tube as the &#34;input&#34;.</li>
	<li>Incubate the supernatant in the 2 mL tube with the anti-GFP antibody (5 &#181;g/mL; 1:400) at 4 &#176;C on an end-over-end rotator (24 rpm) overnight.</li>
</ol>
4. Immunoprecipitation
<ol>
	<li>Transfer the homogenate/antibody mixture to a new 2 mL round-bottom tube containing the washed protein G beads from step 2.4. Incubate at 4 &#176;C on an end-over-end rotator (24 rpm) for 2 h.</li>
	<li>Separate the magnetic beads from the supernatant using a magnet rack. Save the supernatant as the &#34;negative fraction&#34;. The negative fraction contains (1) RNAs in EGFP-negative cells and (2) RNAs in EGFP-positive cells that are not bound to ribosomes.</li>
	<li>Add 1 mL of high-salt wash buffer to the beads and briefly vortex the tube to wash the beads. Place the tube in a magnet rack.</li>
	<li>Remove the wash buffer. Repeat the washing step two more times. The beads now contain the beads-ribosome-RNA complex from EGFP-positive cells.</li>
</ol>
5. RNA extraction
NOTE: The following steps are adapted from the RNA isolation kit (Table of Materials). Treat each fraction (i.e., input, positive, and negative) as an independent sample and isolate RNAs independently.
<ol>
	<li>Incubate the beads from step 4.4 with 50 &#181;L of Extraction Buffer (from the RNA isolation kit) in a thermomixer (42 &#176;C, 500 rpm) for 30 min to release RNAs from beads.</li>
	<li>Separate the beads with a magnet rack, transfer the supernatant which contains the beads-ribosome-RNA complex to a 1.5 mL tube.</li>
	<li>Centrifuge the tube at 3000 x g for 2 min, then pipette the supernatant to a new 1.5 mL tube. This tube contains the &#34;positive fraction&#34; of the TRAP step. 
	NOTE: For the input and the negative fractions, extract RNA from 25 &#181;L of samples using 1 mL of Extraction Buffer. Incubate in a thermomixer (42 &#176;C, 500 rpm) for 30 min.</li>
	<li>Pre-condition the RNA purification column: Pipette 250 &#181;L of Conditioning Buffer onto the purification column. Incubate for 5 min at room temperature (RT). Centrifuge the column at 16,000 x g for 1 min.</li>
	<li>Pipet&#160;equal volume of 70% EtOH into the&#160;supernatant from step 5.3 (around 50 &#181;L of 70% EtOH for the positive fraction and 1 mL of 70% EtOH for the input and the negative fractions). Mix well by pipetting up and down.</li>
	<li>Pipette the mixture into the column from step 5.4.</li>
	<li>Centrifuge the column at 100 x g for 2 min to allow RNA binding to the membrane in the column, then continue centrifuge at 16,000 x g for 30 s immediately. Discard the flow-through. 
	NOTE: For the input and the negative fractions, add 250 &#181;L of the mixture to the column each time. Repeat steps 5.6 and 5.7 until all mixtures are used.</li>
	<li>Pipette 100 &#181;L of Wash Buffer 1 (W1) into the column and centrifuge at 8,000 x g for 1 min. Discard the flow-through.</li>
	<li>Pipette 75 &#181;L of DNase solution mix directly into the purification column membrane. Incubate at RT for 15 min.</li>
	<li>Pipette 40 &#181;L of W1 into the column and centrifuge at 8,000 x g for 30 s. Discard the flow-through.</li>
	<li>Pipette 100 &#181;L of Wash Buffer 2 (W2) into the column and centrifuge at 8,000 x g for 1 min. Discard the flow-through.</li>
	<li>Pipette 100 &#181;L of W2 into the column and centrifuge at 16,000 x g for 2 min. Discard the flow-through. Re-centrifuge the same column at 16,000 x g for 1 min to remove all traces of wash buffer prior to the elution step.</li>
	<li>Transfer the column to a new 1.5 mL microcentrifuge tube.</li>
	<li>Pipette 12 &#181;L of RNase-free water directly onto the membrane of the purification column. The pipet tip should not touch the membrane. Incubate at RT for 1 min and centrifuge at 1000 x g for 1 min. Then continue centrifugation at 16,000 x g for 1 min to elute the RNA.</li>
</ol>
6. RNA concentration and quality
<ol>
	<li>Use a bioanalyzer to assess the quality and quantity of the extracted RNA10.</li>
</ol>
7. Storage and further analysis
<ol>
	<li>Store the RNA at -80 &#176;C (up to 1 year) until further analysis (e.g., microarray, quantitative PCR (qPCR), and RNA-seq, etc.). 
	NOTE: For details of the qPCR analysis, including cDNA synthesis, refer to Lyu et al.11. Primers for qPCR are listed in the Table of Materials.</li>
</ol>

