The authors would like to thank the Animal Services team at The Pirbright Institute for their expertise in hatching, rearing, and culling birds and the expertise of Caroline Holt in aseptically removing the bursa of Fabricius. A.B. is funded through the Biotechnology and Biological Sciences Research Council (BBSRC) via grant BBS/E/I/00001845, K.D. is funded through the BBSRC via studentship BBS/E/I/00002115, and A.A. is funded through the National Centre for the Replacement, Refinement &#38; Reduction of Animals in Research (NC3Rs) via grant NC/R001138/1.

All procedures with animals must be ethically approved in advance. In our institution, all procedures are performed in accordance with the UK Animal (Scientific Procedures) Act 1986 under Home Office Establishment, Personal and Project licenses, after the approval of the internal Animal Welfare and Ethical Review Board (AWERB).
1. Preparation of chCD40L
<ol>
	<li>Culture HEK 293-msCD8-CD40L cells that stably express a soluble chCD40L construct in 1x Roswell Park Memorial Institute (RPMI) medium supplemented with 10% heat-inactivated (hi) fetal calf serum (FCS) and 1 &#181;g/mL puromycin at 37 &#176;C in an atmosphere containing 5% CO2. 
	NOTE: These cells are available from The Pirbright Institute following the signing of the appropriate material transfer agreement.</li>
	<li>Split the cells at a 1:5 density when confluent. Collect the supernatant (containing the soluble chCD40L construct) each time the cells are split, centrifuge it at 400 x g for 5 min to remove cellular debris, and store it at 4 &#176;C.</li>
	<li>When 500 mL of the supernatant has been collected, pool the liquid and filter-sterilize it through a 0.2 &#181;m filter.</li>
	<li>Concentrate the supernatant using centrifugal protein concentrators with a molecular-weight cutoff of 10 K according to the manufacturer&#8217;s instructions. Extract the concentrated supernatant from each column, pool it together, and filter-sterilize it by passing it through a 0.22 &#181;m syringe filter.</li>
	<li>Determine the final concentration to be used in experiments by serially diluting the chCD40L solution in 1x Iscove&#8217;s modified Dulbecco&#8217;s medium (IMDM) (described in step 2.4) and culturing primary bursal cells in the presence of the dilutions. Determine the number and percentage viability of the cells daily for up to a week. 
	NOTE: The lowest concentration where cell proliferation and viability are adequate is the concentration to use in the assay. This is likely to be between 1:20 and 1:50.</li>
</ol>
2. Preparation of Solutions for Chicken Primary Bursal Cell Isolation
<ol>
	<li>Prepare 1x Hanks&#8217; balanced salt solution (HBBS) with calcium (Ca) by adding 10 mL of 10x HBBS with Ca to 90 mL of sterile H2O and 0.47 &#181;L of 7.5% NaHCO3.</li>
	<li>Prepare collagenase D stock solution at 8 mg/mL in 1x HBBS with Ca. Filter-sterilize the solution through a 0.2 &#181;M filter. 
	NOTE: It is advisable to prepare 5 mL aliquots and freeze them at -20 &#176;C.</li>
	<li>Prepare 1x RPMI medium supplemented with 5% hi FCS. Store the media at 4 &#176;C.</li>
	<li>Prepare 1x 500 mL of IMDM supplemented with 8% hi FCS, 2% hi chicken serum, 50 mM &#946;-mercaptoethanol, 50 &#181;L of insulin-transferrin-sodium-selenite, and 1% penicillin/streptomycin. Store the media at 4 &#176;C. 
	NOTE: Prepare all the above-mentioned solutions in advance.</li>
	<li>Prepare 1x HBBS with Ca. Store the solution on ice.</li>
	<li>Prepare 1x HBBS without Ca by adding 10 mL of 10x HBBS without Ca to 90 mL of sterile H2O, 0.47 &#181;L of 7.5% NaHCO3, and EDTA at a final concentration of 10 mM. Store the solution on ice.</li>
	<li>Prepare 1x collagenase D solution by adding 5 mL of collagenase D stock solution to 13 mL of HBBS with Ca to make a total of 18 mL. Store the solution on ice. 
