The data of the S1PRs-Gi complex were harvested at the West China Cryo-EM Center in Sichuan University and Cryo-EM Center at the Southern University of Science and Technology (SUSTech) and processed at Duyu High-Performance Computing Center in Sichuan University. This work was supported by the Natural Science Foundation of China (32100965 to L.C., 32100988 to W.Y., 31972916 to Z.S.) and the full-time Postdoctoral Research Fund of Sichuan University (2021SCU12003 to L.C.)

<ol><li>Verstockt, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sphingosine+1-phosphate+modulation+and+immune+cell+trafficking+in+inflammatory+bowel+disease%5BTitle%5D)+AND+%22Nature+Reviews%3A+Gastroenterology+%26+Hepatology%22%5BJournal%5D)">Sphingosine 1-phosphate modulation and immune cell trafficking in inflammatory bowel disease.</a> Nature Reviews: Gastroenterology & Hepatology. , 1-16 (2022).</li>
<li>Rosen, H., Stevens, R. C., Hanson, M., Roberts, E., Oldstone, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sphingosine-1-phosphate+and+its+receptors%3A+structure%2C+signaling%2C+and+influence%5BTitle%5D)+AND+%22Annual+Review+of+Biochemistry%22%5BJournal%5D)">Sphingosine-1-phosphate and its receptors: structure, signaling, and influence.</a> Annual Review of Biochemistry. 82, 637-662 (2013).</li>
<li>Cartier, A., Hla, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sphingosine+1-phosphate%3A+Lipid+signaling+in+pathology+and+therapy%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Sphingosine 1-phosphate: Lipid signaling in pathology and therapy.</a> Science. 366 (6463), 5551(2019).</li>
<li>Jozefczuk, E., Guzik, T. J., Siedlinski, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Significance+of+sphingosine-1-phosphate+in+cardiovascular+physiology+and+pathology%5BTitle%5D)+AND+%22Pharmacological+Research%22%5BJournal%5D)">Significance of sphingosine-1-phosphate in cardiovascular physiology and pathology.</a> Pharmacological Research. 156, 104793(2020).</li>
<li>Kihara, Y., Maceyka, M., Spiegel, S., Chun, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Lysophospholipid+receptor+nomenclature+review%3A+IUPHAR+Review+8%5BTitle%5D)+AND+%22British+Journal+of+Pharmacology%22%5BJournal%5D)">Lysophospholipid receptor nomenclature review: IUPHAR Review 8.</a> British Journal of Pharmacology. 171 (15), 3575-3594 (2014).</li>
<li>Bryan, A. M., Del Poeta, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sphingosine-1-phosphate+receptors+and+innate+immunity%5BTitle%5D)+AND+%22Cellular+Microbiology%22%5BJournal%5D)">Sphingosine-1-phosphate receptors and innate immunity.</a> Cellular Microbiology. 20 (5), 12836(2018).</li>
<li>Pelletier, D., Hafler, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fingolimod+for+multiple+sclerosis%5BTitle%5D)+AND+%22New+England+Journal+of+Medicine%22%5BJournal%5D)">Fingolimod for multiple sclerosis.</a> New England Journal of Medicine. 366 (4), 339-347 (2012).</li>
<li>Obinata, H., Hla, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sphingosine+1-phosphate+and+inflammation%5BTitle%5D)+AND+%22International+Immunology%22%5BJournal%5D)">Sphingosine 1-phosphate and inflammation.</a> International Immunology. 31 (9), 617-625 (2019).</li>
<li>Pyne, N. J., Pyne, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sphingosine+1-phosphate+and+cancer%5BTitle%5D)+AND+%22Nature+Reviews%3A+Cancer%22%5BJournal%5D)">Sphingosine 1-phosphate and cancer.</a> Nature Reviews: Cancer. 10 (7), 489-503 (2010).</li>
<li>Abu-Farha, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+role+of+lipid+metabolism+in+COVID-19+virus+infection+and+as+a+drug+target%5BTitle%5D)+AND+%22International+Journal+of+Molecular+Sciences%22%5BJournal%5D)">The role of lipid metabolism in COVID-19 virus infection and as a drug target.</a> International Journal of Molecular Sciences. 21 (10), 3544(2020).</li>
<li>Chun, J., Kihara, Y., Jonnalagadda, D., Blaho, V. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fingolimod%3A+lessons+learned+and+new+opportunities+for+treating+Multiple+Sclerosis+and+other+disorders%5BTitle%5D)+AND+%22Annual+Review+of+Pharmacology+and+Toxicology%22%5BJournal%5D)">Fingolimod: lessons learned and new opportunities for treating Multiple Sclerosis and other disorders.</a> Annual Review of Pharmacology and Toxicology. 59, 149-170 (2019).</li>
<li>Murakami, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sphingosine+1-phosphate+%28S1P%29+regulates+vascular+contraction+via+S1P3+receptor%3A+investigation+based+on+a+new+S1P3+receptor+antagonist%5BTitle%5D)+AND+%22Molecular+Pharmacology%22%5BJournal%5D)">Sphingosine 1-phosphate (S1P) regulates vascular contraction via S1P3 receptor: investigation based on a new S1P3 receptor antagonist.</a> Molecular Pharmacology. 77 (4), 704-713 (2010).</li>
<li>Cao, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Siponimod+for+multiple+sclerosis%5BTitle%5D)+AND+%22Cochrane+Database+of+Systematic+Reviews%22%5BJournal%5D)">Siponimod for multiple sclerosis.</a> Cochrane Database of Systematic Reviews. 11, (2021).</li>
<li>Scott, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Siponimod%3A+a+review+in+secondary+progressive+Multiple+Sclerosis%5BTitle%5D)+AND+%22CNS+Drugs%22%5BJournal%5D)">Siponimod: a review in secondary progressive Multiple Sclerosis.</a> CNS Drugs. 34 (11), 1191-1200 (2020).</li>
<li>Lamb, Y. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ozanimod%3A+first+approval%5BTitle%5D)+AND+%22Drugs%22%5BJournal%5D)">Ozanimod: first approval.</a> Drugs. 80 (8), 841-848 (2020).</li>
<li>Scott, F. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ozanimod+%28RPC1063%29+is+a+potent+sphingosine-1-phosphate+receptor-1+%28S1P1%29+and+receptor-5+%28S1P5%29+agonist+with+autoimmune+disease-modifying+activity%5BTitle%5D)+AND+%22British+Journal+of+Pharmacology%22%5BJournal%5D)">Ozanimod (RPC1063) is a potent sphingosine-1-phosphate receptor-1 (S1P1) and receptor-5 (S1P5) agonist with autoimmune disease-modifying activity.</a> British Journal of Pharmacology. 173 (11), 1778-1792 (2016).</li>