<ol><li>Yang, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Deep+RNA+sequencing+reveals+dynamic+regulation+of+myocardial+noncoding+RNAs+in+failing+human+heart+and+remodeling+with+mechanical+circulatory+support%5BTitle%5D)+AND+%22Circulation%22%5BJournal%5D)">Deep RNA sequencing reveals dynamic regulation of myocardial noncoding RNAs in failing human heart and remodeling with mechanical circulatory support.</a> Circulation. 129 (9), 1009-1021 (2014).</li>
<li>Soumillon, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cellular+source+and+mechanisms+of+high+transcriptome+complexity+in+the+mammalian+testis%5BTitle%5D)+AND+%22Cell+Reports%22%5BJournal%5D)">Cellular source and mechanisms of high transcriptome complexity in the mammalian testis.</a> Cell Reports. 3 (6), 2179-2190 (2013).</li>
<li>Lake, B. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Neuronal+subtypes+and+diversity+revealed+by+single-nucleus+RNA+sequencing+of+the+human+brain%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Neuronal subtypes and diversity revealed by single-nucleus RNA sequencing of the human brain.</a> Science. 352 (6293), 1586-1590 (2016).</li>
<li>Heiman, M., Kulicke, R., Fenster, R. J., Greengard, P., Heintz, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cell+type-specific+mRNA+purification+by+translating+ribosome+affinity+purification+%28TRAP%29%5BTitle%5D)+AND+%22Nature+Protocols%22%5BJournal%5D)">Cell type-specific mRNA purification by translating ribosome affinity purification (TRAP).</a> Nature Protocols. 9 (6), 1282-1291 (2014).</li>
<li>Bertin, B., Renaud, Y., Aradhya, R., Jagla, K., Junion, G. J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((TRAP-rc%2C+translating+ribosome+affinity+purification+from+rare+cell+populations+of+Drosophila+embryos%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%3A+JoVE%22%5BJournal%5D)">TRAP-rc, translating ribosome affinity purification from rare cell populations of Drosophila embryos.</a> Journal of Visualized Experiments: JoVE. (103), e52985(2015).</li>
<li>Thellmann, M., Andersen, T. G., Vermeer, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Translating+ribosome+affinity+purification+%28trap%29+to+investigate+Arabidopsis+thaliana+root+development+at+a+cell+type-specific+scale%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%3A+JoVE%22%5BJournal%5D)">Translating ribosome affinity purification (trap) to investigate Arabidopsis thaliana root development at a cell type-specific scale.</a> Journal of Visualized Experiments: JoVE. (159), e60919(2020).</li>
<li>Moran, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Translating+ribosome+affinity+purification+%28TRAP%29+for+RNA+isolation+from+endothelial+cells+in+vivo%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%3A+JoVE%22%5BJournal%5D)">Translating ribosome affinity purification (TRAP) for RNA isolation from endothelial cells in vivo.</a> Journal of Visualized Experiments: JoVE. (147), e59624(2019).</li>
<li>Roh, H. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Simultaneous+transcriptional+and+epigenomic+profiling+from+specific+cell+types+within+heterogeneous+tissues+in+vivo%5BTitle%5D)+AND+%22Cell+Reports%22%5BJournal%5D)">Simultaneous transcriptional and epigenomic profiling from specific cell types within heterogeneous tissues in vivo.</a> Cell Reports. 18 (4), 1048-1061 (2017).</li>
<li>Varjosalo, M., Taipale, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Hedgehog%3A+functions+and+mechanisms%5BTitle%5D)+AND+%22Genes+%26+Development%22%5BJournal%5D)">Hedgehog: functions and mechanisms.</a> Genes & Development. 22 (18), 2454-2472 (2008).</li>
<li>Mueller, O., Lightfoot, S., Schroeder, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RNA+integrity+number+%28RIN%29-standardization+of+RNA+quality+control%5BTitle%5D)+AND+%22Agilent+Technologies%22%5BJournal%5D)">RNA integrity number (RIN)-standardization of RNA quality control.</a> Agilent Technologies. , Application Note 1 1-8 (2004).</li>
<li>Lyu, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RNA-seq+reveals+sub-zones+in+mouse+adrenal+zona+fasciculata+and+the+sexually+dimorphic+responses+to+thyroid+hormone%5BTitle%5D)+AND+%22Endocrinology%22%5BJournal%5D)">RNA-seq reveals sub-zones in mouse adrenal zona fasciculata and the sexually dimorphic responses to thyroid hormone.</a> Endocrinology. 161 (9), (2020).</li>
