Reaktifler kurma ve jeller dökme ve UCLA Erin Sanders ilham, rehberlik ve destek için ve yazının redaksiyon için UCLA Kris Reddi özel teşekkürler. Ben de GAL3 gen yükseltmek için maya genomik DNA ve primer temini için teşekkürler Giancarlo Costaguta ve Gregory S. Payne istiyorum. 4 - Ben de laboratuar ekipmanları ve rakamlar 2 yapmak için kullanılan reaktiflerin resmini çekmek için Bhairav ​​Şah teşekkür etmek istiyorum. Bu proje için finansman HHMI (HHMI Hibe No 52.006.944) tarafından sağlandı.

<ol>
	<li>Albert, J., Fenyo, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+sensitive,+and+specific+detection+of+human+immunodeficiency+virus+type+1+in+clinical+specimens+by+polymerase+chain+reaction+with+nested+primers.">Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers.</a> J. Clin. Microbiol. 28, 1560-1564 (1990).</li><li>Baskaran, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uniform+amplification+of+a+mixture+of+deoxyribonucleic+acids+with+varying+GC+content.">Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content.</a> Genome Res. 6, 633-638 (1996).</li><li>Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+buffer+optimization+with+uniform+temperature+regimen+to+facilitate+automation.">PCR buffer optimization with uniform temperature regimen to facilitate automation.</a> PCR Methods Appl. 2, 234-240 (1993).</li><li>Borer, P. N., Dengler, B., Tinoco, I., Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stability+of+ribonucleic+acid+double-stranded+helices.">Stability of ribonucleic acid double-stranded helices.</a> J. Mol. Biol. 86, 843-853 (1974).</li><li>Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+DNA+duplex+stability+from+the+base+sequence.">Predicting DNA duplex stability from the base sequence.</a> Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).</li><li>Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevention+of+pre-PCR+mis-priming+and+primer+dimerization+improves+low-copy-number+amplifications.">Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications.</a> Nucleic Acids Res. 20, 1717-1723 (1992).</li><li>Coleman, W. B., Tsongalis, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Diagnostics for the clinical laboration. , (2005).</li><li>D'Aquila, R. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maximizing+sensitivity+and+specificity+of+PCR+by+pre-amplification+heating.">Maximizing sensitivity and specificity of PCR by pre-amplification heating.</a> Nucleic Acids Res. 19, 3749 (1991).</li><li>Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+concepts+for+PCR+primer+design.">General concepts for PCR primer design.</a> PCR Methods Appl. 3, S30-S37 (1993).</li><li>Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term='Touchdown'+PCR+to+circumvent+spurious+priming+during+gene+amplification.">'Touchdown' PCR to circumvent spurious priming during gene amplification.</a> Nucleic Acids Res. 19, 4008 (1991).</li><li>Erlich, H. A., Gelfand, D., Sninsky, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+the+polymerase+chain+reaction.">Recent advances in the polymerase chain reaction.</a> Science. 252, 1643-1651 (1991).</li><li>Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-amplification+of+GC-rich+regions:+'slowdown+PCR.">PCR-amplification of GC-rich regions: 'slowdown PCR.</a> Nat. Protoc. 3, 1312-1317 (2008).</li><li>Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+amplification+with+PCR+of+a+refractory+segment+of+genomic+DNA.">Specific amplification with PCR of a refractory segment of genomic DNA.</a> Nucleic Acids Res. 16, 11844 (1988).</li><li>Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+improves+the+PCR+amplification+of+GC-rich+DNA+sequences.">Betaine improves the PCR amplification of GC-rich DNA sequences.</a> Nucleic Acids Res. 25, 3957-3958 (1997).</li><li>Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> PCR Protocols: A guide to methods and applications. , (1990).</li><li>King, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Molecular Biology. 630, (2010).</li><li>Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+polynucleotides.+XCVI.+Repair+replications+of+short+synthetic+DNA's+as+catalyzed+by+DNA+polymerases.">Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases.</a> J. Mol. Biol. 56, 341-361 (1971).</li><li>Korbie, D. J., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Touchdown+PCR+for+increased+specificity+and+sensitivity+in+PCR+amplification.">Touchdown PCR for increased specificity and sensitivity in PCR amplification.