This work was supported in part by U.S. National Institutes of Health (NIH) grants R01DK122808, R01DK102898, and R01DK132469 (to Y.-H.T.), as well as P30DK036836 (to Joslin Diabetes Center&#39;s Diabetes Research Center). T. T. was supported by the SUNSTAR Research Fellowship (Hiroo Kaneda Scholarship, Sunstar Foundation, Japan) and the American Heart Association grant 903968. Y. Z. was supported by the Charles A. King Trust Fellowship. We thank Sean D. Kodani for kindly proofreading the manuscript.

All the animal experiments and care procedures were approved by the Institutional Animal Care and Use Committee at Joslin Diabetes Center.
1. Screening effective sgRNAs in cultured cells
NOTE: To make the assay cost-effective, before packaging the sgRNAs into AAV particles, we recommend testing different sgRNAs in cultured cells via a lentivirus-based system for Cas9/sgRNA expression (Figure 1) and selecting the sgRNAs that give the highest knockdown efficiency for in vivo experiments.
<ol>
	<li>CRISPR-Cas9 sgRNA design
	<ol>
		<li>Design sgRNAs using online tools, such as the Broad sgRNA design tool (https://portals.broadinstitute.org/gppx/crispick/public)20,21, the CRISPOR online tool (http://crispor.tefor.net/)22, and other available tools.</li>
		<li>Enter gene names or DNA target sequences in the gene name box, and select NGG as the protospacer adjacent motif (PAM) for SpCas9 to generate potential sgRNA sequences.</li>
		<li>Select the sgRNAs with high predicted on-target efficiency and low off-target activity. For instance, sgRNAs with a specificity score of at least 50 on the CRISPOR output are recommended for use. Among the specific sgRNAs that pass the filter, pick the ones with high efficiency scores23. 
		NOTE: In general, three or four sgRNAs are picked to ensure the identification of effective sgRNAs.</li>
	</ol>
	</li>
	<li>Construction of the CRISPR-Cas9 sgRNA plasmid
	<ol>
		<li>Synthesize sgRNA oligo pairs encoding 20 nucleotide (nt) targeted sequences with overhangs (both 5&#39; and 3&#39;) from the BsmBI restriction site (Table 1) through a DNA synthesis platform.</li>
		<li>Ligate annealed oligo pairs with BsmBI-linearized lentiCRISPR v2 vector.</li>
		<li>Transform the ligation product into the Stbl3 E. coli strain, and confirm the sgRNA insertions by Sanger DNA sequencing using U6 forward primer. 
		NOTE: See the detailed cloning procedure in Addgene&#39;s protocol entitled LentiCRISPRv2 and lentiGuide-Puro: lentiviral CRISPR/Cas9 and single guide RNA24.</li>
	</ol>
	</li>
	<li>Producing lentiviral particles
	<ol>
		<li>Approximately 24 h before transfection, plate 7 x 105 HEK-293 cells in 4 mL of complete growth medium in a 6 cm tissue culture plate.</li>
		<li>Add 15 &#181;L of LT1 transfection reagent to 250 &#181;L of serum-free medium, and incubate at room temperature for 5 min.</li>
		<li>Prepare a transfection cocktail for each sgRNA as per Table 2 in 250 &#181;L of serum-free medium. Mix the transfection reagent prepared in step 1.3.2 with the plasmid cocktail, and incubate for 20-30 min at room temperature.</li>
		<li>Replace the complete growth medium with 3.5 mL of fresh growth medium for HEK-293 cells, and then add the DNA transfection reagent mixture dropwise to the HEK-293 cells cultured in the 3.5 mL of fresh growth medium.</li>
		<li>After 12-15 h of transfection, change the medium to remove the transfection reagent, and replace it with 4 mL of fresh growth medium.</li>
		<li>After 24 h of incubation, collect the cell culture medium that contains lentiviral particles, and filter the medium through a 0.45 &#181;m filter to remove any HEK-293 cells. The viruses may be stored at 4 &#176;C for a few days. For long-term storage, the viruses should be frozen at &#8722;80 &#176;C. 
		NOTE: Follow biosafety guidelines when preparing lentiviral particles, and work in an environment (e.g., BL2+) suitable for handling lentivirus. See the detailed lentivirus preparation procedure in Addgene&#39;s protocol entitled pLKO.1 - TRC Cloning Vector (https://www.addgene.org/protocols/plko/#G).</li>
	</ol>
	</li>
	<li>Infection of brown preadipocytes and determination of sgRNA-mediated knockdown
	<ol>
		<li>Plate 1 x 106 mouse immortalized brown preadipocytes in 1 mL of fresh medium containing 8 &#181;g/mL polybrene per well in a 6-well plate. 
		NOTE: In this study, the immortalized brown preadipocytes were generated using SV40 T antigen25. Brown preadipocytes are cultured in high-glucose DMEM with 10% FBS.</li>
		<li>Add 1 mL of lentiviral particle solution from step 1.3 to infect the cells. Maintain one uninfected well of cells in parallel to serve as the antibiotic selection control.</li>
		<li>Change to fresh medium 24 h after infection. Add the corresponding antibiotics (e.g., puromycin with a final concentration of 1 &#181;g/mL) to the medium to kill the uninfected cells and select the infected ones. Change to fresh medium containing the selected antibiotic every other day until all the uninfected control cells are dead.</li>
		<li>Collect protein from the virus-infected cells, and determine the knockdown efficiency of the sgRNAs by western blot analysis. Follow the detailed western blotting procedure in Eslami and Lujan26. Due to the varying turnover rate among proteins, test multiple time points (e.g., from day 6 to day 12 after virus infection) to observe the loss of protein signal. 
		NOTE: If an antibody that recognizes the protein encoded by the gene of interest is not available, Sanger sequencing can alternatively be utilized to determine the genome editing efficiency of each sgRNA. Briefly, amplify the genomic DNA using primers flanking the sgRNA-targeted region to generate PCR amplicons of ~700 bp in length. The projected break site should preferably be ~200 bp downstream from the sequencing start site. Then, subject the PCR product to Sanger sequencing. Analyze the sequencing results using the online tools, such as Tracking of Indels by DEcomposition (TIDE), to determine the frequency of small indels generated by each sgRNA in a pool of cells27.</li>
	</ol>
	</li>
</ol>
2. Construction of the AAV-sgRNA plasmid