	NOTE: Prepare the solutions mentioned in steps 2.5&#8211;2.7 on the day of the experiment.</li>
</ol>
3. Removal of the Bursa of Fabricius (BF)
<ol>
	<li>Rear and hatch chickens in an appropriate, approved facility and humanely cull them at 2&#8211;3 weeks of age. 
	NOTE: Use institute-approved methods for culling.</li>
	<li>Collect the BF from each chicken using aseptic techniques. 
	NOTE: Use the protocols in place at the institution.
	<ol>
		<li>Place the carcass in dorsal recumbency and sterilize the skin and feathers overlaying the abdomen and thorax with a solution of 70% ethanol, diluted in water.</li>
		<li>Make a ventral midline incision in the lower abdomen using a sterilized scalpel or scissors.</li>
		<li>Locate the bursa of Fabricius, which is connected to the caudal section of the colon, cranial to the cloaca.</li>
		<li>Using sterilized forceps and scissors, cut the bursa of Fabricius free from the colon. Take care to avoid puncturing the gut.</li>
	</ol>
	</li>
	<li>Place the organ in cold PBS and transfer it to the laboratory on ice. 
	NOTE: Primary cells should be isolated as soon as possible after the organ harvest.</li>
</ol>
4. Isolation of Chicken Primary Bursal Cells
<ol>
	<li>Working in a microbiological safety cabinet, wash the BF at least 3x in 30 mL of cold PBS.</li>
	<li>Transfer the tissue to a Petri dish (92 mm in diameter, 21 mm in height) and add 5 mL of 1x collagenase D solution.</li>
	<li>Using sterile scissors or a scalpel blade, cut the BF into pieces of less than 5 mm in diameter.</li>
	<li>Incubate the tissue at 37 &#176;C with periodic gentle agitation for 30 min. 
	NOTE: The collagenase solution will begin to digest the tissue.&#160;</li>
	<li>Using a sterile Pasteur pipette, repeatedly aspirate the mixture to encourage disintegration of the tissue. If necessary, cut the tissue into smaller pieces.</li>
	<li>Add another 5 mL of 1x collagenase D solution to the tissue and incubate it at 37 &#176;C with periodic gentle agitation for another 30 min.</li>
	<li>Repeat steps 4.6 and 4.7 until the tissue is completely digested. 
	NOTE: There will be small granules that do not dissolve further.</li>
	<li>Pass the cell suspension through a 100 &#181;m cell strainer into 20 mL of 1x HBBS without Ca.</li>
	<li>Centrifuge the cell suspension at 400 x g for 5 min.</li>
	<li>Discard the supernatant and resuspend the pellet in 10 mL of 1x RPMI with 5% FCS.</li>
	<li>Either overlay 10 mL of the cell suspension on top of 5 mL of density gradient media containing polysucrose and sodium diatrizoate or underlay 5 mL of density gradient media beneath the 10 mL cell suspension. Ensure there is a clear interface between the two.</li>
	<li>Centrifuge the overlay at 900 x g for 20 min at 4 &#176;C. Lower or remove the centrifuge break. 
	NOTE: The cells should form a band at the interface between the cell media and the density gradient media.</li>
	<li>Using a sterile Pasteur pipette, remove the cells and place them in cold PBS. Wash the cells 3x by centrifuging them at 400 x g for 5 min and resuspending them in cold PBS.</li>
</ol>
5. Culture of Chicken Primary Bursal Cells
<ol>
	<li>Centrifuge the cell suspension at 400 x g for 5 min and resuspend them in 1x complete IMDM.</li>
	<li>Take an aliquot of the cell suspension, add it to a Trypan blue solution and count the number of viable cells that exclude the Trypan blue. Determine the number of cells and the percentage viability.</li>
	<li>Centrifuge the cell suspension at 400 x g for 5 min and resuspend it in complete IMDM supplemented with a 1:20 dilution of chicken CD40L at a density of 1 x 107 cells/mL. Titrate the concentrated supernatant containing the chCD40L to determine the optimal dilution, which is likely to lie in the range of 1:10 to 1:50.</li>
	<li>Culture the cells in either 96- or 24-well plates at 37 &#176;C for 48&#8211;72 h. U-bottomed 96-well plates are preferable to flat-bottomed plates. 