</a> Nat. Protoc. 3, 1452-1456 (2008).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+DNA+by+PCR:+standard+procedures+and+optimization.">Enzymatic amplification of DNA by PCR: standard procedures and optimization.</a> Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction.">The polymerase chain reaction.</a> Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).</li><li>Kreader, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relief+of+amplification+inhibition+in+PCR+with+bovine+serum+albumin+or+T4+gene+32+protein.">Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein.</a> Appl. Environ. Microbiol. 62, 1102-1106 (1996).</li><li>Kwok, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+human+immunodeficiency+virus+sequences+by+using+in+vitro+enzymatic+amplification+and+oligomer+cleavage+detection.">Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection.</a> J. Virol. 61, 1690-1694 (1987).</li><li>McConlogue, L., Brow, M. A., Innis, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure-independent+DNA+amplification+by+PCR+using+7-deaza-2'-deoxyguanosine.">Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine.</a> Nucleic Acids Res. 16, 9869 (1988).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+unusual+origin+of+the+polymerase+chain+reaction.">The unusual origin of the polymerase chain reaction.</a> Sci. Am. 262, 56-65 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Target+amplification+for+DNA+analysis+by+the+polymerase+chain+reaction.">Target amplification for DNA analysis by the polymerase chain reaction.</a> Ann. Biol. Clin. (Paris). 48, 579-582 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction+in+an+anemic+mode:+how+to+avoid+cold+oligodeoxyribonuclear+fusion).">The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion).</a> PCR Methods Appl. 1, 1-4 (1991).</li><li>Mullis, K. B., Faloona, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+synthesis+of+DNA+in+vitro+via+a+polymerase-catalyzed+chain+reaction.">Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.</a> Methods Enzymol. 155, 335-350 (1987).</li><li>Paabo, S., Gifford, J. A., Wilson, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+sequences+from+a+7000-year+old+brain.">Mitochondrial DNA sequences from a 7000-year old brain.</a> Nucleic Acids Res. 16, 9775-9787 (1988).</li><li>Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+can+eliminate+the+base+pair+composition+dependence+of+DNA+melting.">Betaine can eliminate the base pair composition dependence of DNA melting.</a> Biochemistry. 32, 137-144 (1993).</li><li>Roux, K. H., Hecker, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+optimization+using+touchdown+and+stepdown+PCR.">One-step optimization using touchdown and stepdown PCR.</a> Methods Mol. Biol. 67, 39-45 (1997).</li><li>Rychlik, W., Spencer, W. J., Rhoads, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+the+annealing+temperature+for+DNA+amplification+in+vitro.">Optimization of the annealing temperature for DNA amplification in vitro.</a> Nucleic Acids Res. 18, 6409-6412 (1990).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer-directed+enzymatic+amplification+of+DNA+with+a+thermostable+DNA+polymerase.">Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.</a> Science. 239, 487-491 (1988).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+beta-globin+genomic+sequences+and+restriction+site+analysis+for+diagnosis+of+sickle+cell+anemia.">Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.</a> Science. 230, 1350-1354 (1985).</li><li>Sambrook, J. A. R., David, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning A Laboratory Manual. 2, (2001).</li><li>Sarkar, G., Kapelner, S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formamide+can+dramatically+improve+the+specificity+of+PCR.">Formamide can dramatically improve the specificity of PCR.</a> Nucleic Acids Res. 18, 7465 (1990).</li><li>Smit, V. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KRAS+codon+12+mutations+occur+very+frequently+in+pancreatic+adenocarcinomas.">KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas.</a> Nucleic Acids Res. 16, 7773-7782 (1988).</li><li>Wilson, I. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+and+facilitation+of+nucleic+acid+amplification.">Inhibition and facilitation of nucleic acid amplification.</a> Appl. Environ. Microbiol. 63, 3741-3751 (1997).</li><li>Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Enzymology. 218, (1993).</li></ol>

