This work was partially supported by NIH R00HD082686. We thank the Endocrine Society Summer Research Fellowship to H.S.Z. We also thank Dr. Yuan Kang for breeding and maintaining the mouse colony.

All performed animal experiments followed the protocols approved by the Institutional Animal Care and Use Committees (IACUC) at Auburn University.
NOTE: The following protocol uses one testis (about 100 mg) at P28 from Gli1-CreERT2; NuTRAP mice (Mus musculus). Volumes of reagents may need to be adjusted based on the types of samples and the number of tissues.
1. Tissue collection
<ol>
	<li>Euthanize the mice using a CO2 chamber, sanitize the abdomen surface with 70% ethanol.</li>
	<li>Open the lower abdomen with scissors and remove the testes.&#160;Use liquid nitrogen&#160;(LN2) to snap-freeze the testes immediately.</li>
	<li>Store samples in the vapor phase of LN2 until use.</li>
</ol>
2. Reagents and beads preparation
<ol>
	<li>Prepare the homogenization stock solution: Add 50 mM Tris (pH 7.4), 12 mM MgCl2, 100 mM KCl, 1% NP-40, and 1 mg/mL heparin. Store the solution at 4 &#176;C until use (up to 1 month).</li>
	<li>Prepare the homogenization working buffer from the stock solution (step 2.1) freshly before use: Add DTT (final concentration: 1 mM), cycloheximide (final concentration: 100 &#181;g/mL), recombinant ribonuclease (final concentration: 200 units/mL), and protease inhibitor cocktail (final concentration: 1x) to the homogenization stock solution to make the required amount of the homogenization working buffer. Store the freshly prepared working buffer on ice until use.</li>
	<li>Prepare the low-salt and the high-salt wash buffers:
	<ol>
		<li>To prepare low-salt wash buffer mix 50 mM Tris (pH 7.4), 12 mM MgCl2, 100 mM KCl, and 1% NP-40. Add DTT (final concentration: 1 mM) and cycloheximide (final concentration: 100 &#181;g/mL) before use.</li>
		<li>To prepare high-salt wash buffer mix 50 mM Tris (pH 7.4), 12 mM MgCl2, 300 mM KCl, 1% NP-40. Add DTT (final concentration: 2 mM) and Cycloheximide (final concentration: 100 &#181;g/mL) before use.</li>
	</ol>
	</li>
	<li>Prepare protein G beads (Table of Materials):
	<ol>
		<li>Each sample will need 50 &#181;L of protein G beads. Place the required amount of beads in a 1.5 mL centrifuge tube and separate the beads from the solution using a magnetic rack by leaving the tube on the rack for 30-60 s.</li>
		<li>Remove the supernatant by pipetting. Wash the beads three times with 1 mL of ice-cold low-salt wash buffer each time.</li>
	</ol>
	</li>
</ol>
3. Tissue lysis and homogenization
<ol>
	<li>Add 2 mL of ice-cold homogenization working buffer (freshly prepared from step 2.2) to a glass tissue grinder set. Quickly place the frozen sample into the grinder and homogenize the tissue with 30 strokes on ice using a loose pestle.</li>
	<li>Transfer the homogenate to a 2 mL round-bottom tube and centrifuge at 12,000 x g for 10 min at 4 &#176;C.</li>
	<li>Transfer the supernatant to a new 2 mL tube. Save 100 &#181;L to a 1.5 mL tube as the &#34;input&#34;.</li>
	<li>Incubate the supernatant in the 2 mL tube with the anti-GFP antibody (5 &#181;g/mL; 1:400) at 4 &#176;C on an end-over-end rotator (24 rpm) overnight.</li>
</ol>
4. Immunoprecipitation
<ol>
	<li>Transfer the homogenate/antibody mixture to a new 2 mL round-bottom tube containing the washed protein G beads from step 2.4. Incubate at 4 &#176;C on an end-over-end rotator (24 rpm) for 2 h.</li>
	<li>Separate the magnetic beads from the supernatant using a magnet rack. Save the supernatant as the &#34;negative fraction&#34;. The negative fraction contains (1) RNAs in EGFP-negative cells and (2) RNAs in EGFP-positive cells that are not bound to ribosomes.</li>