<li>King, P., Paul, A., Laufer, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Shh+signaling+regulates+adrenocortical+development+and+identifies+progenitors+of+steroidogenic+lineages%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Shh signaling regulates adrenocortical development and identifies progenitors of steroidogenic lineages.</a> Proceedings of the National Academy of Sciences of the United States of America. 106 (50), 21185-21190 (2009).</li>
<li>Huang, C. C., Miyagawa, S., Matsumaru, D., Parker, K. L., Yao, H. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Progenitor+cell+expansion+and+organ+size+of+mouse+adrenal+is+regulated+by+sonic+hedgehog%5BTitle%5D)+AND+%22Endocrinology%22%5BJournal%5D)">Progenitor cell expansion and organ size of mouse adrenal is regulated by sonic hedgehog.</a> Endocrinology. 151 (3), 1119-1128 (2010).</li>
<li>Benton, L., Shan, L. -X., Hardy, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Differentiation+of+adult+Leydig+cells%5BTitle%5D)+AND+%22The+Journal+of+Steroid+Biochemistry+and+Molecular+Biology%22%5BJournal%5D)">Differentiation of adult Leydig cells.</a> The Journal of Steroid Biochemistry and Molecular Biology. 53 (1-6), 61-68 (1995).</li>
<li>Monder, C., Hardy, M., Blanchard, R., Blanchard, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Comparative+aspects+of+11%CE%B2-hydroxysteroid+dehydrogenase.+Testicular+11%CE%B2-hydroxysteroid+dehydrogenase%3A+development+of+a+model+for+the+mediation+of+Leydig+cell+function+by+corticosteroids%5BTitle%5D)+AND+%22Steroids%22%5BJournal%5D)">Comparative aspects of 11β-hydroxysteroid dehydrogenase. Testicular 11β-hydroxysteroid dehydrogenase: development of a model for the mediation of Leydig cell function by corticosteroids.</a> Steroids. 59 (2), 69-73 (1994).</li>
<li>Bitgood, M. J., Shen, L., McMahon, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sertoli+cell+signaling+by+Desert+hedgehog+regulates+the+male+germline%5BTitle%5D)+AND+%22Current+Biology%22%5BJournal%5D)">Sertoli cell signaling by Desert hedgehog regulates the male germline.</a> Current Biology. 6 (3), 298-304 (1996).</li>
<li>Beverdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sox9-dependent+expression+of+Gstm6+in+Sertoli+cells+during+testis+development+in+mice%5BTitle%5D)+AND+%22Reproduction%22%5BJournal%5D)">Sox9-dependent expression of Gstm6 in Sertoli cells during testis development in mice.</a> Reproduction. 137 (3), 481(2009).</li>
<li>Gross, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Technologies+for+single-cell+isolation%5BTitle%5D)+AND+%22International+Journal+of+Molecular+Sciences%22%5BJournal%5D)">Technologies for single-cell isolation.</a> International Journal of Molecular Sciences. 16 (8), 16897-16919 (2015).</li>
<li>Ziegenhain, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Comparative+analysis+of+single-cell+RNA+sequencing+methods%5BTitle%5D)+AND+%22Molecular+Cell%22%5BJournal%5D)">Comparative analysis of single-cell RNA sequencing methods.</a> Molecular Cell. 65 (4), 631-643 (2017).</li>
<li>Nguyen, Q. H., Pervolarakis, N., Nee, K., Kessenbrock, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Experimental+considerations+for+single-cell+rna+sequencing+approaches%5BTitle%5D)+AND+%22Frontiers+in+Cell+and+Development+Biology%22%5BJournal%5D)">Experimental considerations for single-cell rna sequencing approaches.</a> Frontiers in Cell and Development Biology. 6, 108(2018).</li>
<li>Chucair-Elliott, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Inducible+cell-specific+mouse+models+for+paired+epigenetic+and+transcriptomic+studies+of+microglia+and+astroglia%5BTitle%5D)+AND+%22Communications+Biology%22%5BJournal%5D)">Inducible cell-specific mouse models for paired epigenetic and transcriptomic studies of microglia and astroglia.</a> Communications Biology. 3 (1), 693(2020).</li>
<li>Barsoum, I., Yao, H. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Redundant+and+differential+roles+of+transcription+factors+Gli1+and+Gli2+in+the+development+of+mouse+fetal+Leydig+cells%5BTitle%5D)+AND+%22Biology+of+Reproduction%22%5BJournal%5D)">Redundant and differential roles of transcription factors Gli1 and Gli2 in the development of mouse fetal Leydig cells.</a> Biology of Reproduction. 84 (5), 894-899 (2011).</li>
<li>Mori, H., Shimizu, D., Fukunishi, R., Christensen, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Morphometric+analysis+of+testicular+Leydig+cells+in+normal+adult+mice%5BTitle%5D)+AND+%22The+Anatomical+Record%22%5BJournal%5D)">Morphometric analysis of testicular Leydig cells in normal adult mice.</a> The Anatomical Record. 204 (4), 333-339 (1982).</li>
</ol>