Ben ifşa hiçbir şey yok.

PCR biyolojik bilim cephanelik vazgeçilmez bir araç haline gelmiştir. PCR genomlar ve çeşitliliğin yanı sıra, daha fazla biyokimyasal analiz için sadece klonlama genler ilgili bilgi sağlamak, özel ve doğru bir klinik test sağlayan, biyologlar genomlarını gücü verim ve yeni fonksiyonları ile hibrid genlerin yapmak için izin bilim elbette değiştirdi. PCR uygulaması sadece kendi gücünü kullanır bilim adamı hayal gücü ile sınırlıdır. Orada PCR yeni özel kullanır tanımlayan pek çok kitap ve makaleler, ve daha birçok biyolojik bilim nesil içinde geliştirilecektir. Ancak, ne olursa olsun, beklenen yaklaşımlar, temel çerçeve aynı kalmıştır. PCR, tüm Haşmetli, DNA segment belirli bir miktarda elde etmek için bir in vitro bir uygulamadır. PCR deney tasarlama düşünce ve sabır gerektirir. Şekil 3&#39;te gösterilen sonuçlar büyük CH biri örneklendirmekPCR için bir optimizasyon stratejisini tasarlarken allenges. PCR ile bir parametre olarak değişir, bu, başka bir etkileyebilir. İlk PCR optimal bir Mg 2 2.0 mM + konsantrasyonu ile optimal tavlama sıcaklığında (58 ° C) gerçekleştirilmiştir halinde, örnek olarak, daha sonra Sonuç Şekil 3c &#39;de görüldüğü gibi, bir yayma üretecektir. Smear çözmek için bir girişimde 2.0 mM MgCl2 içeren reaksiyonlar PCR koşulları kurma ve 61 ° C&#39;ye tavlama sıcaklığının ayarlanması içerebilir Bununla birlikte, Şekil 3a de görüldüğü gibi, bu herhangi bir ürünü vermek olmaz. Sonuç olarak, daha ziyade istenmeyen sonuçlar giderme olduğunda, tek bir reaksiyon için bir konsantrasyonda eklenmesi dışında, reaktifler titre tavsiye edilir. Ayrıca, bir PCR deneyi optimize etmek için gerekli olan en yaygın ayarlamalar Mg 2 + konsantrasyonu değiştirmek için ve tavlama düzeltmek için bulunmaktadır. Ancak, bu değişiklikler en aza indirmek veya anormal sonuçlar feshetmek, katk titrasyonu yoksaves ve / veya Tablo 2-6 açıklanan bisiklet koşulu protokolleri değiştirerek sorunu hafifletmek olabilir. Tümü başarısız olursa, astar yeniden tasarlamak ve denemek, yeniden deneyin.

<table border="1"><tbody><tr><td> Reaktif Adı </td><td> Şirket </td><td> Katalog numarası </td><td> Yorumlar </td></tr><tr><td> Taq Polymeras </td><td> Sigma </td><td> D4545-25UN </td><td></td></tr><tr><td> dNTP </td><td> Qiagen </td><td> 201225 </td><td></td></tr><tr><td> 0.2 ml İnce Duvar Tüpler PCR tüpleri </td><td> Bio Rad </td><td> 223-9469 </td><td></td></tr><tr><td> 0.2 ml İnce Duvar Tüp kapakları </td><td> Bio Rad </td><td> 223-9472 </td><td></td></tr><tr><td> TE Tamponu: </td><td></td><td></td><td></td></tr><tr><td> EDTA disodyum tuzu dihidrat </td><td> Sigma </td><td> E5134 </td><td></td></tr><tr><td> Trizma-HCl </td><td> Sigma </td><td> T-3253 </td><td></td></tr><tr><td> Özel Faj Astar </td><td> Invitrogen </td><td colspan="2"> 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG </td></tr><tr><td> Özel Faj Astar </td><td> Invitrogen </td><td colspan="2"> 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT </td></tr><tr><td> Özel Maya Astar </td><td> Entegre DNA Teknolojileri </td><td colspan="2"> SacI-Gal3 (-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG </td></tr><tr><td> Özel Maya Astar </td><td> Entegre DNA Teknolojileri </td><td colspan="2"> Gal3 (1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG </td></tr><tr><td> Termal Cycler </td><td> Bio Rad </td><td> 170-9703 </td><td> Benim Cycler </td></tr><tr><td> Agaroz </td><td> ISC BioExpress </td><td> E-3120-500 </td><td></td></tr><tr><td> Jel elektroforez </td><td> Hoeffer Bilimsel Aletler </td><td> Model HE33 </td><td></td></tr><tr><td> 1 kb DNA Ladder </td><td> New England Biolabs </td><td> N3232S </td><td></td></tr><tr><td> Bio Rad Power Pack </td><td> Bio Rad </td><td> 164-5050 </td><td> PowerPac Temel </td></tr><tr><td> Gel Doc sistemi </td><td> Fotodyne Incorporated </td><td colspan="2"> FOTO / Analist Araştırmacı FX İstasyonu </td></tr></tbody></table>

polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies

Biyolojik bilimler keşfin altın çağına disiplin mancınık teknolojik gelişmeler olmuştur. Örneğin, mikrobiyoloji alanında bilim adamları ilk kez prokaryotlarda görselleştirmek için izin Anton van Leeuwenhoek en mikroskop, gelişine dönüştürüldü. Polimeraz zincir reaksiyonu (PCR) geliştirilmesi etkisini biyolojinin sayısız alt disiplinleri kapsayan ile moleküler bilimin gidişatını değiştiren bu yeniliklerden biri. Teorik süreci 1971 yılında Keppe ve arkadaşları tarafından ana hatlarıyla ortaya koydu; tam PCR yöntemi Balina Corporation, 1985 yılında ise Kary Mullis tarafından açıklanan ve deneysel olarak uygulanmıştır kadar ancak, başka bir 14 yıl oldu. Bu tekniğin Otomasyon ve arıtma bakteri Thermus aquaticus, dolayısıyla adı Taq DNA polimeraz bir termal dayanıklı DNA polimeraz tanıtımıyla ilerledi. PCR powe olduğunuBaşlangıç ​​malzemesi sadece küçük bir miktarı (yani, DNA şablonu veya hedef dizisi) DNA (yani, bir amplikon) belirli bir bölümü, zengin bir besleme oluşturabilir rful amplifikasyon tekniği. Basit ve genel olarak sorunsuz olsa da, sahte sonuçlar üreten reaksiyon komplike tuzaklar vardır. PCR başarısız olduğunda bunu agaroz jel üzerindeki bantların bir merdiven ya da smear olarak görünür büyüklü küçüklü birçok non-spesifik DNA ürünlere de yol açabilir. Bazen herhangi bir ürün hiç oluştururlar. Mutasyonlar istemeden PCR ürünlerinin heterojen nüfus sonuçlanan amplikonlar başlatıldığında diğer bir olası sorun oluşur. Sabır ve dikkatli bir sorun giderme sıralamak ve sorun (lar) çözmek için istihdam sürece PCR hataları sinir bozucu hale gelebilir. Bu protokol, PCR temel ilkelerini özetlenmektedir en hedef dizilerinin amplifikasyonu ile sonuçlanacaktır bir yöntem sağlar, ve bir reaksiyon optimize etmek için stratejiler sunar. Bu PCR kılavuzu, st takip ederekudents gerekir: <ul><li> Geleneksel PCR deney için reaksiyonlar ve ısıl koşulları ayarlama </li><li> Çeşitli reaksiyon bileşenlerinin fonksiyonu ve PCR deney üzerindeki genel etkisi Anlayın </li><li> Herhangi bir DNA örneğinin bir PCR deney tasarlayın ve optimize </li><li> Başarısız PCR deneyler giderme </li></ul>

Watch this Scientific Journal Video about Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies at JoVE.com

Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

PCR birçok moleküler biyoloji laboratuvarlarında yaygın bir teknik olarak ortaya çıkmıştır. Pek çok geleneksel PCR protokolleri için hızlı bir kılavuzdur burada sağlanan. Her bir reaksiyon benzersiz bir deneyde, bir ürün üretmek için gerekli değişir uygun koşullar olmasıdır. Bir reaksiyonla değişkenlerini anlama büyük ölçüde böylece istenilen sonucu elde etmek şansı artan giderme verimi artıracaktır.

Polimeraz Zincir Reaksiyonu: Temel Protokol Plus, Sorun ve Optimizasyon Stratejileri

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of ...

polymerase-chain-reaction-basic-protocol-plus-troubleshooting

Research

JoVE Journal

Biology

402.5K Görüntüleme.  University of California, Los Angeles. PCR birçok moleküler biyoloji laboratuvarlarında yaygın bir teknik olarak ortaya çıkmıştır. Pek çok geleneksel PCR protokolleri için hızlı bir kılavuzdur burada sağlanan. Her bir reaksiyon benzersiz bir deneyde, bir ürün üretmek için gerekli değişir uygun koşullar olmasıdır. Bir reaksiyonla değişkenlerini anlama büyük ölçüde böylece istenilen sonucu elde etmek şansı artan giderme verimi artıracaktır.

