Special thanks to Kris Reddi at UCLA for setting up reagents and pouring gels and to Erin Sanders at UCLA for inspiration, guidance, and support and proofreading the manuscript. I would also like to thanks Giancarlo Costaguta and Gregory S. Payne for supplying the yeast genomic DNA and primers to amplify the GAL3 gene. I would also like to thank Bhairav Shah for taking pictures of the lab equipment and reagents used to make figures 2 - 4. Funding for this project was provided by HHMI (HHMI Grant No. 52006944).

<ol>
	<li>Albert, J., Fenyo, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+sensitive,+and+specific+detection+of+human+immunodeficiency+virus+type+1+in+clinical+specimens+by+polymerase+chain+reaction+with+nested+primers.">Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers.</a> J. Clin. Microbiol. 28, 1560-1564 (1990).</li><li>Baskaran, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uniform+amplification+of+a+mixture+of+deoxyribonucleic+acids+with+varying+GC+content.">Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content.</a> Genome Res. 6, 633-638 (1996).</li><li>Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+buffer+optimization+with+uniform+temperature+regimen+to+facilitate+automation.">PCR buffer optimization with uniform temperature regimen to facilitate automation.</a> PCR Methods Appl. 2, 234-240 (1993).</li><li>Borer, P. N., Dengler, B., Tinoco, I., Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stability+of+ribonucleic+acid+double-stranded+helices.">Stability of ribonucleic acid double-stranded helices.</a> J. Mol. Biol. 86, 843-853 (1974).</li><li>Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+DNA+duplex+stability+from+the+base+sequence.">Predicting DNA duplex stability from the base sequence.</a> Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).</li><li>Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevention+of+pre-PCR+mis-priming+and+primer+dimerization+improves+low-copy-number+amplifications.">Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications.</a> Nucleic Acids Res. 20, 1717-1723 (1992).</li><li>Coleman, W. B., Tsongalis, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Diagnostics for the clinical laboration. , (2005).</li><li>D'Aquila, R. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maximizing+sensitivity+and+specificity+of+PCR+by+pre-amplification+heating.">Maximizing sensitivity and specificity of PCR by pre-amplification heating.</a> Nucleic Acids Res. 19, 3749 (1991).</li><li>Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+concepts+for+PCR+primer+design.">General concepts for PCR primer design.</a> PCR Methods Appl. 3, S30-S37 (1993).</li><li>Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term='Touchdown'+PCR+to+circumvent+spurious+priming+during+gene+amplification.">'Touchdown' PCR to circumvent spurious priming during gene amplification.</a> Nucleic Acids Res. 19, 4008 (1991).</li><li>Erlich, H. A., Gelfand, D., Sninsky, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+the+polymerase+chain+reaction.">Recent advances in the polymerase chain reaction.</a> Science. 252, 1643-1651 (1991).</li><li>Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-amplification+of+GC-rich+regions:+'slowdown+PCR.">PCR-amplification of GC-rich regions: 'slowdown PCR.</a> Nat. Protoc. 3, 1312-1317 (2008).</li><li>Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+amplification+with+PCR+of+a+refractory+segment+of+genomic+DNA.">Specific amplification with PCR of a refractory segment of genomic DNA.</a> Nucleic Acids Res. 16, 11844 (1988).</li><li>Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+improves+the+PCR+amplification+of+GC-rich+DNA+sequences.">Betaine improves the PCR amplification of GC-rich DNA sequences.</a> Nucleic Acids Res. 25, 3957-3958 (1997).</li><li>Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> PCR Protocols: A guide to methods and applications. , (1990).</li><li>King, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Molecular Biology. 630, (2010).</li><li>Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+polynucleotides.+XCVI.+Repair+replications+of+short+synthetic+DNA's+as+catalyzed+by+DNA+polymerases.">Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases.</a> J. Mol. Biol. 56, 341-361 (1971).</li><li>Korbie, D. J., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Touchdown+PCR+for+increased+specificity+and+sensitivity+in+PCR+amplification.">Touchdown PCR for increased specificity and sensitivity in PCR amplification.</a> Nat. Protoc. 3, 1452-1456 (2008).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+DNA+by+PCR:+standard+procedures+and+optimization.">Enzymatic amplification of DNA by PCR: standard procedures and optimization.</a> Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction.">The polymerase chain reaction.</a> Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).</li><li>Kreader, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relief+of+amplification+inhibition+in+PCR+with+bovine+serum+albumin+or+T4+gene+32+protein.">Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein.</a> Appl. Environ. Microbiol. 62, 1102-1106 (1996).</li><li>Kwok, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+human+immunodeficiency+virus+sequences+by+using+in+vitro+enzymatic+amplification+and+oligomer+cleavage+detection.">Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection.</a> J. Virol. 61, 1690-1694 (1987).</li><li>McConlogue, L., Brow, M. A., Innis, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure-independent+DNA+amplification+by+PCR+using+7-deaza-2'-deoxyguanosine.">Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine.</a> Nucleic Acids Res. 16, 9869 (1988).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+unusual+origin+of+the+polymerase+chain+reaction.">The unusual origin of the polymerase chain reaction.</a> Sci. Am. 262, 56-65 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Target+amplification+for+DNA+analysis+by+the+polymerase+chain+reaction.">Target amplification for DNA analysis by the polymerase chain reaction.</a> Ann. Biol. Clin. (Paris). 48, 579-582 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction+in+an+anemic+mode:+how+to+avoid+cold+oligodeoxyribonuclear+fusion).">The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion).</a> PCR Methods Appl. 1, 1-4 (1991).</li><li>Mullis, K. B., Faloona, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+synthesis+of+DNA+in+vitro+via+a+polymerase-catalyzed+chain+reaction.">Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.</a> Methods Enzymol. 155, 335-350 (1987).</li><li>Paabo, S., Gifford, J. A., Wilson, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+sequences+from+a+7000-year+old+brain.">Mitochondrial DNA sequences from a 7000-year old brain.</a> Nucleic Acids Res. 16, 9775-9787 (1988).</li><li>Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+can+eliminate+the+base+pair+composition+dependence+of+DNA+melting.">Betaine can eliminate the base pair composition dependence of DNA melting.</a> Biochemistry. 32, 137-144 (1993).</li><li>Roux, K. H., Hecker, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+optimization+using+touchdown+and+stepdown+PCR.">One-step optimization using touchdown and stepdown PCR.</a> Methods Mol. Biol. 67, 39-45 (1997).</li><li>Rychlik, W., Spencer, W. J., Rhoads, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+the+annealing+temperature+for+DNA+amplification+in+vitro.">Optimization of the annealing temperature for DNA amplification in vitro.</a> Nucleic Acids Res. 18, 6409-6412 (1990).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer-directed+enzymatic+amplification+of+DNA+with+a+thermostable+DNA+polymerase.">Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.</a> Science. 239, 487-491 (1988).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+beta-globin+genomic+sequences+and+restriction+site+analysis+for+diagnosis+of+sickle+cell+anemia.">Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.</a> Science. 230, 1350-1354 (1985).</li><li>Sambrook, J. A. R., David, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning A Laboratory Manual. 2, (2001).</li><li>Sarkar, G., Kapelner, S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formamide+can+dramatically+improve+the+specificity+of+PCR.">Formamide can dramatically improve the specificity of PCR.</a> Nucleic Acids Res. 18, 7465 (1990).</li><li>Smit, V. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KRAS+codon+12+mutations+occur+very+frequently+in+pancreatic+adenocarcinomas.">KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas.</a> Nucleic Acids Res. 16, 7773-7782 (1988).</li><li>Wilson, I. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+and+facilitation+of+nucleic+acid+amplification.">Inhibition and facilitation of nucleic acid amplification.</a> Appl. Environ. Microbiol. 63, 3741-3751 (1997).</li><li>Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Enzymology. 218, (1993).</li></ol>