NOTE: In this step, the effective sgRNAs identified from the above screen are cloned into the pAAV-U6-BbsI-gRNA-CB-EmGFP vector28 (Figure 2). In the meantime, a non-targeting sgRNA (e.g., TCTGATAGCGTAGGAGTGAT29) that does not recognize any sequence in the mouse genome is also cloned into the same vector to serve as a non-edited control.
<ol>
	<li>Linearize pAAV-U6-BbsI-gRNA-CB-EmGFP backbone using BbsI, which generates identical overhangs with synthesized sgRNA oligos.</li>
	<li>Ligate the annealed oligo pairs with linearized pAAV vector, and confirm the sgRNA insertions as described in step 1.2. 
	&#8203;NOTE: The cloning procedure for lentiCRISPRv2-sgRNA is also applied for the AAV-sgRNA plasmid construction.</li>
</ol>
3. AAV packaging
<ol>
	<li>Package the AAV vectors generated in section 2 into AAV serotype 8. Prepare high-titer AAV according to a previous protocol30, or request an AAV packaging service from viral cores or commercial services. Dilute the virus titer to 1 x 1013 genome copies/mL. 
	&#8203;NOTE: The modified AAV2 genome expressing an sgRNA is packaged into AAV serotype 8. This serotype was chosen due to its high efficiency for adipose tissue18,31. To prevent immune response induced by contaminants, such as cell debris and small amounts of medium components, ultra-purified AAV is required for in vivo injection. Ultra-purification can be achieved by iodixanol gradients and ultracentrifugation30.</li>
</ol>
4. Preparation of Ucp1 Cre/Cas9 mice
<ol>
	<li>Purchase the Ucp1-Cre mouse strain (see Table of Materials) that expresses Cre recombinase under the control of the Ucp1 promoter. Purchase homozygous Rosa26-floxed STOP-Cas9 knock-in mice32 (see Table of Materials), in which the expression of Cas9 is regulated in a Cre recombinase-dependent manner.</li>
	<li>Cross these strains to generate Ucp1-Cre/Cas9 mice, as previously described16,17. Keep all the mice in a temperature- and humidity-controlled room (23 &#176;C, 30% humidity) on a 12 h light-dark cycle (lights on at 6:30 am; lights off at 6:30 pm) with free access to chow diet and water.</li>
	<li>Treat the resulting Ucp1-Cre/Cas9 mice with AAVs carrying either control sgRNA or sgRNA targeting the gene of interest through the method described below. In this study, 12-15 week old male Ucp1-Cre/Cas9 mice weighing approximately 30 g were used.</li>
</ol>
5. Surgery for AAV injection into the BAT in mice
<ol>
	<li>Anesthetize the mice with continuous inhalation of 2.5% isoflurane for induction and maintenance.</li>
	<li>Lubricate both eyes to prevent drying. Then, give analgesics (banamine, 2.5 mg/kg body weight [BW], subcutaneous injection, see Table of Materials) to the mice to minimize and prevent postoperative pain and distress.</li>
	<li>Shave the mouse fur on the interscapular area using a shaver and sterilize the surgical area with at least three alternating rounds of an iodine-based or chlorhexidine-based scrub followed by 70% ethanol. Then, apply sterile surgical drapes around the incision site.</li>
	<li>Incise the skin&#160;between the scapulae&#160;using a scalpel (Figure 3A-B), and then peel the shaved skin off to expose the fat tissues on the neck using surgical scissors&#160;(Figure 3C-D). The size of the incision is dependent on the body size, but generally, the incision should be approximately 2 cm to expose the fat tissues on the interscapular region.</li>
	<li>Cut the fat tissues on the border between the distal region of the fat tissues and muscles using a single incision (Figure 3E-F). The size of the incision should be approximately 1 cm to just open the entrance for the insertion of the surgical scissors for blunt peeling of the fat tissues.</li>
	<li>Using the dominant hand, peel the fat tissues off bluntly and vertically with surgical scissors to expose the BAT while pinching the fat tissues, including the BAT, with the non-dominant hand (Figure 3G). Use the Sultzer&#39;s vein as a landmark to indicate the precise BAT location. 
	NOTE: The BAT in Figure 3H&#160;was completely exposed for the purpose of a picture demonstration. Excess dissection may cause damage to the nerves of the surrounding BAT. Incorrect direction of the scissors may hurt the surrounding muscles and the Sultzer&#39;s vein draining the BAT and could lead to excess bleeding.</li>
	<li>For each mouse, inject 40 &#181;L of AAV slowly into both BAT lobes (20 &#181;L per one lobe of the BAT) using a sharp needle (32 G, see Table of Materials) connected to a Hamilton syringe (100 &#181;L, see Table of Materials; Figure 3I). Check for successful injection as indicated by no leakages from the injected site during AAV administration. 
	NOTE: The BAT in Figure 3I&#160;was completely exposed for the purpose of a picture demonstration. The volume of AAV solution to be administered into a BAT lobe is determined by the size of the BAT of the recipient mouse. We have determined that 20 &#181;L of AAV solution is appropriate for one BAT lobe weighing approximately 0.05 g in a regular C57BL6/J mouse weighing 30 g. If necessary, the viral solution may need to be concentrated to achieve the desired volume.</li>
	<li>Confirm no bleeding from the injected BAT or surrounding tissues. Press gauze soaked with hydrogen peroxide solution (see Table of Materials) onto a bleeding site for hemostasis.</li>
	<li>Place the exposed fat tissues back to their normal position. Stitch up the edge of the fat tissues and muscle using a 5-0 absorbable monofilament thread (Figure 3J). Suture the open skin with 5-0 coated vicryl undyed braided threads (Figure 3K-L). 
	NOTE: Figure 4 describes the steps for stitching the peeled fat tissues and muscles.</li>
	<li>Maintain the animals on a heating pad following the surgery until complete recovery. Provide the animals with access to food, water, and ample bedding for nesting. Monitor them regularly for any signs of distress or illness for 7 days of recovery prior to the beginning of the experiment.</li>
	<li>Confirm the efficiency of the targeted gene deletion by western blot analysis in the BAT dissected from mice, as in Sugimoto et al.16.</li>
</ol>