Video: Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

Neutrophil Isolation Protocol

Neutrophil polymorphonuclear granulocytes (PMN) are the most abundant leukocytes in humans and among the first cells to arrive on the site of inflammatory immune response. Due to their key role in inflammation, neutrophil functions such as locomotion, cytokine production, phagocytosis, and tumor cell combat are extensively studied. To characterize the specific functions of neutrophils, a clean, fast, and reliable method of separating them from other blood cells is desirable for in vitro studies, especially since neutrophils are short-lived and should be used within 2-4 hours of collection. Here, we demonstrate a standard density gradient separation method to isolate human neutrophils from whole blood using commercially available separation media that is a mixture of sodium metrizoate and Dextran 500. The procedure consists of layering whole blood over the density gradient medium, centrifugation, separation of neutrophil layer, and lysis of residual erythrocytes. Cells are then washed, counted, and resuspended in buffer to desired concentration. When performed correctly, this method has been shown to yield samples of >95% neutrophils with >95% viability.

Neutrophils are among the first cells to arrive on the site of inflammatory immune response, and their functions and mechanisms have been studied extensively in vitro. We demonstrate a standard density gradient separation method to isolate human neutrophils from whole blood using commercially available separation media.

Nötrofil İzolasyon Protokolü

Neutrophil polymorphonuclear granulocytes (PMN) are the most abundant leukocytes in humans and among the first cells to arrive on the site of inflammatory ...

Biyoloji

Optimization of the Ugi Reaction Using Parallel Synthesis and Automated Liquid Handling

The optimization of a Ugi reaction involving the mixing of furfurylamine, benzaldehyde, boc-glycine and t-butylisocyanide is described. Triplicate runs of 48 parallel experiments are reported, varying concentration, solvent and the excess of some of the reagents. The isolation of the product was achieved by a simple filtration and wash procedure. The highest yield obtained was 66% from 0.4 M methanol with 1.2 eq. of imine. This is significantly above the 49% yield obtained from the initial reaction under equimolar concentration at 0.4 M in methanol. Methanol solutions with reagent concentrations of 0.4M or 0.2M gave superior yields while all solvent systems at 0.07M performed poorly. At 0.2M, methanol and ethanol/methanol (60/40) mixtures were statistically equally good while THF/methanol (60/40) was poor and acetonitrile/methanol (60/40) was intermediate. Good reproducibility of the precipitate yields was obtained in these replicate experiments, allowing for subtle interaction effects to be positively identified.

The Ugi reaction has proved to be a convenient way to quickly create diverse libraries of compounds. It involves the reaction of an amine, an aldehyde, a carboxylic acid and an isonitrile typically in methanol at room temperature. In this video, we utilize a 48-slot Mettler-Toledo MiniBlock equipped with filtration tubes and a Mettler-Toledo MiniMapper automated liquid handler was used to deliver the reagents and solvent. The parameters of interest were the concentration, the solvent composition and the excess of some of the reagents.

Paralel Sentezi ve Otomatik Liquid Handling kullanma Ugi Reaksiyon optimizasyonu

The optimization of a Ugi reaction involving the mixing of furfurylamine, benzaldehyde, boc-glycine and t-butylisocyanide is described.  Triplicate runs ...

Elevated Plus Maze for Mice

Although the mouse genome is now completely sequenced, the functions of most of the genes expressed in the brain are not known. The influence of a given gene on a specific behavior can be determined by behavioral analysis of mutant mice. If a target gene is expressed in the brain, behavioral phenotype of the mutant mice could elucidate the genetic mechanism of normal behaviors. The elevated plus maze test is one of the most widely used tests for measuring anxiety-like behavior. The test is based on the natural aversion of mice for open and elevated areas, as well as on their natural spontaneous exploratory behavior in novel environments. The apparatus consists of open arms and closed arms, crossed in the middle perpendicularly to each other, and a center area. Mice are given access to all of the arms and are allowed to move freely between them. The number of entries into the open arms and the time spent in the open arms are used as indices of open space-induced anxiety in mice. Unfortunately, the procedural differences that exist between laboratories make it difficult to duplicate and compare results among laboratories. Here, we present a detailed movie demonstrating our protocol for the elevated plus maze test. In our laboratory, we have assessed more than 90 strains of mutant mice using the protocol shown in the movie. These data will be disclosed as a part of a public database that we are now constructing.
Visualization of the protocol will promote better understanding of the details of the entire experimental procedure, allowing for standardization of the protocols used in different laboratories and comparisons of the behavioral phenotypes of various strains of mutant mice assessed using this test. 