	<li>Add 1 mL of high-salt wash buffer to the beads and briefly vortex the tube to wash the beads. Place the tube in a magnet rack.</li>
	<li>Remove the wash buffer. Repeat the washing step two more times. The beads now contain the beads-ribosome-RNA complex from EGFP-positive cells.</li>
</ol>
5. RNA extraction
NOTE: The following steps are adapted from the RNA isolation kit (Table of Materials). Treat each fraction (i.e., input, positive, and negative) as an independent sample and isolate RNAs independently.
<ol>
	<li>Incubate the beads from step 4.4 with 50 &#181;L of Extraction Buffer (from the RNA isolation kit) in a thermomixer (42 &#176;C, 500 rpm) for 30 min to release RNAs from beads.</li>
	<li>Separate the beads with a magnet rack, transfer the supernatant which contains the beads-ribosome-RNA complex to a 1.5 mL tube.</li>
	<li>Centrifuge the tube at 3000 x g for 2 min, then pipette the supernatant to a new 1.5 mL tube. This tube contains the &#34;positive fraction&#34; of the TRAP step. 
	NOTE: For the input and the negative fractions, extract RNA from 25 &#181;L of samples using 1 mL of Extraction Buffer. Incubate in a thermomixer (42 &#176;C, 500 rpm) for 30 min.</li>
	<li>Pre-condition the RNA purification column: Pipette 250 &#181;L of Conditioning Buffer onto the purification column. Incubate for 5 min at room temperature (RT). Centrifuge the column at 16,000 x g for 1 min.</li>
	<li>Pipet&#160;equal volume of 70% EtOH into the&#160;supernatant from step 5.3 (around 50 &#181;L of 70% EtOH for the positive fraction and 1 mL of 70% EtOH for the input and the negative fractions). Mix well by pipetting up and down.</li>
	<li>Pipette the mixture into the column from step 5.4.</li>
	<li>Centrifuge the column at 100 x g for 2 min to allow RNA binding to the membrane in the column, then continue centrifuge at 16,000 x g for 30 s immediately. Discard the flow-through. 
	NOTE: For the input and the negative fractions, add 250 &#181;L of the mixture to the column each time. Repeat steps 5.6 and 5.7 until all mixtures are used.</li>
	<li>Pipette 100 &#181;L of Wash Buffer 1 (W1) into the column and centrifuge at 8,000 x g for 1 min. Discard the flow-through.</li>
	<li>Pipette 75 &#181;L of DNase solution mix directly into the purification column membrane. Incubate at RT for 15 min.</li>
	<li>Pipette 40 &#181;L of W1 into the column and centrifuge at 8,000 x g for 30 s. Discard the flow-through.</li>
	<li>Pipette 100 &#181;L of Wash Buffer 2 (W2) into the column and centrifuge at 8,000 x g for 1 min. Discard the flow-through.</li>
	<li>Pipette 100 &#181;L of W2 into the column and centrifuge at 16,000 x g for 2 min. Discard the flow-through. Re-centrifuge the same column at 16,000 x g for 1 min to remove all traces of wash buffer prior to the elution step.</li>
	<li>Transfer the column to a new 1.5 mL microcentrifuge tube.</li>
	<li>Pipette 12 &#181;L of RNase-free water directly onto the membrane of the purification column. The pipet tip should not touch the membrane. Incubate at RT for 1 min and centrifuge at 1000 x g for 1 min. Then continue centrifugation at 16,000 x g for 1 min to elute the RNA.</li>
</ol>
6. RNA concentration and quality
<ol>
	<li>Use a bioanalyzer to assess the quality and quantity of the extracted RNA10.</li>
</ol>
7. Storage and further analysis
<ol>
	<li>Store the RNA at -80 &#176;C (up to 1 year) until further analysis (e.g., microarray, quantitative PCR (qPCR), and RNA-seq, etc.). 
	NOTE: For details of the qPCR analysis, including cDNA synthesis, refer to Lyu et al.11. Primers for qPCR are listed in the Table of Materials.</li>
</ol>