<ol>
	<li>Kopelman, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Obesity+as+a+medical+problem.">Obesity as a medical problem.</a> Nature. 404 (6778), 635-643 (2000).</li><li>Finkelstein, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Obesity+and+severe+obesity+forecasts+through+2030.">Obesity and severe obesity forecasts through 2030.</a> American Journal of Preventive Medicine. 42 (6), 563-570 (2012).</li><li>Craft, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin+resistance+and+Alzheimer's+disease+pathogenesis:+Potential+mechanisms+and+implications+for+treatment.">Insulin resistance and Alzheimer's disease pathogenesis: Potential mechanisms and implications for treatment.</a> Current Alzheimer Research. 4 (2), 147-152 (2007).</li><li>Villarroya, F., Cereijo, R., Villarroya, J., Giralt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+adipose+tissue+as+a+secretory+organ.">Brown adipose tissue as a secretory organ.</a> Nature Reviews Endocrinology. 13 (1), 26-35 (2017).</li><li>Scheele, C., Wolfrum, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+adipose+crosstalk+in+tissue+plasticity+and+human+metabolism.">Brown adipose crosstalk in tissue plasticity and human metabolism.</a> Endocrine Reviews. 41 (1), 53-65 (2020).</li><li>Becher, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+adipose+tissue+is+associated+with+cardiometabolic+health.">Brown adipose tissue is associated with cardiometabolic health.</a> Nature Medicine. 27 (1), 58-65 (2021).</li><li>Kajimura, S., Spiegelman, B. M., Seale, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+and+beige+fat:+Physiological+roles+beyond+heat+generation.">Brown and beige fat: Physiological roles beyond heat generation.</a> Cell Metabolism. 22 (4), 546-559 (2015).</li><li>Scheja, L., Heeren, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+endocrine+function+of+adipose+tissues+in+health+and+cardiometabolic+disease.">The endocrine function of adipose tissues in health and cardiometabolic disease.</a> Nature Reviews Endocrinology. 15 (9), 507-524 (2019).</li><li>Darcy, J., Tseng, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ComBATing+aging-does+increased+brown+adipose+tissue+activity+confer+longevity.">ComBATing aging-does increased brown adipose tissue activity confer longevity.</a> Geroscience. 41 (3), 285-296 (2019).</li><li>da Silva Xavier, G., Hodson, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+of+peripheral+metabolic+disease.">Mouse models of peripheral metabolic disease.</a> Best Practice &amp; Research Clinical Endocrinology &amp; Metabolism. 32 (3), 299-315 (2018).</li><li>Kim, H., Kim, M., Im, S. K., Fang, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+Cre-LoxP+system:+General+principles+to+determine+tissue-specific+roles+of+target+genes.">Mouse Cre-LoxP system: General principles to determine tissue-specific roles of target genes.</a> Laboratory Animal Research. 34 (4), 147-159 (2018).</li><li>Wang, D., Zhang, F., Gao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-based+therapeutic+genome+editing:+Strategies+and+in+vivo+delivery+by+AAV+vectors.">CRISPR-based therapeutic genome editing: Strategies and in vivo delivery by AAV vectors.</a> Cell. 181 (1), 136-150 (2020).</li><li>Sander, J. D., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas+systems+for+editing,+regulating+and+targeting+genomes.">CRISPR-Cas systems for editing, regulating and targeting genomes.</a> Nature Biotechnology. 32 (4), 347-355 (2014).</li><li>Dow, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+in+vivo+genome+editing+with+CRISPR-Cas9.">Inducible in vivo genome editing with CRISPR-Cas9.</a> Nature Biotechnology. 33 (4), 390-394 (2015).</li><li>Bates, R., Huang, W., Cao, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adipose+tissue:+An+emerging+target+for+adeno-associated+viral+vectors.">Adipose tissue: An emerging target for adeno-associated viral vectors.</a> Molecular Therapy. Methods &amp; Clinical Development. 19, 236-249 (2020).</li><li>Sugimoto, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+adipose+tissue-derived+MaR2+contributes+to+cold-induced+resolution+of+inflammation.">Brown adipose tissue-derived MaR2 contributes to cold-induced resolution of inflammation.</a> Nature Metabolism. 4 (6), 775-790 (2022).</li><li>Leiria, L. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=12-lipoxygenase+regulates+cold+adaptation+and+glucose+metabolism+by+producing+the+omega-3+lipid+12-HEPE+from+brown+fat.">12-lipoxygenase regulates cold adaptation and glucose metabolism by producing the omega-3 lipid 12-HEPE from brown fat.</a> Cell Metabolism. 30 (4), 768-783 (2019).</li><li>Shamsi, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FGF6+and+FGF9+regulate+UCP1+expression+independent+of+brown+adipogenesis.">FGF6 and FGF9 regulate UCP1 expression independent of brown adipogenesis.</a> Nature Communications. 11, 1421 (2020).</li><li>Romanelli, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BAd-CRISPR:+Inducible+gene+knockout+in+interscapular+brown+adipose+tissue+of+adult+mice.">BAd-CRISPR: Inducible gene knockout in interscapular brown adipose tissue of adult mice.</a> Journal of Biological Chemistry. 297 (6), 101402 (2021).</li><li>Doench, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+sgRNA+design+to+maximize+activity+and+minimize+off-target+effects+of+CRISPR-Cas9.">Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9.</a> Nature Biotechnology. 34 (2), 184-191 (2016).</li><li>Sanson, K. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+libraries+for+CRISPR-Cas9+genetic+screens+with+multiple+modalities.">Optimized libraries for CRISPR-Cas9 genetic screens with multiple modalities.</a> Nature Communications. 9, 5416 (2018).</li><li>Concordet, J. P., Haeussler, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPOR:+Intuitive+guide+selection+for+CRISPR/Cas9+genome+editing+experiments+and+screens.">CRISPOR: Intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens.</a> Nucleic Acids Research. 46, 242-245 (2018).</li><li>Haeussler, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+off-target+and+on-target+scoring+algorithms+and+integration+into+the+guide+RNA+selection+tool+CRISPOR.">Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR.</a> Genome Biology. 17 (1), 148 (2016).</li><li>Sanjana, N. E., Shalem, O., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+vectors+and+genome-wide+libraries+for+CRISPR+screening.">Improved vectors and genome-wide libraries for CRISPR screening.</a> Nature Methods. 11 (8), 783-784 (2014).</li><li>Tseng, Y. H., Kriauciunas, K. M., Kokkotou, E., Kahn, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+roles+of+insulin+receptor+substrates+in+brown+adipocyte+differentiation.">Differential roles of insulin receptor substrates in brown adipocyte differentiation.</a> Molecular and Cellular Biology. 24 (5), 1918-1929 (2004).</li><li>Eslami, A., Lujan, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Western+blotting:+Sample+preparation+to+detection.">Western blotting: Sample preparation to detection.</a> Journal of Visualized Experiments. (44), e2359 (2010).</li><li>Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Easy+quantitative+assessment+of+genome+editing+by+sequence+trace+decomposition.">Easy quantitative assessment of genome editing by sequence trace decomposition.</a> Nucleic Acids Research. 42 (22), 168 (2014).</li><li>Jarrett, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+genome+editing+with+CRISPR/Cas9+generates+and+corrects+a+metabolic+disease.">Somatic genome editing with CRISPR/Cas9 generates and corrects a metabolic disease.</a> Scientific Reports. 7, 44624 (2017).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+RNA-targeting+CRISPR/Cas13d+technology+outperforms+shRNA+in+identifying+functional+circRNAs.">Optimized RNA-targeting CRISPR/Cas13d technology outperforms shRNA in identifying functional circRNAs.</a> Genome Biology. 22 (1), 41 (2021).</li><li>Fripont, S., Marneffe, C., Marino, M., Rincon, M. Y., Holt, M. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production,+purification,+and+quality+control+for+adeno-associated+virus-based+vectors.">Production, purification, and quality control for adeno-associated virus-based vectors.</a> Journal of Visualized Experiments. (143), e58960 (2019).</li><li>Jimenez, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+adeno-associated+viral+vector-mediated+genetic+engineering+of+white+and+brown+adipose+tissue+in+adult+mice.">In vivo adeno-associated viral vector-mediated genetic engineering of white and brown adipose tissue in adult mice.</a> Diabetes. 62 (12), 4012-4022 (2013).</li><li>Platt, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+knockin+mice+for+genome+editing+and+cancer+modeling.">CRISPR-Cas9 knockin mice for genome editing and cancer modeling.</a> Cell. 159 (2), 440-455 (2014).</li><li>Huang, W., Queen, N. J., Cao, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=rAAV-mediated+gene+delivery+to+adipose+tissue.">rAAV-mediated gene delivery to adipose tissue.</a> Methods in Molecular Biology. 1950, 389-405 (2019).</li><li>Xue, K., Wu, D., Qiu, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+and+efficient+gene+knockout+and+overexpression+in+mouse+interscapular+brown+adipocytes+in+vivo.">Specific and efficient gene knockout and overexpression in mouse interscapular brown adipocytes in vivo.</a> STAR Protocols. 3 (4), 101895 (2022).</li></ol>