The elevated plus maze test is one of the most widely used tests for measuring anxiety-like behavior in mice. Here, we present a movie showing the detailed procedures for conducting the test.

Fareler için Yükseltilmiş Artı Labirent

Although the mouse genome is now completely sequenced, the functions of most of the genes expressed in the brain are not known. The influence of a given ...

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

Small animal Magnetic Resonance (MR) research has emerged as an important element of modern biomedical research due to its non-invasive nature and the richness of biological information it provides. MR does not require any ionizing radiation and can noninvasively provide higher resolution and better signal-to-noise ratio in comparison to other tomographic or spectroscopic modalities. In this protocol, we will focus on small animal MR imaging and MR spectroscopy (MRI/MRS) to noninvasively acquire relaxation weighted 1H images of mouse and to obtain 31P spectra of mouse muscle. This work does not attempt to cover every aspect of small animal MRI/MRS but rather introduces basic procedures of mouse MRI/MRS experiments. The main goal of this work is to inform researchers of the basic procedures for in vivo MR experiments on small animals. The goal is to provide a better understanding of basic experimental procedures to allow researchers new to the MR field to better plan for non-MR components of their studies so that both MR and non-MR procedures are seamlessly integrated.

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

This work describes basic procedures of noninvasive small animal MRI and MRS in vivo.

Noninvaziv In Vivo Küçük Hayvan MRG ve MRS: Temel Deneysel Prosedürler

Small animal Magnetic Resonance (MR) research has emerged as an important element of modern biomedical research due to its non-invasive nature and the ...

Multiplexed Fluorometric ImmunoAssay Testing Methodology and Troubleshooting

To ensure the quality of animal models used in biomedical research we have developed a number of diagnostic testing strategies and methods to determine if animals have been exposed to adventitious infectious agents (viruses, mycoplasma, and other fastidious microorganisms). Infections of immunocompetent animals are generally transient, yet serum antibody responses to infection often can be detected within days to weeks and persist throughout the life of the host. Serology is the primary diagnostic methodology by which laboratory animals are monitored. Historically the indirect enzyme-linked immunosorbent assay (ELISA) has been the main screening method for serosurveillance. The ELISA is performed as a singleplex, in which one microbial antigen-antibody reaction is measured per well. In comparison the MFIA is performed as a multiplexed assay. Since the microspheres come in 100 distinct color sets, as many as 100 different assays can be performed simultaneously in a single microplate well. This innovation decreases the amount of serum, reagents and disposables required for routine testing while increasing the amount of information obtained from a single test well. In addition, we are able to incorporate multiple internal control beads to verify sample and system suitability and thereby assure the accuracy of results. These include tissue control and IgG anti-test serum species immunoglobulin (&alpha;Ig) coated bead sets to evaluate sample suitability. As in the ELISA and IFA, the tissue control detects non-specific binding of serum immunoglobulin. The &alpha;Ig control (Serum control) confirms that serum has been added and contains a sufficient immunoglobulin concentration while the IgG control bead (System Suitability control), coated with serum species immunoglobulin, demonstrates that the labeled reagents and Luminex reader are functioning properly.

Using Luminex Corporation&#x2019;s xMAP microsphere technology, we have developed the Multiplexed Fluorometric ImmunoAssay (MFIA) for serosurveillance of various laboratory animal species. The MFIA is a suspension microarray where antigen, tissue control or immunoglobulins are covalently linked to color-coded polystyrene microspheres. The MFIA testing method as well as various troubleshooting topics is addressed.

Multiplexed Florometrik immunoassay Test Metodolojisi ve Sorun Giderme

To ensure the quality of animal models used in biomedical research we have developed a number of diagnostic testing strategies and methods to determine if ...