<li>McGowan, E. M., Haddadi, N., Nassif, N. T., Lin, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Targeting+the+SphK-S1P-SIPR+pathway+as+a+potential+therapeutic+approach+for+COVID-19%5BTitle%5D)+AND+%22International+Journal+of+Molecular+Sciences%22%5BJournal%5D)">Targeting the SphK-S1P-SIPR pathway as a potential therapeutic approach for COVID-19.</a> International Journal of Molecular Sciences. 21 (19), 7189(2020).</li>
<li>O'Sullivan, C., Dev, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+structure+and+function+of+the+S1P1+receptor%5BTitle%5D)+AND+%22Trends+in+Pharmacological+Sciences%22%5BJournal%5D)">The structure and function of the S1P1 receptor.</a> Trends in Pharmacological Sciences. 34 (7), 401-412 (2013).</li>
<li>Liao, M., Cao, E., Julius, D., Cheng, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structure+of+the+TRPV1+ion+channel+determined+by+electron+cryo-microscopy%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Structure of the TRPV1 ion channel determined by electron cryo-microscopy.</a> Nature. 504 (7478), 107-112 (2013).</li>
<li>Bai, X. C., McMullan, G., Scheres, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((How+cryo-EM+is+revolutionizing+structural+biology%5BTitle%5D)+AND+%22Trends+in+Biochemical+Sciences%22%5BJournal%5D)">How cryo-EM is revolutionizing structural biology.</a> Trends in Biochemical Sciences. 40 (1), 49-57 (2015).</li>
<li>Murata, K., Wolf, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cryo-electron+microscopy+for+structural+analysis+of+dynamic+biological+macromolecules%5BTitle%5D)+AND+%22Biochimica+et+Biophysica+Acta+General+Subjects%22%5BJournal%5D)">Cryo-electron microscopy for structural analysis of dynamic biological macromolecules.</a> Biochimica et Biophysica Acta General Subjects. 1862 (2), 324-334 (2018).</li>
<li>Zhang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cryo-EM+structure+of+an+activated+GPCR-G+protein+complex+in+lipid+nanodiscs%5BTitle%5D)+AND+%22Nature+Structural+%26+Molecular+Biology%22%5BJournal%5D)">Cryo-EM structure of an activated GPCR-G protein complex in lipid nanodiscs.</a> Nature Structural & Molecular Biology. 28 (3), 258-267 (2021).</li>
<li>Renaud, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cryo-EM+in+drug+discovery%3A+achievements%2C+limitations+and+prospects%5BTitle%5D)+AND+%22Nature+Reviews%3A+Drug+Discovery%22%5BJournal%5D)">Cryo-EM in drug discovery: achievements, limitations and prospects.</a> Nature Reviews: Drug Discovery. 17 (7), 471-492 (2018).</li>
<li>Ishchenko, A., Gati, C., Cherezov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structural+biology+of+G+protein-coupled+receptors%3A+new+opportunities+from+XFELs+and+cryoEM%5BTitle%5D)+AND+%22Current+Opinion+in+Structural+Biology%22%5BJournal%5D)">Structural biology of G protein-coupled receptors: new opportunities from XFELs and cryoEM.</a> Current Opinion in Structural Biology. 51, 44-52 (2018).</li>
<li>Yang, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((G+protein-coupled+receptors%3A+structure-+and+function-based+drug+discovery%5BTitle%5D)+AND+%22Signal+Transduction+and+Targeted+Therapy%22%5BJournal%5D)">G protein-coupled receptors: structure- and function-based drug discovery.</a> Signal Transduction and Targeted Therapy. 6 (1), 7(2021).</li>
<li>Yuan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structures+of+signaling+complexes+of+lipid+receptors+S1PR1+and+S1PR5+reveal+mechanisms+of+activation+and+drug+recognition%5BTitle%5D)+AND+%22Cell+Research%22%5BJournal%5D)">Structures of signaling complexes of lipid receptors S1PR1 and S1PR5 reveal mechanisms of activation and drug recognition.</a> Cell Research. 31 (12), 1263-1274 (2021).</li>
<li>Zhao, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structural+insights+into+sphingosine-1-phosphate+recognition+and+ligand+selectivity+of+S1PR3-Gi+signaling+complexes%5BTitle%5D)+AND+%22Cell+Research%22%5BJournal%5D)">Structural insights into sphingosine-1-phosphate recognition and ligand selectivity of S1PR3-Gi signaling complexes.</a> Cell Research. 32 (2), 218-221 (2022).</li>
<li>Xu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structural+basis+of+sphingosine-1-phosphate+receptor+1+activation+and+biased+agonism%5BTitle%5D)+AND+%22Nature+Chemical+Biology%22%5BJournal%5D)">Structural basis of sphingosine-1-phosphate receptor 1 activation and biased agonism.</a> Nature Chemical Biology. 18, 281-288 (2022).</li>
<li>Liu, Y. F., Ghahremani, M. H., Rasenick, M. M., Jakobs, K. H., Albert, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Stimulation+of+cAMP+synthesis+by+Gi-coupled+receptors+upon+ablation+of+distinct+Galphai+protein+expression.+Gi+subtype+specificity+of+the+5-HT1A+receptor%5BTitle%5D)+AND+%22Journal+of+Biological+Chemistry%22%5BJournal%5D)">Stimulation of cAMP synthesis by Gi-coupled receptors upon ablation of distinct Galphai protein expression. Gi subtype specificity of the 5-HT1A receptor.</a> Journal of Biological Chemistry. 274 (23), 16444-16450 (1999).</li>
<li>Buccioni, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Innovative+functional+cAMP+assay+for+studying+G+protein-coupled+receptors%3A+application+to+the+pharmacological+characterization+of+GPR17%5BTitle%5D)+AND+%22Purinergic+Signalling%22%5BJournal%5D)">Innovative functional cAMP assay for studying G protein-coupled receptors: application to the pharmacological characterization of GPR17.</a> Purinergic Signalling. 7 (4), 463-468 (2011).</li>