I have nothing to disclose.

PCR has become an indispensible tool in the biological science arsenal. PCR has altered the course of science allowing biologists to yield power over genomes, and make hybrid genes with novel functions, allowing specific and accurate clinical testing, gaining insights into genomes and diversity, as well as simply cloning genes for further biochemical analysis. PCR application is limited only by the imagination of the scientist that wields its power. There are many books and papers that describe new specialized uses of PCR, and many more will be developed over the next generation of biological science. However, regardless of the anticipated approaches, the fundamental framework has remained the same. PCR, in all its grandeur, is an in vitro application to generate large quantities of a specific segment of DNA. 
Designing a PCR experiment requires thought and patience. The results shown in Figure 3 exemplify one of the major challenges when designing an optimization strategy for PCR. That is, as one parameter of PCR is changed, it may impact another. As an example, if the initial PCR was carried out at the sub-optimal annealing temperature (58&deg;C) with an optimal Mg2+ concentration of 2.0 mM, then the result would produce a smear as seen in Figure 3c. An attempt to resolve the smear might involve setting up PCR conditions with reactions containing 2.0 mM MgCl2 and adjusting the annealing temperature to 61&deg;C. However, as seen in Figure 3a, this would not yield any product. Consequently, it is advisable to titrate reagents, rather than adding one concentration to a single reaction, when troubleshooting spurious results. Also, the most common adjustments that are required for optimizing a PCR experiment are to change the Mg2+ concentration and to correct the annealing temperatures. However, if these changes do not minimize or abrogate aberrant results, titration of additives and /or changing the cycling condition protocols as described in Tables 2-6 may alleviate the problem. If all else fails, redesign the primers and try, try again.