The authors declare no conflict of interest.

The usefulness of the whole-tissue transcriptome analysis could be dampened, especially when studying complex heterogeneous tissues. How to obtain cell-type-specific RNAs becomes an urgent need to unleash the powerful RNA-seq technique. The isolation of cell-type-specific RNAs usually relies on the collection of a specific type of cells using micromanipulation, fluorescent-activated cell sorting (FACS), or laser capture microdissection (LCM)18. Other modern high-throughput single-cell collection m...

High-throughput approaches, including RNA sequencing (RNA-seq) and microarray, have made it possible to interrogate gene expression profiles at the genome-wide level. For complex tissues such as the heart, brain, and testis, the cell-type-specific data will provide more details comparing the use of RNAs from the whole tissue1,2,3. To overcome the impact of cellular heterogeneity, the Translating Ribosome Affinity Purification (TRAP) method has been developed since early 2010s4. TRAP is able to isolate ribosome-bound RNAs from specific cell types without tissue dissociation. This method has been used for translatome (mRNAs that are being recruited to the ribosome for translation) analysis in different organisms, including targeting an extremely rare population of muscle cells in Drosophila embryos5, studying different root cells in the model plant Arabidopsis thaliana6, and performing transcriptome analysis of endothelial cells in mammals7.
TRAP requires a genetic modification to tag the ribosome of a model organism. Evan Rosen and colleagues recently developed a mouse model called Nuclear tagging and Translating Ribosome Affinity Purification (NuTRAP) mouse8, which has been available through the Jackson Laboratory since 2017. By crossing with a Cre mouse line, researchers can use this NuTRAP mouse model to isolate ribosome-bound RNAs and cell nuclei from Cre-expressing cells without cell sorting. In Cre-expressing cells that also carry the NuTRAP allele, the EGFP/L10a tagged ribosome allows the isolation of translating mRNAs using affinity pulldown assays. At the same cell, the biotin ligase recognition peptide (BLRP)-tagged nuclear membrane, which is also mCherry positive, allows the nuclear isolation by using affinity- or fluorescence-based purification. The same research team also generated a similar mouse line in which the nuclear membrane is labeled only with mCherry without biotin8. These two genetically modified mouse lines give access to characterize paired epigenomic and transcriptomic profiles of specific types of cells in interest.
The hedgehog (Hh) signaling pathway plays a critical role in tissue development9. GLI1, a member of the GLI family, acts as a transcriptional activator and mediates the Hh signaling. Gli1+ cells can be found in many hormone-secreting organs, including the adrenal gland and the testis. To isolate cell-type-specific DNAs and RNAs from Gli1+ cells using the NuTRAP mouse model, Gli1-CreERT2 mice were crossed with the NuTRAP mice. Shh-CreERT2 mice were also crossed with the NuTRAP mice aim to isolate sonic hedgehog (Shh) expressing cells. The following protocol shows how to use Gli1-CreERT2;NuTRAP mice to isolate ribosome-bound RNAs from Gli1+ cells in adult mouse testes.