<ol>
	<li>Yang, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+RNA+sequencing+reveals+dynamic+regulation+of+myocardial+noncoding+RNAs+in+failing+human+heart+and+remodeling+with+mechanical+circulatory+support.">Deep RNA sequencing reveals dynamic regulation of myocardial noncoding RNAs in failing human heart and remodeling with mechanical circulatory support.</a> Circulation. 129 (9), 1009-1021 (2014).</li><li>Soumillon, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+source+and+mechanisms+of+high+transcriptome+complexity+in+the+mammalian+testis.">Cellular source and mechanisms of high transcriptome complexity in the mammalian testis.</a> Cell Reports. 3 (6), 2179-2190 (2013).</li><li>Lake, B. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuronal+subtypes+and+diversity+revealed+by+single-nucleus+RNA+sequencing+of+the+human+brain.">Neuronal subtypes and diversity revealed by single-nucleus RNA sequencing of the human brain.</a> Science. 352 (6293), 1586-1590 (2016).</li><li>Heiman, M., Kulicke, R., Fenster, R. J., Greengard, P., Heintz, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+type-specific+mRNA+purification+by+translating+ribosome+affinity+purification+(TRAP).">Cell type-specific mRNA purification by translating ribosome affinity purification (TRAP).</a> Nature Protocols. 9 (6), 1282-1291 (2014).</li><li>Bertin, B., Renaud, Y., Aradhya, R., Jagla, K., Junion, G. J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TRAP-rc,+translating+ribosome+affinity+purification+from+rare+cell+populations+of+Drosophila+embryos.">TRAP-rc, translating ribosome affinity purification from rare cell populations of Drosophila embryos.</a> Journal of Visualized Experiments: JoVE. (103), e52985 (2015).</li><li>Thellmann, M., Andersen, T. G., Vermeer, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+ribosome+affinity+purification+(trap)+to+investigate+Arabidopsis+thaliana+root+development+at+a+cell+type-specific+scale.">Translating ribosome affinity purification (trap) to investigate Arabidopsis thaliana root development at a cell type-specific scale.</a> Journal of Visualized Experiments: JoVE. (159), e60919 (2020).</li><li>Moran, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+ribosome+affinity+purification+(TRAP)+for+RNA+isolation+from+endothelial+cells+in+vivo.">Translating ribosome affinity purification (TRAP) for RNA isolation from endothelial cells in vivo.</a> Journal of Visualized Experiments: JoVE. (147), e59624 (2019).</li><li>Roh, H. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+transcriptional+and+epigenomic+profiling+from+specific+cell+types+within+heterogeneous+tissues+in+vivo.">Simultaneous transcriptional and epigenomic profiling from specific cell types within heterogeneous tissues in vivo.</a> Cell Reports. 18 (4), 1048-1061 (2017).</li><li>Varjosalo, M., Taipale, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hedgehog:+functions+and+mechanisms.">Hedgehog: functions and mechanisms.</a> Genes &amp; Development. 22 (18), 2454-2472 (2008).</li><li>Mueller, O., Lightfoot, S., Schroeder, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+integrity+number+(RIN)-standardization+of+RNA+quality+control.">RNA integrity number (RIN)-standardization of RNA quality control.</a> Agilent Technologies. , 1-8 (2004).</li><li>Lyu, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-seq+reveals+sub-zones+in+mouse+adrenal+zona+fasciculata+and+the+sexually+dimorphic+responses+to+thyroid+hormone.">RNA-seq reveals sub-zones in mouse adrenal zona fasciculata and the sexually dimorphic responses to thyroid hormone.</a> Endocrinology. 161 (9), (2020).</li><li>King, P., Paul, A., Laufer, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shh+signaling+regulates+adrenocortical+development+and+identifies+progenitors+of+steroidogenic+lineages.">Shh signaling regulates adrenocortical development and identifies progenitors of steroidogenic lineages.</a> Proceedings of the National Academy of Sciences of the United States of America. 106 (50), 21185-21190 (2009).</li><li>Huang, C. C., Miyagawa, S., Matsumaru, D., Parker, K. L., Yao, H. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progenitor+cell+expansion+and+organ+size+of+mouse+adrenal+is+regulated+by+sonic+hedgehog.">Progenitor cell expansion and organ size of mouse adrenal is regulated by sonic hedgehog.</a> Endocrinology. 151 (3), 1119-1128 (2010).</li><li>Benton, L., Shan, L. -. X., Hardy, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+adult+Leydig+cells.">Differentiation of adult Leydig cells.</a> The Journal of Steroid Biochemistry and Molecular Biology. 53 (1-6), 61-68 (1995).</li><li>Monder, C., Hardy, M., Blanchard, R., Blanchard, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+aspects+of+11&#946;-hydroxysteroid+dehydrogenase.+Testicular+11&#946;-hydroxysteroid+dehydrogenase:+development+of+a+model+for+the+mediation+of+Leydig+cell+function+by+corticosteroids.">Comparative aspects of 11&#946;-hydroxysteroid dehydrogenase. Testicular 11&#946;-hydroxysteroid dehydrogenase: development of a model for the mediation of Leydig cell function by corticosteroids.</a> Steroids. 59 (2), 69-73 (1994).</li><li>Bitgood, M. J., Shen, L., McMahon, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sertoli+cell+signaling+by+Desert+hedgehog+regulates+the+male+germline.">Sertoli cell signaling by Desert hedgehog regulates the male germline.</a> Current Biology. 6 (3), 298-304 (1996).</li><li>Beverdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sox9-dependent+expression+of+Gstm6+in+Sertoli+cells+during+testis+development+in+mice.">Sox9-dependent expression of Gstm6 in Sertoli cells during testis development in mice.</a> Reproduction. 137 (3), 481 (2009).</li><li>Gross, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technologies+for+single-cell+isolation.">Technologies for single-cell isolation.</a> International Journal of Molecular Sciences. 16 (8), 16897-16919 (2015).</li><li>Ziegenhain, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+single-cell+RNA+sequencing+methods.">Comparative analysis of single-cell RNA sequencing methods.</a> Molecular Cell. 65 (4), 631-643 (2017).</li><li>Nguyen, Q. H., Pervolarakis, N., Nee, K., Kessenbrock, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+considerations+for+single-cell+rna+sequencing+approaches.">Experimental considerations for single-cell rna sequencing approaches.</a> Frontiers in Cell and Development Biology. 6, 108 (2018).</li><li>Chucair-Elliott, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+cell-specific+mouse+models+for+paired+epigenetic+and+transcriptomic+studies+of+microglia+and+astroglia.">Inducible cell-specific mouse models for paired epigenetic and transcriptomic studies of microglia and astroglia.</a> Communications Biology. 3 (1), 693 (2020).</li><li>Barsoum, I., Yao, H. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Redundant+and+differential+roles+of+transcription+factors+Gli1+and+Gli2+in+the+development+of+mouse+fetal+Leydig+cells.">Redundant and differential roles of transcription factors Gli1 and Gli2 in the development of mouse fetal Leydig cells.</a> Biology of Reproduction. 84 (5), 894-899 (2011).</li><li>Mori, H., Shimizu, D., Fukunishi, R., Christensen, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphometric+analysis+of+testicular+Leydig+cells+in+normal+adult+mice.">Morphometric analysis of testicular Leydig cells in normal adult mice.</a> The Anatomical Record. 204 (4), 333-339 (1982).</li></ol>