<li>Wang, F. I., Ding, G., Ng, G. S., Dixon, S. J., Chidiac, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Luciferase-based+GloSensor+cAMP+assay%3A+Temperature+optimization+and+application+to+cell-based+kinetic+studies%5BTitle%5D)+AND+%22Methods%22%5BJournal%5D)">Luciferase-based GloSensor cAMP assay: Temperature optimization and application to cell-based kinetic studies.</a> Methods. , (2021).</li>
<li>Audet, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Small-scale+approach+for+precrystallization+screening+in+GPCR+X-ray+crystallography%5BTitle%5D)+AND+%22Nature+Protocols%22%5BJournal%5D)">Small-scale approach for precrystallization screening in GPCR X-ray crystallography.</a> Nature Protocols. 15 (1), 144-160 (2020).</li>
<li>Sgro, G. G., Costa, T. R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cryo-EM+grid+preparation+of+membrane+protein+samples+for+single+particle+analysis%5BTitle%5D)+AND+%22Frontiers+in+Molecular+Biosciences%22%5BJournal%5D)">Cryo-EM grid preparation of membrane protein samples for single particle analysis.</a> Frontiers in Molecular Biosciences. 5, 74(2018).</li>
<li>White, J. B. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single+particle+cryo-electron+microscopy%3A+from+sample+to+structure%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">Single particle cryo-electron microscopy: from sample to structure.</a> Journal of Visualized Experiments. (171), e62415(2021).</li>
<li>Thompson, R. F., Iadanza, M. G., Hesketh, E. L., Rawson, S., Ranson, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Collection%2C+pre-processing+and+on-the-fly+analysis+of+data+for+high-resolution%2C+single-particle+cryo-electron+microscopy%5BTitle%5D)+AND+%22Nature+Protocols%22%5BJournal%5D)">Collection, pre-processing and on-the-fly analysis of data for high-resolution, single-particle cryo-electron microscopy.</a> Nature Protocols. 14 (1), 100-118 (2019).</li>
<li>Fernandez-Leiro, R., Scheres, S. H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+pipeline+approach+to+single-particle+processing+in+RELION%5BTitle%5D)+AND+%22Acta+Crystallographica+Section+D%22%5BJournal%5D)">A pipeline approach to single-particle processing in RELION.</a> Acta Crystallographica Section D. 73 (6), 496-502 (2017).</li>
<li>Punjani, A., Rubinstein, J. L., Fleet, D. J., Brubaker, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((cryoSPARC%3A+algorithms+for+rapid+unsupervised+cryo-EM+structure+determination%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination.</a> Nature Methods. 14 (3), 290-296 (2017).</li>
<li>Brilot, A. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Beam-induced+motion+of+vitrified+specimen+on+holey+carbon+film%5BTitle%5D)+AND+%22Journal+of+Structural+Biology%22%5BJournal%5D)">Beam-induced motion of vitrified specimen on holey carbon film.</a> Journal of Structural Biology. 177 (3), 630-637 (2012).</li>
<li>Zheng, S. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((MotionCor2%3A+anisotropic+correction+of+beam-induced+motion+for+improved+cryo-electron+microscopy%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy.</a> Nature Methods. 14 (4), 331-332 (2017).</li>
<li>Zhang, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Gctf%3A+Real-time+CTF+determination+and+correction%5BTitle%5D)+AND+%22Journal+of+Structural+Biology%22%5BJournal%5D)">Gctf: Real-time CTF determination and correction.</a> Journal of Structural Biology. 193 (1), 1-12 (2016).</li>
<li>Scheres, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Semi-automated+selection+of+cryo-EM+particles+in+RELION-1.3%5BTitle%5D)+AND+%22Journal+of+Structural+Biology%22%5BJournal%5D)">Semi-automated selection of cryo-EM particles in RELION-1.3.</a> Journal of Structural Biology. 189 (2), 114-122 (2015).</li>
<li>Liu, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Differential+activation+mechanisms+of+lipid+GPCRs+by+lysophosphatidic+acid+and+sphingosine+1-phosphate%5BTitle%5D)+AND+%22Nature+Communications%22%5BJournal%5D)">Differential activation mechanisms of lipid GPCRs by lysophosphatidic acid and sphingosine 1-phosphate.</a> Nature Communications. 13 (1), 731(2022).</li>
<li>Duan, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cryo-EM+structure+of+an+activated+VIP1+receptor-G+protein+complex+revealed+by+a+NanoBiT+tethering+strategy%5BTitle%5D)+AND+%22Nature+Communications%22%5BJournal%5D)">Cryo-EM structure of an activated VIP1 receptor-G protein complex revealed by a NanoBiT tethering strategy.</a> Nature Communications. 11 (1), 4121(2020).</li>
<li>DiIorio, M. C., Kulczyk, A. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+robust+single-particle+cryo-electron+microscopy+%28cryo-EM%29+processing+workflow+with+cryoSPARC%2C+RELION%2C+and+Scipion%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">A robust single-particle cryo-electron microscopy (cryo-EM) processing workflow with cryoSPARC, RELION, and Scipion.</a> Journal of Visualized Experiments. (179), e63387(2022).</li>
<li>Pradelles, P., Grassi, J., Chabardes, D., Guiso, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Enzyme+immunoassays+of+adenosine+cyclic+3%27%2C5%27-monophosphate+and+guanosine+cyclic+3%27%2C5%27-monophosphate+using+acetylcholinesterase%5BTitle%5D)+AND+%22Analytical+Chemistry%22%5BJournal%5D)">Enzyme immunoassays of adenosine cyclic 3',5'-monophosphate and guanosine cyclic 3',5'-monophosphate using acetylcholinesterase.</a> Analytical Chemistry. 61 (5), 447-453 (1989).</li>
<li>Jiang, L. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Use+of+a+cAMP+BRET+sensor+to+characterize+a+novel+regulation+of+cAMP+by+the+sphingosine+1-phosphate%2FG13+pathway%5BTitle%5D)+AND+%22Journal+of+Biological+Chemistry%22%5BJournal%5D)">Use of a cAMP BRET sensor to characterize a novel regulation of cAMP by the sphingosine 1-phosphate/G13 pathway.</a> Journal of Biological Chemistry. 282 (14), 10576-10584 (2007).</li>
</ol>