The authors have nothing to disclose.

The existing published methods for AAV-mediated gene delivery to the interscapular BAT do not contain detailed pictures and videos describing the surgical techniques and approach for direct AAV injection into the BAT. In most of the published methods33,34, the AAV is injected into the fat tissues surrounding the interscapular BAT instead of the BAT itself. Hence, there are several key steps in this protocol that determine the success of the study. These include t...

Obesity is increasing at a significant rate worldwide, leading to a broad spectrum of metabolic diseases1,2,3. The adipose tissue is key to these pathologies. The two functionally distinct types of adipose tissue that exist are white adipose tissue (WAT), which stores excess calories, and brown adipose tissue (BAT) and its related beige/brite fat, which dissipate energy for thermogenesis. While BAT has been recognized for its energy-dissipating function, it also has endocrine functions via the production of bioactive molecules that regulate metabolism in distal organs4,5. Numerous studies in rodents have demonstrated that increasing the amount or activity of brown or beige fat leads to increased energy expenditure and improved insulin sensitivity. In humans, people with detectable BAT have a significantly lower prevalence of cardiometabolic diseases6. Thus, BAT holds excellent therapeutic potential for obesity-related metabolic sequelae7,8,9.
To investigate the physiology and pathophysiology of BAT development and function and to elucidate the molecular mechanisms involved in these processes, the BAT-specific transgenic mouse model is a method of choice10. The Cre-LoxP recombination system is the most commonly used means to produce conditional knockout mice by editing the mouse genome. This system has enabled the modification (overexpression or knockout) of genes of interest in a tissue/cell-specific manner11. It can also be utilized to label a specific cell type by expressing a selective fluorescent reporter gene.
Recently, the Cre-LoxP system approach has been further developed by combining the CRISPR-Cas9 technology and the adeno-associated virus (AAV) single-guide RNA (sgRNA) system12. The CRISPR-Cas9 system is a specific and efficient gene-editing tool to modify, regulate, or target precise regions of the genome13. CRISPR-Cas9-based genome editing allows for rapid genetic manipulation of genomic loci because it does not require homologous recombination with a gene-targeting vector. Combined Cre-LoxP, CRISPR-Cas9, and AAV-sgRNA techniques enable researchers to understand gene functions more precisely by allowing the investigation of the role of genes of interest at desired times in tissues/cells. Additionally, these combined techniques reduce the time and effort required to generate transgenic mice and allow the temporal control of CRISPR-Cas9 activity for inducible genome editing in mice if an inducible Cre line is used14.
AAV vectors are safe and effective in vivo gene delivery systems. However, AAVs targeting adipose tissue have lagged behind applications in other tissues, such as the brain, heart, liver, and muscle15. Due to the relatively low transduction efficiency and tropism with naturally occurring serotype vectors, AAV-guided gene delivery to adipose tissue is still challenging15. Over the last 5 years, we and others have successfully established effective and minimally invasive ways to deliver AAV-guided genes into adipose tissue and created mouse models that allow us to gain an understanding of the genes involved in the regulation of BAT function16,17,18,19. For example, by using AAV8 to deliver sgRNA targeting Alox12, which encodes 12-lipoxygenase (12-LOX), into the BAT of the Ucp1-Cre/Cas9 mice, we have discovered that activated BAT produces 12-LOX metabolites, namely 12-hydroxy-eicosapentaenoic acid (12-HEPE) and 13R, 14S-dihydroxy docosahexaenoic acid (maresin 2), to regulate glucose metabolism and resolve obesity-associated inflammation, respectively16,17. Here, we provide a step-by-step protocol on the technical procedures, particularly the surgery for the direct microinjection of AAV-sgRNA into the BAT lobes, to generate BAT-specific knockout mice using the combined Cre-LoxP, CRISPR-Cas9, and AAV-sgRNA system.