The authors declare no conflict of interest.

The usefulness of the whole-tissue transcriptome analysis could be dampened, especially when studying complex heterogeneous tissues. How to obtain cell-type-specific RNAs becomes an urgent need to unleash the powerful RNA-seq technique. The isolation of cell-type-specific RNAs usually relies on the collection of a specific type of cells using micromanipulation, fluorescent-activated cell sorting (FACS), or laser capture microdissection (LCM)18. Other modern high-throughput single-cell collection m...

High-throughput approaches, including RNA sequencing (RNA-seq) and microarray, have made it possible to interrogate gene expression profiles at the genome-wide level. For complex tissues such as the heart, brain, and testis, the cell-type-specific data will provide more details comparing the use of RNAs from the whole tissue1,2,3. To overcome the impact of cellular heterogeneity, the Translating Ribosome Affinity Purification (TRAP) method has been developed since early 2010s4. TRAP is able to isolate ribosome-bound RNAs from specific cell types without tissue dissociation. This method has been used for translatome (mRNAs that are being recruited to the ribosome for translation) analysis in different organisms, including targeting an extremely rare population of muscle cells in Drosophila embryos5, studying different root cells in the model plant Arabidopsis thaliana6, and performing transcriptome analysis of endothelial cells in mammals7.
TRAP requires a genetic modification to tag the ribosome of a model organism. Evan Rosen and colleagues recently developed a mouse model called Nuclear tagging and Translating Ribosome Affinity Purification (NuTRAP) mouse8, which has been available through the Jackson Laboratory since 2017. By crossing with a Cre mouse line, researchers can use this NuTRAP mouse model to isolate ribosome-bound RNAs and cell nuclei from Cre-expressing cells without cell sorting. In Cre-expressing cells that also carry the NuTRAP allele, the EGFP/L10a tagged ribosome allows the isolation of translating mRNAs using affinity pulldown assays. At the same cell, the biotin ligase recognition peptide (BLRP)-tagged nuclear membrane, which is also mCherry positive, allows the nuclear isolation by using affinity- or fluorescence-based purification. The same research team also generated a similar mouse line in which the nuclear membrane is labeled only with mCherry without biotin8. These two genetically modified mouse lines give access to characterize paired epigenomic and transcriptomic profiles of specific types of cells in interest.
The hedgehog (Hh) signaling pathway plays a critical role in tissue development9. GLI1, a member of the GLI family, acts as a transcriptional activator and mediates the Hh signaling. Gli1+ cells can be found in many hormone-secreting organs, including the adrenal gland and the testis. To isolate cell-type-specific DNAs and RNAs from Gli1+ cells using the NuTRAP mouse model, Gli1-CreERT2 mice were crossed with the NuTRAP mice. Shh-CreERT2 mice were also crossed with the NuTRAP mice aim to isolate sonic hedgehog (Shh) expressing cells. The following protocol shows how to use Gli1-CreERT2;NuTRAP mice to isolate ribosome-bound RNAs from Gli1+ cells in adult mouse testes.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Actb</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>ATGGAGGGGAATACAGCCC / TTCTTTGCAGCTCCTTCGTT (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>Bioanalyzer</td>
			<td>Agilent</td>
			<td>2100 Bioanalyzer Instrument</td>
			<td></td>
		</tr>
		<tr>
			<td>cOmplete Mini EDTA-free Protease Inhibitor Cocktail</td>
			<td>Millipore</td>
			<td>11836170001</td>
			<td></td>
		</tr>
		<tr>
			<td>cycloheximide</td>
			<td>Millipore</td>
			<td>239764-100MG</td>
			<td></td>
		</tr>
		<tr>
			<td>Cyp11a1</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>CTGCCTCCAGACTTCTTTCG / TTCTTGAAGGGCAGCTTGTT (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>dNTP</td>
			<td>Thermo Fisher Scientific</td>
			<td>R0191</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT, Dithiothreitol</td>
			<td>Thermo Fisher Scientific</td>
			<td>P2325</td>
			<td></td>
		</tr>
		<tr>
			<td>DynaMag-2 magnet</td>
			<td>Thermo Fisher Scientific</td>
			<td>12321D</td>
			<td></td>
		</tr>
		<tr>
			<td>Falcon tubes 15 mL</td>
			<td>VWR</td>
			<td>89039-666</td>
			<td></td>
		</tr>
		<tr>
			<td>GFP antibody</td>
			<td>Abcam</td>
			<td>ab290</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass grinder set</td>
			<td>DWK Life Sciences</td>
			<td>357542</td>
			<td></td>
		</tr>
		<tr>
			<td>heparin</td>
			<td>BEANTOWN CHEMICAL</td>
			<td>139975-250MG</td>
			<td></td>
		</tr>
		<tr>
			<td>Hsd3b</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>GACAGGAGCAGGAGGGTTTGTG / CACTGGGCATCCAGAATGTCTC (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>KCl</td>
			<td>Biosciences</td>
			<td>R005</td>
			<td></td>
		</tr>
		<tr>
			<td>MgCl2</td>
			<td>Biosciences</td>
			<td>R004</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge tubes 2 mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>02-707-354</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse Clariom S Assay microarrays</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td>Microarray service</td>
		</tr>
		<tr>
			<td>NP-40</td>
			<td>Millipore</td>
			<td>492018-50 Ml</td>
			<td></td>
		</tr>
		<tr>
			<td>oligo (dT)20</td>
			<td>Invitrogen</td>
			<td>18418020</td>
			<td></td>
		</tr>
		<tr>
			<td>PicoPure RNA Isolation Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>KIT0204</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein G Dynabead</td>
			<td>Thermo Fisher Scientific</td>
			<td>10003D</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase-free water</td>
			<td>growcells</td>
			<td>NUPW-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>RNaseOUT Recombinant Ribonuclease Inhibitor</td>
			<td>Thermo Fisher Scientific</td>
			<td>10777019</td>
			<td></td>
		</tr>
		<tr>
			<td>Sox9</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>TGAAGAACGGACAAGCGGAG / CTGAGATTGCCCAGAGTGCT (forward primer/reverse primer</td>
		</tr>
		<tr>
			<td>Superscript IV reverse transcriptase</td>
			<td>Invitrogen</td>
			<td>18090050</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green PCR Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>4309155</td>
			<td></td>
		</tr>
		<tr>
			<td>Sycp3</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>GAATGTGTTGCAGCAGTGGGA /GAACTGCTCGTGTATCTGTTTGA (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>Tris</td>
			<td>Alfa Aesar</td>
			<td>J62848</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolate cell-type-specific rnas from snap-frozen heterogeneous tissue samples without cell sorting