<table border="1">
 <tbody>
<tr>
 <td>Name of the reagent</td>
 <td>Company</td>
 <td>Catalogue number</td>
 <td>Comments </td>
 </tr>
 <tr>
 <td>Taq Polymeras</td>
 <td>Sigma</td>
 <td>D4545-25UN</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>dNTPs</td>
 <td>Qiagen</td>
 <td>201225</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>0.2 ml Thin Wall Tubes PCR tubes </td>
 <td>Bio Rad</td>
 <td>223-9469</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>0.2 ml Thin Wall Tube caps</td>
 <td>Bio Rad</td>
 <td>223-9472</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>TE Buffer:</td>
 <td>&nbsp;</td>
 <td>&nbsp;</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>&nbsp;&nbsp;EDTA 			disodium salt dihydrate</td>
 <td>Sigma</td>
 <td>E5134</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>&nbsp;&nbsp;Trizma-HCl</td>
 <td>Sigma</td>
 <td>T-3253</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>Custom Phage 			Primer</td>
 <td>Invitrogen</td>
 <td colspan="2">25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG</td>
 </tr>
 <tr>
 <td>Custom Phage 			Primer</td>
 <td>Invitrogen</td>
 <td colspan="2">26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT</td>
 </tr>
 <tr>
 <td>Custom Yeast 			Primer</td>
 <td>Integrated DNA Technologies</td>
 <td colspan="2">SacI-Gal3(-256) 			ACCTGGAGCTCCTATTT
 TAACATGTGGATTTCTTGAAAGAATGAAATCG</td>
 </tr>
 <tr>
 <td>Custom Yeast 			Primer</td>
 <td>Integrated DNA Technologies</td>
 <td colspan="2">Gal3(1848)-SacI 			CGGATGGAGCTCGCGT
 GAAGGTAATTTTTTTTTATGTCTCCG</td>
 </tr>
 <tr>
 <td>Thermal 			Cycler </td>
 <td>Bio Rad</td>
 <td>170-9703</td>
 <td>My Cycler</td>
 </tr>
 <tr>
 <td>Agarose</td>
 <td>ISC BioExpress</td>
 <td>E-3120-500</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>Gel 			electrophoresis </td>
 <td>Hoeffer Scientific Instruments</td>
 <td>Model HE33</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>1 kb DNA 			Ladder </td>
 <td>New England BioLabs</td>
 <td>N3232S</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>Bio Rad Power Pack</td>
 <td>Bio Rad</td>
 <td>164-5050</td>
 <td>PowerPac Basic </td>
 </tr>
 <tr>
 <td>Gel Doc system</td>
 <td>Fotodyne Incorporated</td>
 <td colspan="2">FOTO/Analyst Investigator FX Workstation</td>
 </tr>
</tbody>
</table>

polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek&#39;s microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase.
PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: 
 
&#9679; Set up reactions and thermal cycling conditions for a conventional PCR experiment 
&#9679; Understand the function of various reaction components and their overall effect on a PCR experiment 
&#9679; Design and optimize a PCR experiment for any DNA template 
&#9679; Troubleshoot failed PCR experiments

Watch this Scientific Journal Video about Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies at JoVE.com

Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

PCR has emerged as a common technique in many molecular biology laboratories. Provided here is a quick guide to several conventional PCR protocols. Because each reaction is a unique experiment, optimal conditions required to generate a product vary. Understanding the variables in a reaction will greatly enhance troubleshooting efficiency, thereby increasing the chance to obtain the desired result.

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of ...

polymerase-chain-reaction-basic-protocol-plus-troubleshooting

Research

JoVE Journal

Biology

399.2K Views.  University of California, Los Angeles. PCR has emerged as a common technique in many molecular biology laboratories. Provided here is a quick guide to several conventional PCR protocols. Because each reaction is a unique experiment, optimal conditions required to generate a product vary. Understanding the variables in a reaction will greatly enhance troubleshooting efficiency, thereby increasing the chance to obtain the desired result.