	NOTE: Cells can also be cultured at 40&#160;&#176;C</li>
</ol>
6. Infection of Chicken Primary Bursal Cells with IBDV
<ol>
	<li>48&#8211;72 h post-isolation, thaw an aliquot of the virus, vortex the sample, and store it on ice.</li>
	<li>Resuspend the primary bursal cells, take a 10-&#181;L aliquot of the cell suspension, add it to 10 &#181;L of a Trypan blue solution, and determine the number of cells and percentage viability.</li>
	<li>Dilute the virus in 1x complete IMDM to the appropriate multiplicity of infection (MOI) to make the virus inoculum and vortex.</li>
	<li>Centrifuge the cell suspension at 400 x g for 5 min.</li>
	<li>Remove the supernatant and resuspend the cells in the virus inoculum.</li>
	<li>Incubate the cell suspension at 37 &#176;C for 1 h with periodic agitation.</li>
	<li>Centrifuge the cell suspension at 400 x g for 5 min, remove the virus inoculum, and wash the cells in 1x complete IMDM media.</li>
	<li>Centrifuge the cell suspension at 400 x g for 5 min, remove the supernatant, and resuspend the cells in complete IMDM media supplemented with chicken CD40L at a density of 1 x 107 cells per mL.</li>
	<li>Culture the cells in either 96- or 24-well plates at 37 &#176;C. 
	NOTE: Cells can also be cultured at 40&#160;&#176;C</li>
</ol>
7. Quantification of IBDV Replication in Chicken Primary Bursal Cells
<ol>
	<li>At the desired time-point postinfection, resuspend the cells, transfer them to an appropriate tube, centrifuge them at 400 x g for 5 min and harvest the supernatant for virus titration by either plaque assay or TCID50 assay as per the Reed-Muench method15.</li>
	<li>Wash the cells in 1 mL of PBS and prepare them either for immunostaining with an antibody specific to IBDV, or extract RNA using an appropriate kit (following the manufacturer&#8217;s instructions) and perform reverse transcription quantitative polymerase chain reaction (RT-qPCR) using primers specific for an IBDV gene (Forward, GAGGTGGCCGACCTCAACT; Reverse, GCCCGGATTATGTCTTTGAAG). Mock-infected cell cultures should be used as a control.</li>
</ol>

<ol>
	<li>Hoerr, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+aspects+of+immunosuppression+in+poultry.">Clinical aspects of immunosuppression in poultry.</a> Avian Diseases. 54 (1), 2-15 (2010).</li><li>Schermuly, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+model+for+lytic+replication,+latency,+and+transformation+of+an+oncogenic+alphaherpesvirus.">In vitro model for lytic replication, latency, and transformation of an oncogenic alphaherpesvirus.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (23), 7279-7284 (2015).</li><li>Farhanah, M. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bursal+immunopathology+responses+of+specific-pathogen-free+chickens+and+red+jungle+fowl+infected+with+very+virulent+infectious+bursal+disease+virus.">Bursal immunopathology responses of specific-pathogen-free chickens and red jungle fowl infected with very virulent infectious bursal disease virus.</a> Archives of Virology. , (2018).</li><li>Farhanah, M. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bursal+transcriptome+profiling+of+different+inbred+chicken+lines+reveals+key+differentially+expressed+genes+at+3+days+post-infection+with+very+virulent+infectious+bursal+disease+virus.">Bursal transcriptome profiling of different inbred chicken lines reveals key differentially expressed genes at 3 days post-infection with very virulent infectious bursal disease virus.</a> Journal of General Virology. 99 (1), 21-35 (2018).</li><li>Guo, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+expression+of+the+Toll-like+receptor+pathway+and+related+genes+of+chicken+bursa+after+experimental+infection+with+infectious+bursa+disease+virus.">Differential expression of the Toll-like receptor pathway and related genes of chicken bursa after experimental infection with infectious bursa disease virus.