<table><tbody><tr><td>&lt;em&gt;Actb&lt;/em&gt;</td><td>eurofins</td><td>qPCR primers</td><td>ATGGAGGGGAATACAGCCC / TTCTTTGCAGCTCCTTCGTT (forward primer/reverse primer)</td></tr><tr><td>Bioanalyzer</td><td>Agilent</td><td>2100 Bioanalyzer Instrument</td><td></td></tr><tr><td>cOmplete Mini EDTA-free Protease Inhibitor Cocktail</td><td>Millipore</td><td>11836170001</td><td></td></tr><tr><td>cycloheximide</td><td>Millipore</td><td>239764-100MG</td><td></td></tr><tr><td>&lt;em&gt;Cyp11a1&lt;/em&gt;</td><td>eurofins</td><td>qPCR primers</td><td>CTGCCTCCAGACTTCTTTCG / TTCTTGAAGGGCAGCTTGTT (forward primer/reverse primer)</td></tr><tr><td>dNTP</td><td>Thermo Fisher Scientific</td><td>R0191</td><td></td></tr><tr><td>DTT, Dithiothreitol</td><td>Thermo Fisher Scientific</td><td>P2325</td><td></td></tr><tr><td>DynaMag-2 magnet</td><td>Thermo Fisher Scientific</td><td>12321D</td><td></td></tr><tr><td>Falcon tubes 15 mL</td><td>VWR</td><td>89039-666</td><td></td></tr><tr><td>GFP antibody</td><td>Abcam</td><td>ab290</td><td></td></tr><tr><td>Glass grinder set</td><td>DWK Life Sciences</td><td>357542</td><td></td></tr><tr><td>heparin</td><td>BEANTOWN CHEMICAL</td><td>139975-250MG</td><td></td></tr><tr><td>&lt;em&gt;Hsd3b&lt;/em&gt;</td><td>eurofins</td><td>qPCR primers</td><td>GACAGGAGCAGGAGGGTTTGTG / CACTGGGCATCCAGAATGTCTC (forward primer/reverse primer)</td></tr><tr><td>KCl</td><td>Biosciences</td><td>R005</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Biosciences</td><td>R004</td><td></td></tr><tr><td>Microcentrifuge tubes 2 mL</td><td>Thermo Fisher Scientific</td><td>02-707-354</td><td></td></tr><tr><td>Mouse Clariom S Assay microarrays</td><td>Thermo Fisher Scientific</td><td></td><td>Microarray service</td></tr><tr><td>NP-40</td><td>Millipore</td><td>492018-50 Ml</td><td></td></tr><tr><td>oligo (dT)20</td><td>Invitrogen</td><td>18418020</td><td></td></tr><tr><td>PicoPure RNA Isolation Kit</td><td>Thermo Fisher Scientific</td><td>KIT0204</td><td></td></tr><tr><td>Protein G Dynabead</td><td>Thermo Fisher Scientific</td><td>10003D</td><td></td></tr><tr><td>RNase-free water</td><td>growcells</td><td>NUPW-0500</td><td></td></tr><tr><td>RNaseOUT Recombinant Ribonuclease Inhibitor</td><td>Thermo Fisher Scientific</td><td>10777019</td><td></td></tr><tr><td>&lt;em&gt;Sox9&lt;/em&gt;</td><td>eurofins</td><td>qPCR primers</td><td>TGAAGAACGGACAAGCGGAG / CTGAGATTGCCCAGAGTGCT (forward primer/reverse primer</td></tr><tr><td>Superscript IV reverse transcriptase</td><td>Invitrogen</td><td>18090050</td><td></td></tr><tr><td>SYBR Green PCR Master Mix</td><td>Thermo Fisher Scientific</td><td>4309155</td><td></td></tr><tr><td>&lt;em&gt;Sycp3&lt;/em&gt;</td><td>eurofins</td><td>qPCR primers</td><td>GAATGTGTTGCAGCAGTGGGA /GAACTGCTCGTGTATCTGTTTGA (forward primer/reverse primer)</td></tr><tr><td>Tris</td><td>Alfa Aesar</td><td>J62848</td><td></td></tr></tbody></table>

isolate cell-type-specific rnas from snap-frozen heterogeneous tissue samples without cell sorting

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids potential pitfalls caused by the heterogeneity of tissues and unleashes the powerful transcriptome analysis. The protocol described here demonstrates how to use the Translating Ribosome Affinity Purification (TRAP) method to isolate ribosome-bound RNAs from a small amount of EGFP-expressing cells in a complex tissue without cell sorting. This protocol is suitable for isolating cell-type-specific RNAs using the recently available NuTRAP mouse model and could also be used to isolate RNAs from any EGFP-expressing cells.

Gli1-CreERT2 mouse (Jackson Lab Stock Number: 007913) were first crossed with the NuTRAP reporter mouse (Jackson Lab Stock Number: 029899) to generate double-mutant mice. Mice carrying both genetically engineered gene alleles (i.e., Gli1-CreERT2&#160;and NuTRAP) were injected with tamoxifen once a day, every other day, for three injections. Tissue samples were collected on the 7th day after the 1st day of the injection. Immunofluorescence analysis sho...

Watch this Scientific Journal Video about Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting at JoVE.com

Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting

This protocol aims to isolate cell-type-specific translating ribosomal mRNAs using the NuTRAP mouse model.

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids ...

isolate-cell-type-specific-rnas-from-snap-frozen-heterogeneous-tissue

Research

JoVE Journal

Biology

2.1K Views.  Auburn University. Dit protocol is gericht op het verkrijgen van hoogwaardige celtypen specifieke RNA's van een klein aantal cellen in een complex weefsel zonder celsortering. Het maakt gebruik van een recent beschikbaar muismodel waarmee onderzoekers een ribosoomgebonden RNA's kunnen isoleren met behulp van GLP pull down. De methode is ook geschikt voor het isoleren van ribosoomgebonden RNA's van EGFP-expressiecellen.Voeg om te beginnen twee milliliter ijskoude homogenisatiewerkbuffer toe aan een glazen...

Video: Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting

Isolation of Adipose Tissue Nuclei for Single-Cell Genomic Applications

Brown and beige fat are specialized adipose tissues that dissipate energy for thermogenesis by UCP1 (Uncoupling Protein-1)-dependent and independent pathways. Until recently, thermogenic adipocytes were considered a homogeneous population. However, recent studies have indicated that there are multiple subtypes or subpopulations that are distinct in developmental origin, substrate use, and transcriptome. Despite advances in single-cell genomics, unbiased decomposition of adipose tissues into cellular subtypes has been challenging because of the fragile nature of lipid-filled adipocytes. The protocol presented was developed to circumvent these obstacles by effective isolation of single nuclei from adipose tissue for downstream applications, including RNA sequencing. Cellular heterogeneity can then be analyzed by RNA sequencing and bioinformatic analyses.