Authors have no conflicts of interest.

This protocol describes a primary pipeline for determining the structures of S1PRs by cryo-EM and measuring the activation potency of S1PRs by Gi-mediated cAMP inhibition assay. Some steps are crucial to the experiment's success.
To purify the S1PRs-Gi complex, the quality of the virus and the health of sf9 cells should be paid more attention to. The expression of the receptor is dramatically reduced in poor sf9 cells. The health of sf9 cells was assessed by measurin...

Sphingosine-1-phosphate (S1P), a metabolic product of sphingolipids in the cell membrane, is a ubiquitous lysophosphatidic signaling molecule that involves various biological activities, including lymphocyte trafficking, vascular development, endothelial integrity, and heart rate1,2,3. S1P exerts its diverse physiological effects through five S1P receptor subtypes (S1PRs 1-5); S1PRs are found in a variety of tissues and exhibit unique preferences for downstream G proteins4,5. S1PR1 is primarily coupled with the Gi protein, which subsequently inhibits cAMP production; S1PR2 and S1PR3 are coupled with Gi, Gq, and G12/13, and S1PR4 and S1PR5 transduce signal through Gi and G12/136.
S1P-S1PR signaling is a critical therapeutic target for multiple diseases, including autoimmune disorders7, inflammation8, cancer9, and even COVID-1910. In 2010, fingolimod (FTY720) was licensed as a first-in-class drug targeting S1PRs to treat relapse multiple sclerosis (MS)11. However, it is capable of binding to all S1PRs except S1PR2, while nonspecific binding to S1PR3 results in edema of the cerebral cortex, vascular and bronchial constriction, and lung epithelial leakage12. As an alternate strategy for increasing therapeutic selectivity, subtype-specific ligands for the receptor have been produced. Siponimod (BAF312) was approved in 2019 for the relapse MS treatment13; it effectively targets S1PR1 and S1PR5, whereas it has no affinity for S1PR3, exhibiting fewer side effects in clinical practice14. In 2020, the US Food and Drug Administration authorized ozanimod for MS therapy15. It has been reported that ozanimod holds a 25-fold greater selectivity for S1PR1 than for S1PR516. Notably, in the context of the current COVID-19 pandemic, it has been discovered that agonist drugs targeting S1PRs may be utilized to treat COVID-19 by using immunomodulatory therapy techniques17. In comparison with fingolimod, the ozanimod has shown superiority in lowering symptoms in COVID-19 patients and is now undergoing clinical trials10. Understanding the structural basis and function of S1PRs lays a significant foundation for developing a drug that selectively targets S1PRs18.
Many techniques are used to investigate the structural information of biomacromolecules, including X-ray crystallography, nuclear magnetic resonance (NMR), and electron microscopy (EM). As of March 2022, there are more than 180,000 structures deposited on the Protein Databank (PDB), and most of them have been resolved by X-ray crystallography. However, with the first near-atomic resolution structure of TPRV1 (3.4 &#197; resolution) reported by Yifan Cheng and David Julius in 201319, cryo-electron microscopy (cryo-EM) has become a mainstream technique for protein structures, and the total number of EM PDB structures was more than 10,000. The critical breakthrough areas are the development of new cameras for imaging known as direct electron detection cameras and new image processing algorithms. Cryo-EM has revolutionized structure biology and structure-based drug discovery in the past decade20. As understanding how macromolecular complexes fulfill their complicated roles in the living cell is a central theme in biological sciences, cryo-EM has the potential to reveal conformations of dynamic molecular complexes, particularly for transmembrane proteins21. G-protein coupled receptors (GPCRs) are the largest superfamily of transmembrane proteins and the targets of more than 30% of currently marketed pharmaceuticals22. The development of cryo-EM has contributed to a burst of high-resolution structures of GPCR-G protein complexes, enabling structural determination for &#39;intractable&#39; targets that are still not accessible to X-ray crystallographic analysis in drug design23. Hence, the cryo-EM application provides a chance to determine the three-dimensional structure of GPCRs in near-native conditions at close to atomic resolution24. Advancements in cryo-EM make it possible to visualize mechanistic underpinnings of GPCR stimulation or inhibition, and further benefit in uncovering the novel binding sites for GPCR-targeted drug creation25.
Relying on the tremendous strides of cryo-EM technology, we have identified structures of agonized S1PR1-, S1PR3-, and S1PR5-Gi signaling complexes recently26,27. In humans, S1PRs are found in various tissues and exhibit unique preferences for downstream G proteins4,5. S1PR1 is primarily coupled with the Gi protein, which subsequently inhibits 3&#8242;,5&#8242;-cyclic adenosine monophosphate (cAMP) production. S1PR3 and S1PR5 are also capable of coupling with Gi6,28. Since Gi-coupled receptor activation decreases the production of cAMP29, a Gi-inhibition cAMP assay was introduced to measure cAMP inhibition effects for capturing functional alterations26,27. Using a mutant version of Photinus pyralis luciferase wherein a cAMP-binding protein moiety has been inserted, this cAMP assay offers a simple and reliable method for monitoring GPCR activity through changes in intracellular cAMP concentration30. It is a sensitive and non-radioactive functional assay and can be applied to monitor the real-time downstream signaling of a wide range of GPCRs for drug discovery purposes31.
Here, a summary is provided of the critical methods in resolving the activation and drug recognition modes of S1PRs, primarily including cryo-EM manipulations and a Gi-inhibition cAMP assay. This article aims to provide comprehensive experimental guidance for further explorations into the structures and functions of GPCRs.