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids potential pitfalls caused by the heterogeneity of tissues and unleashes the powerful transcriptome analysis. The protocol described here demonstrates how to use the Translating Ribosome Affinity Purification (TRAP) method to isolate ribosome-bound RNAs from a small amount of EGFP-expressing cells in a complex tissue without cell sorting. This protocol is suitable for isolating cell-type-specific RNAs using the recently available NuTRAP mouse model and could also be used to isolate RNAs from any EGFP-expressing cells.

Gli1-CreERT2 mouse (Jackson Lab Stock Number: 007913) were first crossed with the NuTRAP reporter mouse (Jackson Lab Stock Number: 029899) to generate double-mutant mice. Mice carrying both genetically engineered gene alleles (i.e., Gli1-CreERT2&#160;and NuTRAP) were injected with tamoxifen once a day, every other day, for three injections. Tissue samples were collected on the 7th day after the 1st day of the injection. Immunofluorescence analysis sho...

Watch this Scientific Journal Video about Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting at JoVE.com

Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting

This protocol aims to isolate cell-type-specific translating ribosomal mRNAs using the NuTRAP mouse model.

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids ...

isolate-cell-type-specific-rnas-from-snap-frozen-heterogeneous-tissue

Research

JoVE Journal

Biology

2.1K Views.  Auburn University. This protocol aims to isolate cell-type-specific translating ribosomal mRNAs using the NuTRAP mouse model.

Video: Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting

Actin Co-Sedimentation Assay; for the Analysis of Protein Binding to F-Actin

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates tension and helps maintains cellular shape.  Although the actin cytoskeleton is a rigid structure, it is a dynamic structure that is constantly remodeling.  A number of proteins can bind to the actin cytoskeleton.  The binding of a particular protein to F-actin is often desired to support cell biological observations or to further understand dynamic processes due to remodeling of the actin cytoskeleton. The actin co-sedimentation assay is an in vitro assay routinely used to analyze the binding of specific proteins or protein domains with F-actin.  The basic principles of the assay involve an incubation of the protein of interest (full length or domain of) with F-actin, ultracentrifugation step to pellet F-actin and analysis of the protein co-sedimenting with F-actin.  Actin co-sedimentation assays can be designed accordingly to measure actin binding affinities and in competition assays.

Proteins bind to filamentous actin (F-actin) through distinct actin binding modules. In this video we demonstrate the procedure of actin co-sedimentation, which is an in vitro assay routinely used to analyze proteins or specific domains that bind F-actin.

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates ...