This publication describes a protocol for the isolation of nuclei from mature adipocytes, purification by fluorescence-activated sorting, and single-cell level transcriptomics.

Brown and beige fat are specialized adipose tissues that dissipate energy for thermogenesis by UCP1 (Uncoupling Protein-1)-dependent and independent ...

Genetics

Nuclei Isolation from Mouse Cardiac Progenitor Cells at Single-Cell Resolution

Nuclei Isolation from Mouse Cardiac Progenitor Cells for Epigenome and Gene Expression Profiling at Single-Cell Resolution

The developing heart is a complex structure containing various progenitor cells controlled by complex regulatory mechanisms. The examination of the gene expression and chromatin state of individual cells allows the identification of the cell type and state. Single-cell sequencing approaches have revealed a number of important characteristics of cardiac progenitor cell heterogeneity. However, these methods are generally restricted to fresh tissue, which limits studies with diverse experimental conditions, as the fresh tissue must be processed at once in the same run to reduce the technical variability. Therefore, easy and flexible procedures to produce data from methods such as single-nucleus RNA sequencing (snRNA-seq) and the single-nucleus assay for transposase-accessible chromatin with high-throughput sequencing (snATAC-seq) are needed in this area. Here, we present a protocol to rapidly isolate nuclei for subsequent single-nuclei dual-omics (combined snRNA-seq and snATAC-seq). This method allows the isolation of nuclei from frozen samples of cardiac progenitor cells and can be combined with platforms that use microfluidic chambers.

Author Spotlight: Nuclei Isolation from Mouse Cardiac Progenitor Cells for Epigenome and Gene Expression Profiling at Single-Cell Resolution  

Here, we present a protocol describing cell nuclei preparation. After microdissection and enzymatic dissociation of cardiac tissue into single cells, the progenitor cells were frozen, followed by isolation of pure viable cells, which were used for single-nucleus RNA sequencing and the single-nucleus assay for transposase-accessible chromatin with high-throughput sequencing analyses.

The developing heart is a complex structure containing various progenitor cells controlled by complex regulatory mechanisms. The examination of the gene ...

Developmental Biology

Working with Human Tissues for Translational Cancer Research

Medical research for human benefit is greatly impeded by the necessity for human tissues and subjects. However, upon obtaining consent for human specimens, precious samples must be handled with the greatest care in order to ensure integrity of organs, tissues, and cells to the highest degree. Unfortunately, tissue processing by definition requires extraction of tissues from the host, a change which can cause great cellular stress and have major repercussions on subsequent analyses. These stresses could result in the specimen being no longer representative of the site from which it was retrieved. Therefore, a strict protocol must be adhered to while processing these specimens to ensure representativeness. The desired assay(s) must also be taken into consideration in order to ensure that an optimal technique is used for sample processing. Outlined here is a protocol for tissue retrieval, processing and various analyses which may be performed on processed tissue in order to maximize downstream production from limited tissue samples.

Translational cancer research is dependent on extraction of human tissues. Much work has gone into optimizing extraction methods for ex vivo analysis. Here, we describe tissue processing methods allowing for maximal data output from limited samples.

Medical research for human benefit is greatly impeded by the necessity for human tissues and subjects. However, upon obtaining consent for human ...

Medicine

Isolation of Adult Spinal Cord Nuclei for Massively Parallel Single-nucleus RNA Sequencing

Probing an individual cell&#39;s gene expression enables the identification of cell type and cell state. Single-cell RNA sequencing has emerged as a powerful tool for studying transcriptional profiles of cells, particularly in heterogeneous tissues such as the central nervous system. However, dissociation methods required for single cell sequencing can lead to experimental changes in the gene expression and cell death. Furthermore, these methods are generally restricted to fresh tissue, thus limiting studies on archival and bio-bank material. Single nucleus RNA sequencing (snRNA-Seq) is an appealing alternative for transcriptional studies, given that it accurately identifies cell types, permits the study of tissue that is frozen or difficult to dissociate, and reduces dissociation-induced transcription. Here, we present a high-throughput protocol for rapid isolation of nuclei for downstream snRNA-Seq. This method enables isolation of nuclei from fresh or frozen spinal cord samples and can be combined with two massively parallel droplet encapsulation platforms.

Here, we present a protocol to rapidly isolate high-quality nuclei from the fresh or frozen tissue for downstream massively parallel RNA sequencing. We include detergent-mechanical and hypotonic-mechanical tissue disruption and cell lysis options, both of which can be used for isolation of nuclei.