<table><tbody><tr><td>0.05% trypsin-EDTA</td><td>GIBCO</td><td>Cat# 25300054</td><td></td></tr><tr><td>0.22 &amp;micro;M filter</td><td>Thermo Fisher Scientific</td><td>Cat# 42213-PS</td><td></td></tr><tr><td>100 kDa cut-off concentrator</td><td>Thermo Fisher Scientific</td><td>Cat# 88533</td><td></td></tr><tr><td>6-well plate</td><td>Corning</td><td>Cat# 43016</td><td></td></tr><tr><td>96-well plate</td><td>Corning</td><td>Cat# 3917</td><td></td></tr><tr><td>Aprotinin</td><td>Sigma-Aldrich</td><td>Cat# 9087-70-1</td><td></td></tr><tr><td>Apyrase</td><td>NEB</td><td>Cat# M0398S</td><td></td></tr><tr><td>Baculovirus transfection reagent</td><td>Thermo Fisher Scientific</td><td>Cat# 10362100</td><td>For the preparation of P0 baculovirus</td></tr><tr><td>Benzamidine</td><td>Sigma-Aldrich</td><td>Cat# B6506</td><td></td></tr><tr><td>CHO-K1</td><td>ATCC</td><td>N/A</td><td></td></tr><tr><td>CHS</td><td>Sigma-Aldrich</td><td>Cat# C6512</td><td></td></tr><tr><td>CryoSPARC</td><td>Punjani, A., et al.,2017</td><td>https://cryosparc.com/</td><td></td></tr><tr><td>DH5&amp;alpha; competent E.coli</td><td>Thermo Fisher Scientific</td><td>Cat# EC0112</td><td></td></tr><tr><td>D-Luciferin-Potassium Salt</td><td>Sigma- Aldrich</td><td>Cat# 50227</td><td></td></tr><tr><td>DMSO</td><td>Sigma- Aldrich</td><td>Cat# D2438</td><td></td></tr><tr><td>EDTA</td><td>Thermo Fisher Scientific</td><td>Cat# S311-500</td><td></td></tr><tr><td>ESF921 cell culture medium</td><td>Expression Systems</td><td>Cat#&amp;nbsp; 96-001</td><td></td></tr><tr><td>Excel</td><td>microsoft</td><td>N/A</td><td></td></tr><tr><td>F12 medium</td><td>Invitrogen</td><td>Cat# 11765</td><td></td></tr><tr><td>FBS</td><td>Cell Box</td><td>Cat# SAG-01U-02</td><td></td></tr><tr><td>Flag resin</td><td>Sigma- Aldrich</td><td>Cat# A4596</td><td></td></tr><tr><td>Forskolin</td><td>APExBIO</td><td>Cat# B1421</td><td></td></tr><tr><td>Gctf</td><td>Zhang, 2016</td><td>&amp;nbsp;https://www.mrc-lmb.cam.ac.uk/kzhang/Gctf/</td><td></td></tr><tr><td>GDN</td><td>Anatrace</td><td>Cat# GDN101</td><td></td></tr><tr><td>Gel filtration column</td><td>GE healthcare</td><td>Cat# 28990944</td><td></td></tr><tr><td>Gen5 3.11</td><td>BIO-TEK</td><td>N/A</td><td></td></tr><tr><td>Gentamicin</td><td>Solarbio</td><td>Cat# L1312</td><td></td></tr><tr><td>GloSensor cAMP assay kit</td><td>Promega</td><td>Cat# E1291</td><td>Gi-inhibition cAMP assay kit</td></tr><tr><td>GloSensor plasmid</td><td>Promega</td><td>Cat# E2301</td><td>Sensor plasmid</td></tr><tr><td>Grace&amp;rsquo;s medium</td><td>GIBCO</td><td>Cat# 11595030</td><td></td></tr><tr><td>GraphPad Prism 8</td><td>Graphpad</td><td>N/A</td><td></td></tr><tr><td>HBSS</td><td>Thermo Fisher Scientific</td><td>Cat# 88284</td><td></td></tr><tr><td>HEPES</td><td>Sigma- Aldrich</td><td>Cat# H4034</td><td></td></tr><tr><td>jetPRIME Reagent</td><td>Polyplus Transfection</td><td>Cat# 114-15</td><td>transfection reagent</td></tr><tr><td>Janamycin</td><td>Solarbio</td><td>Cat# K1030</td><td></td></tr><tr><td>LB medium</td><td>Invitrogen</td><td>Cat# 12780052</td><td></td></tr><tr><td>Leupeptin</td><td>Sigma-Aldrich</td><td>Cat# L2884</td><td></td></tr><tr><td>LMNG</td><td>Anatrace</td><td>Cat# NG310</td><td></td></tr><tr><td>MotionCor2</td><td>(Zheng et al., 2017)</td><td>https://emcore.ucsf.edu/ucsf-software</td><td></td></tr><tr><td>NanoCab</td><td>Thermo Fisher Scientific</td><td>Cat# 1121822</td><td></td></tr><tr><td>PBS</td><td>Invitrogen</td><td>Cat# 14190-144</td><td></td></tr><tr><td>pcDNA3.1-HA-FLAG-S1PRs</td><td>GenScript</td><td>N/A</td><td></td></tr><tr><td>pFastBac1-G&amp;alpha;&lt;sub&gt;i&lt;/sub&gt;</td><td>GenScript</td><td>N/A</td><td></td></tr><tr><td>pFastBac1-HA-FLAG-T4L-S1PRs-His10</td><td>GenScript</td><td>N/A</td><td></td></tr><tr><td>pFastBacdual-G&amp;beta;1&amp;gamma;2</td><td>GenScript</td><td>N/A</td><td></td></tr><tr><td>PureLink HiPure Plasmid Miniprep Kit</td><td>Invitrogen</td><td>Cat# K210003</td><td>For the preparation of plasmids and P0 baculovirus</td></tr><tr><td>Q5 site-Directed Mutagenesis kit</td><td>NEB</td><td>Cat# E0554S</td><td>For the preparation of plasmids</td></tr><tr><td>Quantifoil</td><td>Quantifoil</td><td>Cat# 251448</td><td></td></tr><tr><td>RELION-3.1</td><td>(Zivanov et al., 2018)</td><td>https://www2.mrc-lmb.cam.ac.uk/relion</td><td></td></tr><tr><td>S1PRs cDNA</td><td>addgene</td><td>N/A</td><td></td></tr><tr><td>scFv16</td><td>Invitrogen</td><td>Cat# 703976</td><td></td></tr><tr><td>Sf9</td><td>Expression Systems</td><td>N/A</td><td></td></tr><tr><td>Siponimod</td><td>Selleck</td><td>Cat# S7179</td><td></td></tr><tr><td>sodium cholate</td><td>Sigma-Aldrich</td><td>Cat# C1254</td><td></td></tr><tr><td>Synergy H1 microplate reader</td><td>BIO-TEK</td><td>N/A</td><td></td></tr><tr><td>Synthetic T4L DNA (sequence)</td><td>N/A</td><td>N/A</td><td>Aacatcttcgagatgctgcgcatcgacgaagg&lt;br/&gt; cctgcgtctcaagatttacaagaataccgaagg&lt;br/&gt; ttattacacgattggcatcggccacctcctgaca&lt;br/&gt; aagagcccatcactcaacgctgccaagtctga&lt;br/&gt; actggacaaagccattggtcgcaacaccaac&lt;br/&gt; ggtgtcattacaaaggacgaggcggagaaac&lt;br/&gt; tcttcaaccaagatgtagatgcggctgtccgtgg&lt;br/&gt; catcctgcgtaatgccaagttgaagcccgtgt&lt;br/&gt; atgactcccttgatgctgttcgccgtgcagcctt&lt;br/&gt; gatcaacatggttttccaaatgggtgagaccgg&lt;br/&gt; agtggctggttttacgaactccctgcgcatgctcc&lt;br/&gt; agcagaagcgctgggacgaggccgcagtga&lt;br/&gt; atttggctaaatctcgctggtacaatcagacacc&lt;br/&gt; taaccgtgccaagcgtgtcatcactaccttccg&lt;br/&gt; tactggaacttgggacgcttac</td></tr><tr><td>TCEP</td><td>Thermo Fisher Scientific</td><td>Cat# 77720</td><td></td></tr><tr><td>Tetracycline</td><td>Solarbio</td><td>Cat# T8180</td><td></td></tr><tr><td>Vitrobot Mark IV</td><td>Thermo Fisher Scientific</td><td>N/A</td><td></td></tr></tbody></table>

a pipeline to investigate the structures and signaling pathways of sphingosine 1-phosphate receptors