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called photoreceptors to sense and adapt to light. The red/far-red light-absorbing phytochrome photoreceptors have been studied extensively. Phytochromes exist as a family of proteins with distinct and overlapping functions in all higher plant systems in which they have been studied1. Phytochrome-mediated light responses, which range from seed germination through flowering and senescence, are often localized to specific plant tissues or organs2. Despite the discovery and elucidation of individual and redundant phytochrome functions through mutational analyses, conclusive reports on distinct sites of photoperception and the molecular mechanisms of localized pools of phytochromes that mediate spatial-specific phytochrome responses are limited. We designed experiments based on the hypotheses that specific sites of phytochrome photoperception regulate tissue- and organ-specific aspects of photomorphogenesis, and that localized phytochrome pools engage distinct subsets of downstream target genes in cell-to-cell signaling. We developed a biochemical approach to selectively reduce functional phytochromes in an organ- or tissue-specific manner within transgenic plants. Our studies are based on a bipartite enhancer-trap approach that results in transactivation of the expression of a gene under control of the Upstream Activation Sequence (UAS) element by the transcriptional activator GAL43. The biliverdin reductase (BVR) gene under the control of the UAS is silently maintained in the absence of GAL4 transactivation in the UAS-BVR parent4. Genetic crosses between a UAS-BVR transgenic line and a GAL4-GFP enhancer trap line result in specific expression of the BVR gene in cells marked by GFP expression4. BVR accumulation in Arabidopsis plants results in phytochrome chromophore deficiency in planta5-7. Thus, transgenic plants that we have produced exhibit GAL4-dependent activation of the BVR gene, resulting in the biochemical inactivation of phytochrome, as well as GAL4-dependent GFP expression. Photobiological and molecular genetic analyses of BVR transgenic lines are yielding insight into tissue- and organ-specific phytochrome-mediated responses that have been associated with corresponding sites of photoperception4, 7, 8. Fluorescence Activated Cell Sorting (FACS) of GFP-positive, enhancer-trap-induced BVR-expressing plant protoplasts coupled with cell-type-specific gene expression profiling through microarray analysis is being used to identify putative downstream target genes involved in mediating spatial-specific phytochrome responses. This research is expanding our understanding of sites of light perception, the mechanisms through which various tissues or organs cooperate in light-regulated plant growth and development, and advancing the molecular dissection of complex phytochrome-mediated cell-to-cell signaling cascades.

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

The molecular basis of spatial-specific phytochrome responses is being investigated using transgenic plants that exhibit tissue- and organ-specific phytochrome deficiencies. The isolation of specific cells exhibiting induced phytochrome chromophore depletion by Fluorescence-Activated Cell Sorting followed by microarray analyses is being utilized to identify genes involved in spatial-specific phytochrome responses.

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

Heterokaryon Technique for Analysis of Cell Type-specific Localization

A significant number of proteins are regulated by subcellular trafficking or nucleocytolasmic shuttling. These proteins display a diverse array of cellular functions including nuclear import/export of RNA and protein, transcriptional regulation, and apoptosis. Interestingly, major cellular reorganizations including cell division, differentiation and transformation, often involve such activities3,4,8,10. The detailed study of these proteins and their respective regulatory mechanisms can be challenging as the stimulation for these localization changes can be elusive, and the movements themselves can be quite dynamic and difficult to track. Studies involving cellular oncogenesis, for example, continue to benefit from understanding pathways and protein activities that differ between normal primary cells and transformed cells6,7,11,12. As many proteins show altered localization during transformation or as a result of transformation, methods to efficiently characterize these proteins and the pathways in which they participate stand to improve the understanding of oncogenesis and open new areas for drug targeting.
Here we present a method for the analysis of protein trafficking and shuttling activity between primary and transformed mammalian cells. This method combines the generation of heterokaryon fusions with fluorescence microscopy to provide a flexible protocol that can be used to detect steady-state or dynamic protein localizations. As shown in Figure 1, two separate cell types are transiently transfected with plasmid constructs bearing a fluoroprotein gene attached to the gene of interest. After expression, the cells are fused using polyethylene glycol, and protein localizations may then be imaged using a variety of methods. The protocol presented here is a fundamental approach to which specialized techniques may be added.

A flexible and efficient method for the characterization of cell type-specific protein localization and nucleocytoplasmic shuttling is described. This heterokaryon approach uses fluorescently-labeled fusion proteins to image protein localizations after cell fusion. The protocol is amenable to steady-state localizations or more dynamic determinations based on live cell imaging.

A significant number of proteins are regulated by subcellular trafficking or nucleocytolasmic shuttling.  These proteins display a diverse array of ...

Genotyping of Plant and Animal Samples without Prior DNA Purification

The Direct PCR approach facilitates PCR amplification directly from small amounts of unpurified samples, and is demonstrated here for several plant and animal tissues (Figure 1). Direct PCR is based on specially engineered Thermo Scientific Phusion and Phire DNA Polymerases, which include a double-stranded DNA binding domain that gives them unique properties such as high tolerance of inhibitors.
PCR-based target DNA detection has numerous applications in plant research, including plant genotype analysis and verification of transgenes. PCR from plant tissues traditionally involves an initial DNA isolation step, which may require expensive or toxic reagents. The process is time consuming and increases the risk of cross contamination1, 2. Conversely, by using Thermo Scientific Phire Plant Direct PCR Kit the target DNA can be easily detected, without prior DNA extraction. In the model demonstrated here, an example of derived cleaved amplified polymorphic sequence analysis (dCAPS)3,4 is performed directly from Arabidopsis plant leaves. dCAPS genotyping assays can be used to identify single nucleotide polymorphisms (SNPs) by SNP allele-specific restriction endonuclease digestion3. 
Some plant samples tend to be more challenging when using Direct PCR methods as they contain components that interfere with PCR, such as phenolic compounds. In these cases, an additional step to remove the compounds is traditionally required2,5. Here, this problem is overcome by using a quick and easy dilution protocol followed by Direct PCR amplification (Figure 1). Fifteen year-old oak leaves are used as a model for challenging plants as the specimen contains high amounts of phenolic compounds including tannins. 
Gene transfer into mice is broadly used to study the roles of genes in development, physiology and human disease. The use of these animals requires screening for the presence of the transgene, usually with PCR. Traditionally, this involves a time consuming DNA isolation step, during which DNA for PCR analysis is purified from ear, tail or toe tissues6,7. However, with the Thermo Scientific Phire Animal Tissue Direct PCR Kit transgenic mice can be genotyped without prior DNA purification. In this protocol transgenic mouse genotyping is achieved directly from mouse ear tissues, as demonstrated here for a challenging example where only one primer set is used for amplification of two fragments differing greatly in size.