Probing an individual cell&#39;s gene expression enables the identification of cell type and cell state. Single-cell RNA sequencing has emerged as a ...

Neuroscience

RNA Isolation from Cell Specific Subpopulations Using Laser-capture Microdissection Combined with Rapid Immunolabeling

Laser capture microdissection (LCM) allows the isolation of specific cells from thin tissue sections with high spatial resolution. Effective LCM requires precise identification of cells subpopulations from a heterogeneous tissue. Identification of cells of interest for LCM is usually based on morphological criteria or on fluorescent protein reporters. The combination of LCM and rapid immunolabeling offers an alternative and efficient means to visualize specific cell types and to isolate them from surrounding tissue. High-quality RNA can then be extracted from a pure cell population and further processed for downstream applications, including RNA-sequencing, microarray or qRT-PCR. This approach has been previously performed and briefly described in few publications. The goal of this article is to illustrate how to perform rapid immunolabeling of a cell population while keeping RNA integrity, and how to isolate these specific cells using LCM. Herein, we illustrated this multi-step procedure by immunolabeling and capturing dopaminergic cells in brain tissue from one-day-old mice. We highlight key critical steps that deserve special consideration. This protocol can be adapted to a variety of tissues and cells of interest. Researchers from different fields will likely benefit from the demonstration of this approach.

Gene expression analysis of a subset of cells in a specific tissue represents a major challenge. This article describes how to isolate high-quality total RNA from a specific cell population by combining a rapid immunolabeling method with laser capture microdissection.

Laser capture microdissection (LCM) allows the isolation of specific cells from thin tissue sections with high spatial resolution. Effective LCM requires ...

Cryosectioning of Contiguous Regions of a Single Mouse Skeletal Muscle for Gene Expression and Histological Analyses

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene expression using adjacent regions from a single mouse skeletal muscle. Typically, it is challenging to achieve adequate homogenization of small skeletal muscle samples because buffer volumes may be too low for efficient grinding applications, yet without sufficient mechanical disruption, the dense tissue architecture of muscle limits penetration of buffer reagents, ultimately causing low RNA yield. By following the protocol reported here, 30 &#956;m sections are collected and pooled allowing cryosectioning and subsequent needle homogenization to mechanically disrupt the muscle, increasing the surface area exposed for buffer penetration. The primary limitations of the technique are that it requires a cryostat, and it is relatively low throughput. However, high-quality RNA can be obtained from small samples of pooled muscle cryosections, making this method accessible for many different skeletal muscles and other tissues. Furthermore, this technique enables matched analyses (e.g., tissue histopathology and gene expression) from adjacent regions of a single skeletal muscle so that measurements can be directly compared across applications to reduce experimental uncertainty and to reduce replicative animal experiments necessary to source a small tissue for multiple applications.

Consecutive cryo-sections are collected to enable histological applications and enrichment of RNA for gene expression measurements using adjacent regions from a single mouse skeletal muscle. High-quality RNA is obtained from 20 - 30 mg of pooled cryosections and measurements are directly compared across applications.

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene ...

A Laser Capture Microdissection Protocol That Yields High Quality RNA from Fresh-frozen Mouse Bones

RNA yield and integrity are decisive for RNA analysis. However, it is often technically challenging to maintain RNA integrity throughout the entire laser capture microdissection (LCM) procedure. Since LCM studies work with low amounts of material, concerns about limited RNA yields are also important. Therefore, an LCM protocol was developed to obtain sufficient quantity of high-quality RNA for gene expression analysis in bone cells. The effect of staining protocol, thickness of cryosections, microdissected tissue quantity, RNA extraction kit, and LCM system used on RNA yield and integrity obtained from microdissected bone cells was evaluated. Eight-&#181;m-thick frozen bone sections were made using an adhesive film and stained using a rapid protocol for a commercial LCM stain. The sample was sandwiched between a polyethylene terephthalate (PET) membrane and the adhesive film. An LCM system that uses gravity for sample collection and a column-based RNA extraction method were used to obtain high quality RNAs of sufficient yield. The current study focusses on mouse femur sections. However, the LCM protocol reported here can be used to study in situ gene expression in cells of any hard tissue in both physiological conditions and disease processes.

A laser capture microdissection (LCM) protocol was developed to obtain sufficient quantity of high-quality RNA for gene expression analysis in bone cells. The current study focusses on mouse femur sections. However, the LCM protocol reported here can be used to study gene expression in cells of any hard tissue.

RNA yield and integrity are decisive for RNA analysis. However, it is often technically challenging to maintain RNA integrity throughout the entire laser ...