Lysophospholipids (LPLs) are bioactive lipids that include sphingosine 1-phosphate (S1P), lysophosphatidic acid, etc. S1P, a metabolic product of sphingolipids in the cell membrane, is one of the best-characterized LPLs that regulates a variety of cellular physiological responses via signaling pathways mediated by sphingosine 1-phosphate receptors (S1PRs). This implicated that the S1P-S1PRs signaling system is a remarkable potential therapeutic target for disorders, including multiple sclerosis (MS), autoimmune disorders, cancer, inflammation, and even COVID-19. S1PRs, a small subset of the class A G-protein coupled receptor (GPCR) family, are composed of five subtypes: S1PR1, S1PR2, S1PR3, S1PR4, and S1PR5. The lack of detailed structural information, however, impedes the drug discovery targeting S1PRs. Here, we applied the cryo-electron microscopy method to solve the structure of the S1P-S1PRs complex, and elucidated the mechanism of activation, selective drug recognition, and G-protein coupling by using cell-based functional assays. Other lysophospholipid receptors (LPLRs) and GPCRs can also be studied using this strategy.

Before freezing the sample of S1PRs-Gi complex, the purified sample needs to be separated by size-exclusion chromatography (SEC) and analyzed with gel filtration chromatography. Figure 2 shows the S1PR3-Gi complex as an example. The peak fraction of the homogeneous GPCR-G protein complex was usually located at ~10.5 mL of the size-exclusion chromatography (Figure 2A). SDS-page analysis of the S1PR3-Gi complex (Figure 2B) reveals fou...

Watch this Scientific Journal Video about A Pipeline to Investigate the Structures and Signaling Pathways of Sphingosine 1-Phosphate Receptors at JoVE.com

A Pipeline to Investigate the Structures and Signaling Pathways of Sphingosine 1-Phosphate Receptors

S1P exerts its diverse physiological effects through the S1P receptors (S1PRs) subfamily. Here, a pipeline is described to expound on the structures and function of S1PRs.

Lysophospholipids (LPLs) are bioactive lipids that include sphingosine 1-phosphate (S1P), lysophosphatidic acid, etc. S1P, a metabolic product of ...

a-pipeline-to-investigate-structures-signaling-pathways-sphingosine-1

Research

JoVE Journal

Biochemistry

3.3K Views.  Sichuan University. We hebben de activerings- en herberekeningsstemmingen van S1PRS door de bemanning, EM-manipulaties en GI-inhab-toestand A M P A en minder belangrijke basis voor het ontwikkelen van een medicijn dat zich stevig richt op S1PRS-Verbeteringen die het mogelijk maken om magnistische onderschilderingen van GP ZR-stimulatie of bewoning te viruliseren en verdere voordelen bij het blootleggen van de normale bindingsplaatsen voor T BCR-gerichte medicijncreatie. De kwaliteit van het monster is de basis v...

Video: A Pipeline to Investigate the Structures and Signaling Pathways of Sphingosine 1-Phosphate Receptors

Single-molecule Super-resolution Imaging of Phosphatidylinositol 4,5-bisphosphate in the Plasma Membrane with Novel Fluorescent Probes

Phosphoinositides in the cell membrane are signaling lipids with multiple cellular functions. Phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) is a determinant phosphoinositide of the plasma membrane (PM), and it is required to modulate ion channels, actin dynamics, exocytosis, endocytosis, intracellular signaling, and many other cellular processes. However, the spatial organization of PI(4,5)P2 in the PM is controversial, and its nanoscale distribution is poorly understood due to the technical limitations of research approaches. Here by utilizing single molecule localization microscopy and the Pleckstrin Homology (PH) domain based dual color fluorescent probes, we describe a novel method to visualize the nanoscale distribution of PI(4,5)P2 in the PM in fixed membrane sheets as well as live cells.

PI(4,5)P2 regulates various cellular functions, but its nanoscale organization in the cell plasma membrane is poorly understood. By labeling PI(4,5)P2 with a dual-color fluorescent probe fused to the Pleckstrin Homology domain, we describe a novel approach to study the PI(4,5)P2 spatial distribution in the plasma membrane at the nanometer scale.

Phosphoinositides in the cell membrane are signaling lipids with multiple cellular functions. Phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) is a ...

Quantitative and Qualitative Method for Sphingomyelin by LC-MS Using Two Stable Isotopically Labeled Sphingomyelin Species

We present a method of analyzing sphingomyelin (SM) qualitatively and quantitatively by liquid chromatography-electrospray Ionization-tandem mass spectrometry (LC-ESI-MS/MS). SM is a common sphingolipid composed of a phosphorylcholine and a ceramide as the hydrophilic and hydrophobic component, respectively. A number of SM species are present in mammalian cells due to a variety in the sphingoid long chain base (LCB) and an N-acyl moiety in the ceramide. In this report, we show a method of estimating the number of carbon and double bonds in a LCB and an N-acyl moiety based on their corresponding product ions in MS/MS/MS (MS3) experiments. In addition, we present a quantitative analysis method for SM using two stable isotopically labeled SM species, which facilitates determining the range used in SM quantitation. The present method will be useful in characterizing a variety of SM species in biological samples and industrial products such as cosmetics.

Here, we present a protocol to quantify and qualify each sphingomyelin species using multiple reaction monitoring and MS/MS/MS mode, respectively.

We present a method of analyzing sphingomyelin (SM) qualitatively and quantitatively by liquid chromatography-electrospray Ionization-tandem mass ...