Basic Caenorhabditis elegans Methods: Synchronization and Observation

Research into the molecular and developmental biology of the nematode Caenorhabditis elegans was begun in the early seventies by Sydney Brenner and it has since been used extensively as a model organism 1. C. elegans possesses key attributes such as simplicity, transparency and short life cycle that have made it a suitable experimental system for fundamental biological studies for many years 2. Discoveries in this nematode have broad implications because many cellular and molecular processes that control animal development are evolutionary conserved 3.
C. elegans life cycle goes through an embryonic stage and four larval stages before animals reach adulthood. Development can take 2 to 4 days depending on the temperature. In each of the stages several characteristic traits can be observed. The knowledge of its complete cell lineage 4,5 together with the deep annotation of its genome turn this nematode into a great model in fields as diverse as the neurobiology 6, aging 7,8, stem cell biology 9 and germ line biology 10. 
An additional feature that makes C. elegans an attractive model to work with is the possibility of obtaining populations of worms synchronized at a specific stage through a relatively easy protocol. The ease of maintaining and propagating this nematode added to the possibility of synchronization provide a powerful tool to obtain large amounts of worms, which can be used for a wide variety of small or high-throughput experiments such as RNAi screens, microarrays, massive sequencing, immunoblot or in situ hybridization, among others. 
Because of its transparency, C. elegans structures can be distinguished under the microscope using Differential Interference Contrast microscopy, also known as Nomarski microscopy. The use of a fluorescent DNA binder, DAPI (4',6-diamidino-2-phenylindole), for instance, can lead to the specific identification and localization of individual cells, as well as subcellular structures/defects associated to them.

Basic Caenorhabditis elegans Methods: Synchronization and Observation

The easiness of maintaining and propagating the nematode C. elegans make it a nice model organism to work with. The possibility of synchronizing worms allows the work with a significant amount of subjects at the same developmental stage, what facilitates the study of one particular process in many animals.

Temel<em&gt; Caenorhabditis elegans</em&gt; Yöntem: Senkronizasyon ve Gözlem

Research into the molecular and developmental biology of the nematode Caenorhabditis elegans was begun in the early seventies by Sydney Brenner and it has ...

A Guide to Modern Quantitative Fluorescent Western Blotting with Troubleshooting Strategies

The late 1970s saw the first publicly reported use of the western blot, a technique for assessing the presence and relative abundance of specific proteins within complex biological samples. Since then, western blotting methodology has become a common component of the molecular biologists experimental repertoire. A cursory search of PubMed using the term &#8220;western blot&#8221; suggests that in excess of two hundred and twenty thousand published manuscripts have made use of this technique by the year 2014. Importantly, the last ten years have seen technical imaging advances coupled with the development of sensitive fluorescent labels which have improved sensitivity and yielded even greater ranges of linear detection. The result is a now truly Quantifiable Fluorescence based Western Blot (QFWB) that allows biologists to carry out comparative expression analysis with greater sensitivity and accuracy than ever before. Many &#8220;optimized&#8221; western blotting methodologies exist and are utilized in different laboratories. These often prove difficult to implement due to the requirement of subtle but undocumented procedural amendments. This protocol provides a comprehensive description of an established and robust QFWB method, complete with troubleshooting strategies.

The advancement of western blotting using fluorescence has allowed detection of subtle changes in protein expression enabling quantitative analyses. Here we describe a robust methodology for detection of a range of proteins across a variety of species and tissue types. A strategy to overcome common technical problems is also provided.

Sorun Giderme Stratejileri Modern Kantitatif Floresan Western Blot A Guide

The late 1970s saw the first publicly reported use of the western blot, a technique for assessing the presence and relative abundance of specific proteins ...

A Rapid Automated Protocol for Muscle Fiber Population Analysis in Rat Muscle Cross Sections Using Myosin Heavy Chain Immunohistochemistry

Quantification of muscle fiber populations provides a deeper insight into the effects of disease, trauma, and various other influences on skeletal muscle composition. Various time-consuming methods have traditionally been used to study fiber populations in many fields of research. However, recently developed immunohistochemical methods based on myosin heavy chain protein expression provide a quick alternative to identify multiple fiber types in a single section. Here, we present a rapid, reliable and reproducible protocol for improved staining quality, allowing automatic acquisition of whole cross sections and automatic quantification of fiber populations with ImageJ. For this purpose, embedded skeletal muscles are cut in cross sections, stained using myosin heavy chains antibodies with secondary fluorescent antibodies and DAPI for cell nuclei staining. Whole cross sections are then scanned automatically using a slide scanner to obtain high-resolution composite pictures of the entire specimen. Fiber population analyses are subsequently performed to quantify slow, intermediate and fast fibers using an automated macro for ImageJ. We have previously shown that this method can identify fiber populations reliably to a degree of &#177;4%. In addition, this method reduces inter-user variability and time per analyses significantly using the open source platform ImageJ.

Here, we present a protocol for rapid muscle fiber analyses, which allows improved staining quality, and thereby automatic acquisition and quantification of fiber populations using the freely available software ImageJ.