<table><tbody><tr><td>Chemicals, Peptides and Recombinant Proteins</td><td></td><td></td><td></td></tr><tr><td>OPTI-MEM serum-free medium</td><td>Invitrogen</td><td>31985</td><td></td></tr><tr><td>Polybrene Infection / Transfection Reagent</td><td>Sigma</td><td>TR-1003-G</td><td></td></tr><tr><td>TransIT-LT1 Transfection Reagent</td><td>Mirus</td><td>MIR 2300</td><td></td></tr><tr><td>Recombinant DNA</td><td></td><td></td><td></td></tr><tr><td>lentiCRISPR v2 vector&amp;nbsp;</td><td>Addgene</td><td>52961</td><td></td></tr><tr><td>pAAV-U6-BbsI-gRNA-CB-EmGFP</td><td>Addgene</td><td>89060</td><td></td></tr><tr><td>pMD2.G envelope plasmid</td><td>Addgene</td><td>12259</td><td></td></tr><tr><td>psPAX2 packaging plasmid</td><td>Addgene</td><td>12260</td><td></td></tr><tr><td>Experimental Models: Cell Lines</td><td></td><td></td><td></td></tr><tr><td>HEK-293 cells</td><td>ATCC</td><td>CRL-1573</td><td></td></tr><tr><td>WT-1 cells</td><td>Developed in Tseng lab</td><td>PMID: 14966273</td><td></td></tr><tr><td>Experimental Models: Organisms/Strains</td><td></td><td></td><td></td></tr><tr><td>Cas9 knockin mice</td><td>Jackson Laboratories</td><td>24857</td><td></td></tr><tr><td>Ucp1-CRE mice</td><td>Jackson Laboratories</td><td>24670</td><td></td></tr><tr><td>Others</td><td></td><td></td><td></td></tr><tr><td>Banamine</td><td>Patterson</td><td>07-859-1323</td><td></td></tr><tr><td>Hamilton syringe</td><td>Hamilton</td><td>Model 710 RN Syringe</td><td></td></tr><tr><td>Hydrogen peroxide solution</td><td>Fisher Scientific</td><td>H325-500</td><td></td></tr><tr><td>Needle</td><td>Hamilton</td><td>32 gauge, small hub RN needle, needle point style 2</td><td></td></tr><tr><td>Suture 5-0 Unify PCL25 P-3 Undyed 18 inch Monofilament 12/Bx</td><td>Henry Schein</td><td>1273504</td><td></td></tr><tr><td>Suture 5-0 Unify Silk P-3 Black 18 inch 12/Bx</td><td>Henry Schein</td><td>1294522</td><td></td></tr></tbody></table>

generation of brown fat-specific knockout mice using a combined cre-loxp, crispr-cas9, and adeno-associated virus single-guide rna system

Brown adipose tissue (BAT) is an adipose depot specialized in energy dissipation that can also serve as an endocrine organ via the secretion of bioactive molecules. The creation of BAT-specific knockout mice is one of the most popular approaches for understanding the contribution of a gene of interest to BAT-mediated energy regulation. The conventional gene targeting strategy utilizing the Cre-LoxP system has been the principal approach to generate tissue-specific knockout mice. However, this approach is time-consuming and tedious. Here, we describe a protocol for the rapid and efficient knockout of a gene of interest in BAT using a combined Cre-LoxP, CRISPR-Cas9, and adeno-associated virus (AAV) single-guide RNA (sgRNA) system. The interscapular BAT is located in the deep layer between the muscles. Thus, the BAT must be exposed in order to inject the AAV precisely and directly into the BAT within the visual field. Appropriate surgical handling is crucial to prevent damage to the sympathetic nerves and vessels, such as the Sultzer's vein that connects to the BAT. To minimize tissue damage, there is a critical need to understand the three-dimensional anatomical location of the BAT and the surgical skills required in the technical steps. This protocol highlights the key technical procedures, including the design of sgRNAs targeting the gene of interest, the preparation of AAV-sgRNA particles, and the surgery for the direct microinjection of AAV into both BAT lobes for generating BAT-specific knockout mice, which can be broadly applied to study the biological functions of genes in BAT.

Throughout the above procedures, the precise delivery of AAV-sgRNA to the BAT is crucial to the success of the protocol. To maximize the effect of AAV-sgRNA and minimize the tissue damage during surgery, it is essential to understand the three-dimensional (3D) anatomical location of the BAT. As shown in Figure 3E, it is hard to identify the precise location of the BAT without exposing the tissue. However, excess BAT exposure may damage the tissue (Figure 3<stron...