Preparation of Human Tissues Embedded in Optimal Cutting Temperature Compound for Mass Spectrometry Analysis

Sphingolipids are cellular components that have well-established roles in human metabolism and disease. Mass spectrometry can be used to determine whether sphingolipids are altered in a disease and investigate whether sphingolipids can be targeted clinically. However, properly powered prospective studies that acquire tissues directly from the surgical suite can be time consuming, and technically, logistically, and administratively challenging. In contrast, retrospective studies can take advantage of cryopreserved human specimens already available, usually in large numbers, at tissue biorepositories. Other advantages of procuring tissues from biorepositories include access to information associated with the tissue specimens including histology, pathology, and in some instances clinicopathological variables, all of which can be used to examine correlations with lipidomics data. However, technical limitations related to the incompatibility of optimal cutting temperature compound (OCT) used in the cryopreservation and mass spectrometry is a technical barrier for the analysis of lipids. However, we have previously shown that OCT can be easily removed from human biorepository specimens through cycles of washes and centrifugation without altering their sphingolipid content. We have also previously established that sphingolipids in human tissues cryopreserved in OCT are stable for up to 16 years. In this report, we outline the steps and workflow to analyze sphingolipids in human tissue specimens that are embedded in OCT, including washing tissues, weighing tissues for data normalization, the extraction of lipids, preparation of samples for analysis by liquid chromatography electrospray ionization tandem mass spectrometry (LC-ESI-MS/MS), mass spectrometry data integration, data normalization, and data analysis.

Sphingolipids are bioactive metabolites with well-established roles in human disease. Characterizing alterations in tissues with mass-spectrometry can reveal roles in disease etiology or identify therapeutic targets. However, the OCT-compound used for cryopreservation in biorepositories interferes with mass-spectrometry. We outline methods to analyze sphingolipids in human tissues embedded in OCT with LC-ESI-MS/MS.

Sphingolipids are cellular components that have well-established roles in human metabolism and disease. Mass spectrometry can be used to determine whether ...

Cancer Research

Fluorescence-Based Measurements of Phosphatidylserine/Phosphatidylinositol 4-Phosphate Exchange Between Membranes

Several members of the evolutionarily conserved oxysterol-binding protein (OSBP)-related proteins(ORP)/OSBP homologs (Osh) family have recently been found to represent a novel lipid transfer protein (LTP) group in yeast and human cells. They transfer phosphatidylserine (PS) from the endoplasmic reticulum (ER) to the plasma membrane (PM) via PS/phosphatidylinositol 4-phosphate (PI(4)P) exchange cycles. This finding allows a better understanding of how PS, which is critical for signaling processes, is distributed throughout the cell and the investigation of the link between this process and phosphoinositide (PIP) metabolism. The development of new fluorescence-based protocols has been instrumental in the discovery and characterization of this new cellular mechanism in vitro at the molecular level. This paper describes the production and the use of two fluorescently labelled lipid sensors, NBD-C2Lact and NBD-PHFAPP, to measure the ability of a protein to extract PS or PI(4)P and to transfer these lipids between artificial membranes. First, the protocol describes how to produce, label, and obtain high-purity samples of these two constructs. Secondly, this paper explains how to use these sensors with a fluorescence microplate reader to determine whether a protein can extract PS or PI(4)P from liposomes, using Osh6p as a case study. Finally, this protocol shows how to accurately measure the kinetics of PS/PI(4)P exchange between liposomes of defined lipid composition and to determine lipid transfer rates by fluorescence resonance energy transfer (FRET) using a standard fluorometer.

Here, we describe protocols using fluorescent lipid sensors and liposomes to determine whether a protein extracts and transports phosphatidylserine or phosphatidylinositol 4-phosphate in vitro.

Several members of the evolutionarily conserved oxysterol-binding protein (OSBP)-related proteins(ORP)/OSBP homologs (Osh) family have recently been found ...

Analysis of Lipid Signaling in Drosophila Photoreceptors using Mass Spectrometry

The activation of phospholipase C&#946; (PLC&#946;) is an essential step during sensory transduction in Drosophila photoreceptors. PLC&#946; activity results in the hydrolysis of the membrane lipid phosphatidylinositol 4,5 bisphosphate [PI(4,5)P2] leading ultimately to the activation of transient receptor potential (TRP) and TRP like (TRPL) channels. The activity of PLC&#946; also leads subsequently to the generation of many lipid species several of which have been proposed to play a role in TRP and TRPL activation. In addition, several classes of lipids have been proposed to play key roles in organizing the cell biology of photoreceptors to optimize signaling reactions for optimal sensory transduction. Historically, these discoveries have been driven by the ability to isolate Drosophila mutants for enzymes that control the levels of specific lipids and perform analysis of photoreceptor physiology in these mutants. More recently, powerful mass spectrometry methods for isolation and quantitative analysis of lipids with high sensitivity and specificity have been developed. These are particularly suited for use in Drosophila where lipid analysis is now possible from photoreceptors without the need for radionuclide labeling. In this article, the conceptual and practical considerations in the use of lipid mass spectrometry for the robust, sensitive, and accurate quantitative assessment of various signaling lipids in Drosophila photoreceptors are covered. Along with existing methods in molecular genetics and physiological analysis such lipid is likely to enhance the power of photoreceptors as a model system for discoveries in biology.

Analysis of Lipid Signaling in Drosophila Photoreceptors using Mass Spectrometry

The manuscript presents versatile, robust, and sensitive mass spectrometry protocols to identify and quantify several classes of lipids from Drosophila photoreceptors.

The activation of phospholipase C&#946; (PLC&#946;) is an essential step during sensory transduction in Drosophila photoreceptors. PLC&#946; activity ...

PIP-on-a-chip: A Label-free Study of Protein-phosphoinositide Interactions

Numerous cellular proteins interact with membrane surfaces to affect essential cellular processes. These interactions can be directed towards a specific lipid component within a membrane, as in the case of phosphoinositides (PIPs), to ensure specific subcellular localization and/or activation. PIPs and cellular PIP-binding domains have been studied extensively to better understand their role in cellular physiology. We applied a pH modulation assay on supported lipid bilayers (SLBs) as a tool to study protein-PIP interactions. In these studies, pH sensitive ortho-Sulforhodamine B conjugated phosphatidylethanolamine is used to detect protein-PIP interactions. Upon binding of a protein to a PIP-containing membrane surface, the interfacial potential is modulated (i.e. change in local pH), shifting the protonation state of the probe. A case study of the successful usage of the pH modulation assay is presented by using phospholipase C delta1 Pleckstrin Homology (PLC-&#948;1 PH) domain and phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) interaction as an example. The apparent dissociation constant (Kd,app) for this interaction was 0.39 &#177; 0.05 &#181;M, similar to Kd,app values obtained by others. As previously observed, the PLC-&#948;1 PH domain is PI(4,5)P2 specific, shows weaker binding towards phosphatidylinositol 4-phosphate, and no binding to pure phosphatidylcholine SLBs. The PIP-on-a-chip assay is advantageous over traditional PIP-binding assays, including but not limited to low sample volume and no ligand/receptor labeling requirements, the ability to test high- and low-affinity membrane interactions with both small and large molecules, and improved signal to noise ratio. Accordingly, the usage of the PIP-on-a-chip approach will facilitate the elucidation of mechanisms of a wide range of membrane interactions. Furthermore, this method could potentially be used in identifying therapeutics that modulate protein&#39;s capacity to interact with membranes.