Miyosin Ağır Zincir İmünohistokimya kullanma Sıçan kas Çapraz Bölüm kas Elyaf Nüfus Analizi İçin Hızlı Otomatik Protokolü

Quantification of muscle fiber populations provides a deeper insight into the effects of disease, trauma, and various other influences on skeletal muscle ...

Procedure and Key Optimization Strategies for an Automated Capillary Electrophoretic-based Immunoassay Method

New technologies that utilize capillary-based immunoassays promise faster and more quantitative protein assessment compared to traditional immunoassays. However, similar to other antibody-based protein assays, optimization of capillary-based immunoassay parameters, such as protein concentration, antibody dilution, and exposure time is an important prerequisite to the generation of meaningful and reliable data. Measurements must fall within the linear range of the assay where changes in signal are directly proportional to changes in lysate concentration. The process of choosing appropriate lysate concentrations, antibody dilutions, and exposure times in the human bronchial epithelial cell line, BEAS-2B, is demonstrated here. Assay linearity is shown over a range of whole cell extract protein concentrations with p53 and &#945;-tubulin antibodies. An example of signal burnout is seen at the highest concentrations with long exposure times, and an &#945;-tubulin antibody dilution curve is shown demonstrating saturation. In addition, example experimental results are reported for doxorubicin-treated cells using optimized parameters.

A capillary-based immunoassay using a commercial platform to measure target proteins from total protein preparations is demonstrated. In addition, assay parameters of exposure time, protein concentration, and antibody dilution are optimized for a cell culture model system.

Yordam ve anahtar optimizasyon stratejileri için bir otomatik Kapiler elektroforetik tabanlı Immunoassay yöntemi

New technologies that utilize capillary-based immunoassays promise faster and more quantitative protein assessment compared to traditional immunoassays. ...

Simultaneous Measurements of Intracellular Calcium and Membrane Potential in Freshly Isolated and Intact Mouse Cerebral Endothelium

Cerebral arteries and their respective microcirculation deliver oxygen and nutrients to the brain via blood flow regulation. Endothelial cells line the lumen of blood vessels and command changes in vascular diameter as needed to meet the metabolic demand of neurons. Primary endothelial-dependent signaling pathways of hyperpolarization of membrane potential (Vm) and nitric oxide typically operate in parallel to mediate vasodilation and thereby increase blood flow. Although integral to coordinating vasodilation over several millimeters of vascular length, components of endothelium-derived hyperpolarization (EDH) have been historically difficult to measure. These components of EDH entail intracellular Ca2+ [Ca2+]i increases and subsequent activation of small- and intermediate conductance Ca2+-activated K+ (SKCa/IKCa) channels.
Here, we present a simplified illustration of the isolation of fresh endothelium from mouse cerebral arteries; simultaneous measurements of endothelial [Ca2+]i and Vm using Fura-2 photometry and intracellular sharp electrodes, respectively; and a continuous superfusion of salt solutions and pharmacological agents under physiological conditions (pH 7.4, 37 &#176;C). Posterior cerebral arteries from the Circle of Willis are removed free of the posterior communicating and the basilar arteries. Enzymatic digestion of cleaned posterior cerebral arterial segments and subsequent trituration facilitates removal of adventitia, perivascular nerves, and smooth muscle cells. Resulting posterior cerebral arterial endothelial &#34;tubes&#34; are then secured under a microscope and examined using a camera, photomultiplier tube, and one to two electrometers while under continuous superfusion. Collectively, this method can simultaneously measure changes in endothelial [Ca2+]i and Vm in discrete cellular locations, in addition to the spreading of EDH through gap junctions up to millimeter distances along the intact endothelium. This method is expected to yield a high-throughput analysis of the cerebral endothelial functions underlying mechanisms of blood flow regulation in the normal and diseased brain.

Demonstrated here are protocols for (1) freshly isolating intact cerebral endothelial "tubes" and (2) simultaneous measurements of endothelial calcium and membrane potential during endothelium-derived hyperpolarization. Further, these methods allow for pharmacological tuning of endothelial cell calcium and electrical signaling as individual or interactive experimental variables.

Hücre içi kalsiyum ve taze izole ve olduğu gibi fare serebral endotel membran potansiyeli eşzamanlı ölçümler

Cerebral arteries and their respective microcirculation deliver oxygen and nutrients to the brain via blood flow regulation. Endothelial cells line the ...