Watch this Scientific Journal Video about Generation of Brown Fat-Specific Knockout Mice Using a Combined Cre-LoxP, CRISPR-Cas9, and Adeno-Associated Virus Single-Guide RNA System at JoVE.com

Generation of Brown Fat-Specific Knockout Mice Using a Combined Cre-LoxP, CRISPR-Cas9, and Adeno-Associated Virus Single-Guide RNA System

In this protocol, we describe the technical procedures to generate brown adipose tissue (BAT)-specific knockout mice leveraging a combined Cre-LoxP, CRISPR-Cas9, and adeno-associated virus (AAV) single-guide RNA (sgRNA) system. The described steps include the design of the sgRNAs, the preparation of the AAV-sgRNA particles, and the microinjection of AAV into the BAT lobes.

Brown adipose tissue (BAT) is an adipose depot specialized in energy dissipation that can also serve as an endocrine organ via the secretion of bioactive ...

generation-brown-fat-specific-knockout-mice-using-combined-cre-loxp

Research

JoVE Journal

Biology

2.2K Views.  Harvard Medical School. Dit protocol genereert bruine vet-specifieke knock-out muizen met behulp van een Cre-LoxP, CRISPR-Cas9 en adeno-geassocieerd virus single-guide RNA-systeem. Het omvat een chirurgische techniek om AAV veilig toe te dienen in het bruine vet. Het grote voordeel van deze techniek is dat het snel weefselspecifieke knock-outs kan genereren zonder selectief muizen te hoeven fokken.De aanpak voor het maken van weefselspecifieke knock-out of knockdowns kan worden aangepast aan andere weefsels a...

Video: Generation of Brown Fat-Specific Knockout Mice Using a Combined Cre-LoxP, CRISPR-Cas9, and Adeno-Associated Virus Single-Guide RNA System

Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation of gene functions. Their therapeutic potential in the heart can also be determined. There are limited approaches for in vivo molecular intervention in the mouse heart. Recombinant adeno-associated virus (rAAV)-based genome engineering has been utilized as an essential tool for in vivo cardiac gene manipulation. The specific advantages of this technology include high efficiency, high specificity, low genomic integration rate, minimal immunogenicity, and minimal pathogenicity. Here, a detailed procedure to construct, package, and purify the rAAV9 vectors is described. Subcutaneous injection of rAAV9 into neonatal pups results in robust expression or efficient knockdown of the gene(s) of interest in the mouse heart, but not in the liver and other tissues. Using the cardiac-specific TnnT2 promoter, high expression of GFP gene in the heart was obtained. Additionally, target mRNA was inhibited in the heart when a rAAV9-U6-shRNA was utilized. Working knowledge of rAAV9 technology may be useful for cardiovascular investigations.

In this manuscript, a method to prepare recombinant adeno-associated virus 9 (rAAV9) vectors to manipulate gene expression in the mouse heart is described.

Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation ...

Genetics

Development of Knock-Out Muscle Cell Lines using Lentivirus-Mediated CRISPR/Cas9 Gene Editing

One important application of clustered regulatory interspaced short palindromic repeats (CRISPR)/Cas 9 is the development of knock-out cell lines, specifically to study the function of new genes/proteins associated with a disease, identified during the genetic diagnosis. For the development of such cell lines, two major issues have to be untangled: insertion of the CRISPR tools (the Cas9 and the guide RNA) with high efficiency into the chosen cells, and restriction of the Cas9 activity to the specific deletion of the chosen gene. The protocol described here is dedicated to the insertion of the CRISPR tools in difficult to transfect cells, such as muscle cells. This protocol is based on the use of lentiviruses, produced with plasmids publicly available, for which all the cloning steps are described to target a gene of interest. The control of Cas9 activity has been performed using an adaptation of a previously described system called KamiCas9, in which the transduction of the cells with a lentivirus encoding a guide RNA targeting the Cas9 allows the progressive abolition of Cas9 expression. This protocol has been applied to the development of a RYR1-knock out human muscle cell line, which has been further characterized at the protein and functional level, to confirm the knockout of this important calcium channel involved in muscle intracellular calcium release and in excitation-contraction coupling. The procedure described here can easily be applied to other genes in muscle cells or in other difficult to transfect cells and produce valuable tools to study these genes in human cells.

The protocol describes how to generate knock-out myoblasts using CRISPR/Cas9, starting from the design of guide-RNAs to the cellular cloning and characterization of the knock-out clones.

One important application of clustered regulatory interspaced short palindromic repeats (CRISPR)/Cas 9 is the development of knock-out cell lines, ...

Adenovirus-mediated Genetic Removal of Signaling Molecules in Cultured Primary Mouse Embryonic Fibroblasts

The ability to genetically remove specific components of various cell signalling cascades has been an integral tool in modern signal transduction analysis. One particular method to achieve this conditional deletion is via the use of the Cre-loxP system. This method involves flanking the gene of interest with loxP sites, which are specific recognition sequences for the Cre recombinase protein. Exposure of the so-called floxed (flanked by loxP site) DNA to this enzyme results in a Cre-mediated recombination event at the loxP sites, and subsequent excision of the intervening gene3. Several different methods exist to administer Cre recombinase to the site of interest. In this video, we demonstrate the use of an adenovirus containing the Cre recombinase gene to infect primary mouse embryonic fibroblasts (MEFs) obtained from embryos containing a floxed Rac1 allele1. Our rationale for selecting Rac1 MEFs for our experiments is that clear morphological changes can be seen upon deletion of Rac1, due to alterations in the actin cytoskeleton2,5. 72 hours following viral transduction and Cre expression, cells were stained using the actin dye phalloidin and imaged using confocal laser scanning microscopy. It was observed that MEFs which had been exposed to the adeno-Cre virus appeared contracted and elongated in morphology compared to uninfected cells, consistent with previous reports2,5. The adenovirus method of Cre recombinase delivery is advantageous as the adeno-Cre virus is easily available, and gene deletion via Cre in nearly 100% of the cells can be achieved with optimized adenoviral infection.

In this video we use an adenovirus carrying the Cre recombinase gene to infect primary mouse embryonic fibroblasts carrying a floxed Rac1 allele.