Here we present a supported lipid bilayer in the context of a microfluidic platform to study protein-phosphoinositide interactions using a label-free method based on pH modulation.

Numerous cellular proteins interact with membrane surfaces to affect essential cellular processes. These interactions can be directed towards a specific ...

Bioengineering

Identification of Mediators of T-cell Receptor Signaling via the Screening of Chemical Inhibitor Libraries

The T-cell receptor (TCR) signaling pathway comprises a multitude of mediators that transmit signals upon the activation of the TCR. Different strategies have been proposed and implemented for the identification of new mediators of TCR signaling, which would improve the understanding of T-cell processes, including activation and thymic selection. We describe a screening assay that enables the identification of molecules that influence TCR signaling based on the activation of developing thymocytes. Strong TCR signals cause developing thymocytes to activate apoptotic machinery in a process known as negative selection. Through the application of kinase inhibitors, those with targets that affect TCR signaling are able to override the process of negative selection. The method detailed in this paper can be used to identify inhibitors of canonical kinases with established roles in the TCR signaling pathways and also inhibitors of new kinases yet to be established in the TCR signaling pathways. The screening strategy here can be applied to screens of higher throughput for the identification of novel druggable targets in TCR signaling.

Identification of Mediators of T-cell Receptor Signaling via the Screening of Chemical Inhibitor Libraries

This paper uses a flow-cytometry-based assay to screen libraries of chemical inhibitors for the identification of inhibitors and their targets that influence T-cell receptor signaling. The methods described here can also be expanded for high-throughput screenings.

The T-cell receptor (TCR) signaling pathway comprises a multitude of mediators that transmit signals upon the activation of the TCR. Different strategies ...

Immunology and Infection

Construction of Model Lipid Membranes Incorporating G-protein Coupled Receptors (GPCRs)

Robust in vitro investigations of the structure and function of integral membrane proteins has been a challenge due to the complexities of the plasma membrane and the numerous factors that influence protein behavior in live cells. Giant unilamellar vesicles (GUVs) are a biomimetic and highly tunable in vitro model system for investigating protein-membrane interactions and probing protein behavior in a precise, stimulus-dependent manner. In this protocol, we present an inexpensive and effective method for fabricating GUVs with the human serotonin 1A receptor (5-HT1AR) stably integrated in the membrane. We fabricate GUVs using a modified hydrogel swelling method; by depositing a lipid film on top of a mixture of agarose and 5-HT1AR and then hydrating the entire system, vesicles can be formed with properly oriented and functional 5-HT1AR incorporated into the membrane. These GUVs can then be used to examine protein-membrane interactions and localization behavior via microscopy. Ultimately, this protocol can advance our understanding of the functionality of integral membrane proteins, providing profound physiological insight.

Construction of Model Lipid Membranes Incorporating G-protein Coupled Receptors GPCRs

This protocol utilizes agarose swelling as a powerful and generalizable technique for incorporating integral membrane proteins (IMPs) into giant unilamellar lipid vesicles (GUVs), as described here for the reconstitution of the human 1A serotonin receptor protein (5-HT1AR), one of the classes of pharmacologically important G protein-coupled receptors.

Robust in vitro investigations of the structure and function of integral membrane proteins has been a challenge due to the complexities of the plasma ...

Selected Reaction Monitoring Mass Spectrometry for Absolute Protein Quantification

Absolute quantification of target proteins within complex biological samples is critical to a wide range of research and clinical applications. This protocol provides step-by-step instructions for the development and application of quantitative assays using selected reaction monitoring (SRM) mass spectrometry (MS). First, likely quantotypic target peptides are identified based on numerous criteria. This includes identifying proteotypic peptides, avoiding sites of posttranslational modification, and analyzing the uniqueness of the target peptide to the target protein. Next, crude external peptide standards are synthesized and used to develop SRM assays, and the resulting assays are used to perform qualitative analyses of the biological samples. Finally, purified, quantified, heavy isotope labeled internal peptide standards are prepared and used to perform isotope dilution series SRM assays. Analysis of all of the resulting MS data is presented. This protocol was used to accurately assay the absolute abundance of proteins of the chemotaxis signaling pathway within RAW 264.7 cells (a mouse monocyte/macrophage cell line). The quantification of Gi2 (a heterotrimeric G-protein &#945;-subunit) is described in detail.

This protocol describes how to perform absolute quantification assays of target proteins within complex biological samples using selected reaction monitoring. It was used to accurately quantify proteins of the mouse macrophage chemotaxis signaling pathway. Target peptide selection, assay development, and qualitative and quantitative assays are described in detail.

Absolute quantification of target proteins within complex biological samples is critical to a wide range of research and clinical applications. This ...

Biology

Analysis of SCAP N-glycosylation and Trafficking in Human Cells

Elevated lipogenesis is a common characteristic of cancer and metabolic diseases. Sterol regulatory element-binding proteins (SREBPs), a family of membrane-bound transcription factors controlling the expression of genes important for the synthesis of cholesterol, fatty acids and phospholipids, are frequently upregulated in these diseases. In the process of SREBP nuclear translocation, SREBP-cleavage activating protein (SCAP) plays a central role in the trafficking of SREBP from the endoplasmic reticulum (ER) to the Golgi and in subsequent proteolysis activation. Recently, we uncovered that glucose-mediated N-glycosylation of SCAP is a prerequisite condition for the exit of SCAP/SREBP from the ER and movement to the Golgi. N-glycosylation stabilizes SCAP and directs SCAP/SREBP trafficking. Here, we describe a protocol for the isolation of membrane fractions in human cells and for the preparation of the samples for the detection of SCAP N-glycosylation and total protein by using western blot. We further provide a method to monitor SCAP trafficking by using confocal microscopy. This protocol is appropriate for the investigation of SCAP N-glycosylation and trafficking in mammalian cells.

Analysis of SCAP N-glycosylation and Trafficking in Human Cells

We describe a modified method for membrane fraction isolation from human cells and sample preparation for the detection of SCAP N-glycosylation and total protein by using western blot. We further introduce a GFP-labeling method to monitor SCAP trafficking using confocal microscopy. This protocol can be used in regular biology laboratories.

A Pipeline to Investigate the Structures and Signaling Pathways of Sphingosine 1-Phosphate Receptors

Samenvatting

Meer video's verkennen