Nuclei Isolation from Whole Tissue using a Detergent and Enzyme-Free Method

High-throughput transcriptome and epigenome profiling requires preparation of a single cell or single nuclei suspension. Preparation of the suspension with&#160;intact cell or nuclei involves dissociation and permeabilization, steps that can introduce unwanted noise and undesirable damage. Particularly, certain cell-types such as neurons are challenging to dissociate into individual cells. Additionally, permeabilization of the cellular membrane to release nuclei requires optimization by trial-and-error, which can be time consuming, labor intensive and financially nonviable. To enhance the robustness and reproducibility of sample preparation for high-throughput sequencing, we describe a rapid enzyme and detergent-free column-based nuclei isolation method. The protocol enables efficient isolation of nuclei from the entire zebrafish brain within 20 minutes. The isolated nuclei display intact nuclear morphology and low propensity to aggregate. Further, flow cytometry allows nuclei enrichment and clearance of cellular debris for downstream application. The protocol, which should work on soft tissues and cultured cells, provides a simple and accessible method for sample preparation that can be utilized for high-throughput profiling, simplifying the steps required for successful single-nuclei RNA-seq and ATAC-seq experiments.

Single nuclei isolation relies on dissociation and detergent-based permeabilization of the cell membrane, steps that need optimization and are prone to introducing technical artifacts. We demonstrate a detergent and enzyme-free protocol for rapid isolation of intact nuclei directly from whole tissue, yielding nuclei suitable for single-nucleus RNA-seq (snRNA-Seq) or ATAC-seq.

High-throughput transcriptome and epigenome profiling requires preparation of a single cell or single nuclei suspension. Preparation of the suspension ...

Nuclei Isolation from Adult Mouse Kidney for Single-Nucleus RNA-Sequencing

The kidneys regulate diverse biological processes such as water, electrolyte, and acid-base homeostasis. Physiological functions of the kidney are executed by multiple cell types arranged in a complex architecture across the corticomedullary axis of the organ. Recent advances in single-cell transcriptomics have accelerated the understanding of cell type-specific gene expression in renal physiology and disease. However, enzyme-based tissue dissociation protocols, which are frequently utilized for single-cell RNA-sequencing (scRNA-seq), require mostly fresh (non-archived) tissue, introduce transcriptional stress responses, and favor the selection of abundant cell types of the kidney cortex resulting in an underrepresentation of cells of the medulla.
Here, we present a protocol that avoids these problems. The protocol is based on nuclei isolation at 4 &#176;C from frozen kidney tissue. Nuclei are isolated from a central piece of the mouse kidney comprised of the cortex, outer medulla, and inner medulla. This reduces the overrepresentation of cortical cells typical for whole-kidney samples for the benefit of medullary cells such that data will represent the entire corticomedullary axis at sufficient abundance. The protocol is simple, rapid, and adaptable and provides a step towards the standardization of single-nuclei transcriptomics in kidney research.

Here, we present a protocol to isolate high-quality nuclei from frozen mouse kidneys that improve the representation of medullary kidney cell types and avoids the gene expression artifacts from enzymatic tissue dissociation.

The kidneys regulate diverse biological processes such as water, electrolyte, and acid-base homeostasis. Physiological functions of the kidney are ...

Isolation of Nuclei from Flash-Frozen Liver Tissue for Single-Cell Multiomics

The liver is a complex and heterogenous tissue responsible for carrying out many critical physiological functions, such as the maintenance of energy homeostasis and the metabolism of xenobiotics, among others. These tasks are performed through tight coordination between hepatic parenchymal and non-parenchymal cells. Additionally, various metabolic activities are confined to specific areas of the hepatic lobule-a phenomenon called liver zonation. Recent advances in single-cell sequencing technologies have empowered researchers to investigate tissue heterogeneity at a single-cell resolution. In many complex tissues, including the liver, harsh enzymatic and/or mechanical dissociation protocols can negatively affect the viability or the quality of the single-cell suspensions needed to comprehensively characterize this organ in health and disease.
This paper describes a robust and reproducible protocol for isolating nuclei from frozen, archived liver tissues. This method yields high-quality nuclei that are compatible with downstream, single-cell omics approaches, including single-nucleus RNA-seq, assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq), as well as multimodal omics (joint RNA-seq and ATAC-seq). This method has been successfully used for the isolation of nuclei from healthy and diseased human, mouse, and non-human primate frozen liver samples. This approach allows the unbiased isolation of all the major cell types in the liver and, therefore, offers a robust methodology for studying the liver at the single-cell resolution.

Here, we present a protocol for isolating nuclei from flash-frozen, archived liver tissues for single-nucleus RNA-seq, ATAC-seq, and joint multiomics (RNA-seq and ATAC-seq).

The liver is a complex and heterogenous tissue responsible for carrying out many critical physiological functions, such as the maintenance of energy ...

Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting

Samenvatting

Meer video's verkennen