The ability to genetically remove specific components of various cell signalling cascades has been an integral tool in modern signal transduction ...

Designing, Packaging, and Delivery of High Titer CRISPR Retro and Lentiviruses via Stereotaxic Injection

Replication defective lentiviruses or retroviruses are capable of stably integrating transgenes into the genome of an infected host cell. This technique has been widely used to encode fluorescent proteins, opto- or chemo-genetic controllers of cell activity, or heterologous expression of human genes in model organisms. These viruses have also successfully been used to deliver recombinases to relevant target sites in transgenic animals, or even deliver small hairpin or micro RNAs in order to manipulate gene expression. While these techniques have been fruitful, they rely on transgenic animals (recombinases) or frequently lack high efficacy and specificity (shRNA/miRNA). In contrast, the CRISPR/Cas system uses an exogenous Cas nuclease which targets specific sites in an organism's genome via an exogenous guide RNA in order to induce double stranded breaks in DNA. These breaks are then repaired by non-homologous end joining (NHEJ), producing insertion and deletion (indel) mutations that can result in deleterious missense or nonsense mutations. This manuscript provides detailed methods for the design, production, injection, and validation of single lenti/retro virus particles that can stably transduce neurons to express a fluorescent reporter, Cas9, and sgRNAs to knockout genes in a model organism.

The CRISPR/Cas9 system offers the potential to make targeted genome editing accessible and affordable to the scientific community. This protocol is intended to demonstrate how to create viruses that will knockout a gene of interest using the CRISPR/Cas9 system, and then inject them stereotaxically into the adult mouse brain.

Replication defective lentiviruses or retroviruses are capable of stably integrating transgenes into the genome of an infected host cell. This technique ...

Neuroscience

Lentiviral CRISPR/Cas9-Mediated Genome Editing for the Study of Hematopoietic Cells in Disease Models

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting from advances in genome editing technology and lentivirus-mediated transgene delivery systems, an efficient and economical method is described here that establishes mice in which genes are manipulated specifically in hematopoietic stem cells. Lentiviruses are used to transduce Cas9-expressing lineage-negative bone marrow cells with a guide RNA (gRNA) targeting specific genes and a red fluorescence reporter gene (RFP), then these cells are transplanted into lethally-irradiated C57BL/6 mice. Mice transplanted with lentivirus expressing non-targeting gRNA are used as controls. Engraftment of transduced hematopoietic stem cells are evaluated by flow cytometric analysis of RFP-positive leukocytes of peripheral blood. Using this method, ~90% transduction of myeloid cells and ~70% of lymphoid cells at 4 weeks after transplantation can be achieved. Genomic DNA is isolated from RFP-positive blood cells, and portions of the targeted site DNA are amplified by PCR to validate the genome editing. This protocol provides a high-throughput evaluation of hematopoiesis-regulatory genes and can be extended to a variety of mouse disease models with hematopoietic cell involvement.

Described are protocols for the highly efficient genome editing of murine hematopoietic stem and progenitor cells (HSPC) by the CRISPR/Cas9 system to rapidly develop mouse model systems with hematopoietic system-specific gene modifications.

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting ...

Immunology and Infection

Adeno-Associated Virus-Mediated Delivery of CRISPR for Cardiac Gene Editing in Mice

The clustered, regularly interspaced, short, palindromic repeat (CRISPR) system has greatly facilitated genome engineering in both cultured cells and living organisms from a wide variety of species. The CRISPR technology has also been explored as novel therapeutics for a number of human diseases. Proof-of-concept data are highly encouraging as exemplified by recent studies that demonstrate the feasibility and efficacy of gene editing-based therapeutic approach for Duchenne muscular dystrophy (DMD) using a murine model. In particular, intravenous and intraperitoneal injection of the recombinant adeno-associated virus (rAAV) serotype rh.74 (rAAVrh.74) has enabled efficient cardiac delivery of the Staphylococcus aureus CRISPR-associated protein 9 (SaCas9) and two guide RNAs (gRNA) to delete a genomic region with a mutant codon in exon 23 of mouse Dmd gene. This same approach can also be used to knock out the gene-of-interest and study their cardiac function in postnatal mice when the gRNA is designed to target the coding region of the gene. In this protocol, we show in detail how to engineer rAAVrh.74-CRISPR vector and how to achieve highly efficient cardiac delivery in neonatal mice.

Here we provide a detailed protocol to carry out in vivo cardiac gene editing in mice using recombinant Adeno-Associated Virus(rAAV)-mediated delivery of CRISPR. This protocol offers a promising therapeutic strategy to treat dystrophic cardiomyopathy in Duchenne muscular dystrophy and can be used to generate cardiac-specific knockout in postnatal mice.

The clustered, regularly interspaced, short, palindromic repeat (CRISPR) system has greatly facilitated genome engineering in both cultured cells and ...

Medicine

Investigation of Beige Fat Biology and Metabolism Using the CRISPR SunTag-p65-HSF1 Activation System

Clustered regularly interspaced short palindromic repeats (CRISPR) technology has prompted a revolution in biology, and recent tools have been applied far beyond the originally described gene editing. The CRISPR activation (CRISPRa) system combines the catalytically inactive Cas9 (dCas9) protein with distinct transcription modules to induce endogenous gene expression. SunTag-p65-HSF1 (SPH) is a recently developed CRISPRa technology that combines components of synergistic activation mediators (SAMs) with the SunTag activators. This system allows the overexpression of single or multiple genes by designing a customized single-guide RNA (sgRNA). In this study, a previously developed SPH mouse was used to generate a conditional mouse expressing SPH in adipocytes (adiponectin Cre lineage), named AdipoSPH. To induce a white-to-beige fat (browning) phenotype, an adeno-associated virus (AAV) carrying sgRNA targeting the endogenous Prdm16 gene (a well-established transcription factor related to brown and beige fat development) was injected into the inguinal white adipose tissue (iWAT). This mouse model induced the expression of endogenous Prdm16 and activated the thermogenic gene program. Moreover, in vitro SPH-induced Prdm16 overexpression enhanced the oxygen consumption of beige adipocytes, phenocopying the results of a previous Prdm16 transgenic mouse model. Thus, this protocol describes a versatile, cost-effective, and time-effective mouse model for investigating adipose tissue biology.