The Direct PCR approach presented here facilitates PCR amplification directly from small amounts of unpurified plant and animal tissue.

The Direct PCR approach facilitates PCR amplification directly from small amounts of unpurified samples, and is demonstrated here for several plant and ...

Optimized Staining and Proliferation Modeling Methods for Cell Division Monitoring using Cell Tracking Dyes

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of different cell types in vitro and in vivo.1-5 Although there are literally thousands of publications using such dyes, some of the most commonly encountered cell tracking applications include monitoring of:
<ol>
	<li>stem and progenitor cell quiescence, proliferation and/or differentiation6-8</li>
	<li>antigen-driven membrane transfer9 and/or precursor cell proliferation3,4,10-18 and</li>
	<li>immune regulatory and effector cell function1,18-21.</li>
</ol>
Commercially available cell tracking dyes vary widely in their chemistries and fluorescence properties but the great majority fall into one of two classes based on their mechanism of cell labeling. "Membrane dyes", typified by PKH26, are highly lipophilic dyes that partition stably but non-covalently into cell membranes1,2,11. "Protein dyes", typified by CFSE, are amino-reactive dyes that form stable covalent bonds with cell proteins4,16,18. Each class has its own advantages and limitations. The key to their successful use, particularly in multicolor studies where multiple dyes are used to track different cell types, is therefore to understand the critical issues enabling optimal use of each class2-4,16,18,24.
The protocols included here highlight three common causes of poor or variable results when using cell-tracking dyes. These are:
<ol>
	<li>Failure to achieve bright, uniform, reproducible labeling. This is a necessary starting point for any cell tracking study but requires attention to different variables when using membrane dyes than when using protein dyes or equilibrium binding reagents such as antibodies.</li>
	<li>Suboptimal fluorochrome combinations and/or failure to include critical compensation controls. Tracking dye fluorescence is typically 102 - 103 times brighter than antibody fluorescence. It is therefore essential to verify that the presence of tracking dye does not compromise the ability to detect other probes being used.</li>
	<li>Failure to obtain a good fit with peak modeling software. Such software allows quantitative comparison of proliferative responses across different populations or stimuli based on precursor frequency or other metrics. Obtaining a good fit, however, requires exclusion of dead/dying cells that can distort dye dilution profiles and matching of the assumptions underlying the model with characteristics of the observed dye dilution profile.</li>
</ol>
Examples given here illustrate how these variables can affect results when using membrane and/or protein dyes to monitor cell proliferation.

Successful use of cell tracking dyes to monitor immune cell function and proliferation involves several critical steps. We describe methods for: 1) obtaining bright, uniform, reproducible label-ing with membrane dyes; 2) selecting fluorochromes and data acquisition conditions; and 3) choosing a model to quantify cell proliferation based on dye dilution.

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of ...

Isolation of Small Noncoding RNAs from Human Serum

The analysis of RNA and its expression is a common feature in many laboratories. Of significance is the emergence of small RNAs like microRNAs, which are found in mammalian cells. These small RNAs are potent gene regulators controlling vital pathways such as growth, development and death and much interest has been directed at their expression in bodily fluids. This is due to their dysregulation in human diseases such as cancer and their potential application as serum biomarkers. However, the analysis of miRNA expression in serum may be problematic. In most cases the amount of serum is limiting and serum contains low amounts of total RNA, of which small RNAs only constitute 0.4-0.5%1. Thus the isolation of sufficient amounts of quality RNA from serum is a major challenge to researchers today. In this technical paper, we demonstrate a method which uses only 400 &#181;l of human serum to obtain sufficient RNA for either DNA arrays or qPCR analysis. The advantages of this method are its simplicity and ability to yield high quality RNA. It requires no specialized columns for purification of small RNAs and utilizes general reagents and hardware found in common laboratories. Our method utilizes a Phase Lock Gel to eliminate phenol contamination while at the same time yielding high quality RNA. We also introduce an additional step to further remove all contaminants during the isolation step. This protocol is very effective in isolating yields of total RNA of up to 100 ng/&#181;l from serum but can also be adapted for other biological tissues.

This protocol describes a method for extracting small RNAs from human serum. We have used this method to isolate microRNAs from cancer serum for use in DNA arrays and also singleplex quantitative PCR. The protocol utilizes phenol and guanidinium thiocyanate reagents with modifications to yield high quality RNA.

The analysis of RNA and its expression is a common feature in many laboratories. Of significance is the emergence of small RNAs like microRNAs, which are ...

Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model

Mesenchymal stem cells (MSCs) are the main cell source for cell-based therapy. MSCs from articular cavity synovial fluid could potentially be used for cartilage tissue engineering. MSCs from synovial fluid (SF-MSCs) have been considered promising candidates for articular regeneration, and their potential therapeutic benefit has made them an important research topic of late. SF-MSCs from the knee cavity of the New Zealand white rabbit can be employed as an optimized translational model to assess human regenerative medicine. By means of CD90-based magnetic activated cell sorting (MACS) technologies, this protocol successfully obtains rabbit SF-MSCs (rbSF-MSCs) from this rabbit model and further fully demonstrates the MSC phenotype of these cells by inducing them to differentiate to osteoblasts, adipocytes, and chondrocytes. Therefore, this approach can be applied in cell biology research and tissue engineering using simple equipment and procedures.

This article presents a simple and economic protocol for the straightforward isolation and purification of mesenchymal stem cells from New Zealand white rabbit synovial fluid.

Mesenchymal stem cells (MSCs) are the main cell source for cell-based therapy. MSCs from articular cavity synovial fluid could potentially be used for ...

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological functions have been extensively studied. Indeed, the advent of next-generation deep sequencing and chromatin immunoprecipitation (ChIP) via specific histone modification antibodies has revolutionized our view of epigenetic regulation across the genome. Conversely, tissues typically consist of diverse cell types, and their complex mixture poses analytic challenges to investigating the epigenome in a particular cell type. To address the cell type-specific chromatin state in a genome-wide manner, we recently developed tandem chromatin immunoprecipitation sequencing (tChIP-Seq), which is based on the selective purification of chromatin by tagged core histone proteins from cell types of interest, followed by ChIP-Seq. The goal of this protocol is the introduction of best practices of tChIP-Seq. This technique provides a versatile tool for tissue-specific epigenome investigation in diverse histone modifications and model organisms.

We describe a step-by-step protocol for tandem chromatin immunoprecipitation sequencing (tChIP-Seq) that enables the analysis of cell-type-specific genome-wide histone modification.

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological ...

Cell Type-specific Gene Expression Profiling in the Mouse Liver

Liver repopulation after injury is a crucial feature of mammals which prevents immediate organ failure and death after exposure of environmental toxins. A deeper understanding of the changes in gene expression that occur during repopulation could help identify therapeutic targets to promote the restoration of liver function in the setting of injuries. Nonetheless, methods to isolate specifically the repopulating hepatocytes are inhibited by a lack of cell markers, limited cell numbers, and the fragility of these cells. The development of translating ribosome affinity purification (TRAP) technology in conjunction with the Fah-/- mouse model to recapitulate repopulation in the setting of liver injury allows gene expression profiling of the repopulating hepatocytes. With TRAP, cell type-specific translating mRNA is rapidly and efficiently isolated. We developed a method that utilizes TRAP with affinity-based isolation of translating mRNA from hepatocytes that selectively express the green fluorescent protein (GFP)-tagged ribosomal protein (RP), GFP:RPL10A. TRAP circumvents the long time period required for fluorescence-activated cell sorting that could change the gene expression profile. Furthermore, since only the repopulating hepatocytes express the GFP:RPL10A fusion protein, the isolated mRNA is devoid of contamination from the surrounding injured hepatocytes and other cell types in the liver. The affinity-purified mRNA is of high quality and allows downstream PCR- or high-throughput sequencing-based analysis of gene expression.

Translating ribosome affinity purification (TRAP) enables rapid and efficient isolation of cell type-specific translating mRNA. Here, we demonstrate a method that combines hydrodynamic tail-vein injection in a mouse model of liver repopulation and TRAP to examine the expression profile of repopulating hepatocytes.

Liver repopulation after injury is a crucial feature of mammals which prevents immediate organ failure and death after exposure of environmental toxins. A ...

Immunophenotyping and Cell Sorting of Human MKs from Human Primary Sources or Differentiated In Vitro from Hematopoietic Progenitors

Megakaryocyte (MK) differentiation encompasses a number of endomitotic cycles that result in a highly polyploid (reaching even&#160;&#62;64N) and extremely large cell (40-60 &#181;m). As opposed to the fast-increasing knowledge in megakaryopoiesis at the cell biology and molecular level, the characterization of megakaryopoiesis by flow cytometry is limited to the identification of mature MKs using lineage-specific surface markers, while earlier MK differentiation stages remain unexplored. Here, we present an immunophenotyping strategy that allows the identification of successive MK differentiation stages, with increasing ploidy status, in human primary sources or in vitro cultures with a panel integrating MK specific and non-specific surface markers. Despite its size and fragility, MKs can be immunophenotyped using the above-mentioned panel and enriched by fluorescence-activated cell sorting under specific conditions of pressure and nozzle diameter. This approach facilitates multi-Omics studies, with the aim to better understand the complexity of megakaryopoiesis and platelet production in humans. A better characterization of megakaryopoiesis may pose fundamental in the diagnosis or prognosis of lineage-related pathologies and malignancy.

Immunophenotyping and Cell Sorting of Human MKs from Human Primary Sources or Differentiated In Vitro from Hematopoietic Progenitors

Here, we present an immunophenotyping strategy for the characterization of megakaryocyte differentiation, and show how that strategy allows the sorting of megakaryocytes at different stages with a fluorescence-activated cell sorter. The methodology can be applied to human primary tissues, but also to megakaryocytes generated in culture in vitro.