This protocol presents the use of CRISPR SunTag-p65-HSF1 (SPH) in adipocytes (AdipoSPH) as an alternative strategy to adeno-associated virus (AAV) for investigating beige fat biology. In vivo injection of AAV-carrying sgRNA targeting the endogenous Prdm16 gene is sufficient to induce beige fat development and enhance the thermogenic gene program.

Clustered regularly interspaced short palindromic repeats (CRISPR) technology has prompted a revolution in biology, and recent tools have been applied far ...

Bioengineering

Isolating Brown Adipocytes from Murine Interscapular Brown Adipose Tissue for Gene and Protein Expression Analysis

Brown adipose tissue (BAT) is responsible for non-shivering thermogenesis in mammals, and brown adipocytes (BAs) are the functional units of BAT. BAs contain both multilocular lipid droplets and abundant mitochondria, and they express uncoupling protein 1 (UCP1). BAs are categorized into two sub-types based on their origin: embryo derived classical BAs (cBAs) and white adipocytes derived BAs. Due to their relatively low density, BAs cannot be isolated from BAT with traditional centrifugation method. In this study, a new method was developed to isolate BAs from mice for gene and protein expression analysis. In this protocol, interscapular BAT from adult mice was digested with Collagenase and Dispase solution, and the dissociated BAs were enriched with 6% iodixanol solution. Isolated BAs were then lysed with Trizol&#160;reagent for simultaneous isolation of RNA, DNA, and protein. After RNA isolation, the organic phase of the lysate was used for protein extraction. Our data showed that 6% iodixanol solution efficiently enriched BAs without interfering with follow-up gene and protein expression studies. Platelet-derived growth factor (PDGF) is a growth factor that regulates the growth and proliferation of mesenchymal cells. Compared to the brown adipose tissue, isolated BAs had significantly higher expression of Pdgfa. In summary, this new method provides a platform for studying the biology of brown adipocytes at a single cell-type level.

This study describes a new method of isolating murine brown adipocytes for gene and protein expression analysis.

Brown adipose tissue (BAT) is responsible for non-shivering thermogenesis in mammals, and brown adipocytes (BAs) are the functional units of BAT. BAs ...

Retroviral Transduction of Guide RNA for Gene Editing in Th17 Differentiation

Retroviral CRISPR/Cas9-Mediated Gene Targeting for the Study of Th17 Differentiation in Vitro

T helper cells that produce IL-17A, known as Th17 cells, play a critical role in immune defense and are implicated in autoimmune disorders. CD4 T cells can be stimulated with antigens and well-defined cytokine cocktails in vitro to mimic Th17 cell differentiation in vivo. Research has been conducted extensively on the Th17 differentiation regulation mechanisms using the in vitro Th17 polarization assay.
Conventional Th17 polarization methods typically involve obtaining na&#239;ve CD4 T cells from genetically modified mice to study the effects of specific genes on Th17 differentiation and function. These methods can be time-consuming and costly and may be influenced by cell-extrinsic factors from the knockout animals. Thus, a protocol using retroviral transduction of guide RNA to introduce gene knockout in CRISPR/Cas9 knockin primary mouse T cells serves as a very useful alternative approach. This paper presents a protocol to differentiate na&#239;ve primary T cells into Th17 cells following retroviral-mediated gene targeting, as well as the subsequent flow cytometry analysis methods for assaying infection and differentiation efficiency.

We present a protocol for retroviral transduction of guide RNA into primary T cells from Cas9 transgenic mice, providing an efficient alternative for gene editing in studying Th17 differentiation.

T helper cells that produce IL-17A, known as Th17 cells, play a critical role in immune defense and are implicated in autoimmune disorders. CD4 T cells ...

Removal of an Internal Translational Start Site from mRNA While Retaining Expression of the Full-Length Protein

The CRISPR-Cas9 gene-editing system, based on genome repair mechanisms, enables the generation of gene-modified mouse models more quickly and easily relative to traditional homologous recombination. The CRISPR-Cas9 system is particularly attractive when a single-point mutation is desired. The gap junction protein, Connexin 43 (Cx43), is encoded by gene Gja1, which has a single coding exon and cannot be spliced. However, Gja1 produces not only full-length Cx43 protein but up to six N-terminus truncated isoforms by a process known as internal translation, the result of ribosomal translation initiation at internal AUG (Methionine) start sites. GJA1-20k is the most commonly generated truncated isoform of Cx43 initiated at the AUG codon at position 213 of Gja1 mRNA. Because residue 213 occurs at the end of the last transmembrane domain of Cx43, GJA1-20k is effectively the 20 kDa C-terminus tail of Cx43 as an independent protein. Previous investigators identified, in cells, that a critical role of GJA1-20k is to facilitate trafficking of full-length Cx43 gap junction hemichannels to the plasma membrane. To examine this phenomenon in vivo, a mutant mouse with a Gja1 point-mutation was generated that replaces the ATG (Methionine) at residue 213 with TTA (Leucine, M213L mutation). The result of M213L is that Gja1 mRNA and full-length Cx43 are still generated, yet the translation of Gja1-20k is significantly reduced. This report focuses on choosing the restriction enzyme site to develop a one amino acid mutated (Gja1M213L/M213L) mouse model. This protocol describes genetically modified mice by the CRISPR-Cas9 system and rapid genotyping by combining PCR and restriction enzyme treatments.

The present protocol describes a single M213L mutation in Gja1 that retains full-length Connexin43 generation but prevents translation of the smaller GJA1-20k internally translated isoform.

The CRISPR-Cas9 gene-editing system, based on genome repair mechanisms, enables the generation of gene-modified mouse models more quickly and easily ...

Generation of Brown Fat-Specific Knockout Mice Using a Combined Cre-LoxP, CRISPR-Cas9, and Adeno-Associated Virus Single-Guide RNA System

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video