</a> Archives of Virology. 157 (11), 2189-2199 (2012).</li><li>He, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+Regulation+of+chTLR3+by+Infectious+Bursal+Disease+Viruses+with+Different+Virulence.">Differential Regulation of chTLR3 by Infectious Bursal Disease Viruses with Different Virulence.</a> In Vitro and In Vivo. Viral Immunology. 30 (7), 490-499 (2017).</li><li>Ou, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+profiles+of+the+responses+of+chicken+bursae+of+Fabricius+to+IBDV+in+different+timing+phases.">Transcription profiles of the responses of chicken bursae of Fabricius to IBDV in different timing phases.</a> Virology Journal. 14 (1), 93 (2017).</li><li>Rasoli, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+modulation+of+immune+response+and+cytokine+profiles+in+the+bursae+and+spleen+of+chickens+infected+with+very+virulent+infectious+bursal+disease+virus.">Differential modulation of immune response and cytokine profiles in the bursae and spleen of chickens infected with very virulent infectious bursal disease virus.</a> BMC Veterinary Research. 11, 75 (2015).</li><li>Ruby, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+profiling+reveals+a+possible+role+for+the+timing+of+the+inflammatory+response+in+determining+susceptibility+to+a+viral+infection.">Transcriptional profiling reveals a possible role for the timing of the inflammatory response in determining susceptibility to a viral infection.</a> Journal of Virology. 80 (18), 9207-9216 (2006).</li><li>Smith, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+early+immune+response+to+infection+by+infectious+bursal+disease+virus+in+chickens+differing+in+their+resistance+to+the+disease.">Analysis of the early immune response to infection by infectious bursal disease virus in chickens differing in their resistance to the disease.</a> Journal of Virology. 89 (5), 2469-2482 (2015).</li><li>Tregaskes, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conservation+of+biological+properties+of+the+CD40+ligand,+CD154+in+a+non-mammalian+vertebrate.">Conservation of biological properties of the CD40 ligand, CD154 in a non-mammalian vertebrate.</a> Developmental &amp; Comparative Immunology. 29 (4), 361-374 (2005).</li><li>Kothlow, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD40+ligand+supports+the+long-term+maintenance+and+differentiation+of+chicken+B+cells+in+culture.">CD40 ligand supports the long-term maintenance and differentiation of chicken B cells in culture.</a> Developmental &amp; Comparative Immunology. 32 (9), 1015-1026 (2008).</li><li>Dulwich, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+gene+expression+in+chicken+primary+B+cells+infected+ex+vivo+with+attenuated+and+very+virulent+strains+of+infectious+bursal+disease+virus+(IBDV).">Differential gene expression in chicken primary B cells infected ex vivo with attenuated and very virulent strains of infectious bursal disease virus (IBDV).</a> Journal of General Virology. 98 (12), 2918-2930 (2017).</li><li>Soubies, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Propagation+and+titration+of+infectious+bursal+disease+virus,+including+non-cell-culture-adapted+strains,+using+ex+vivo-stimulated+chicken+bursal+cells.">Propagation and titration of infectious bursal disease virus, including non-cell-culture-adapted strains, using ex vivo-stimulated chicken bursal cells.</a> Avian Pathology. 47 (2), 179-188 (2018).</li><li>Reed, L., Muench, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+method+of+estimating+fifty+percent+endpoints.">A simple method of estimating fifty percent endpoints.</a> American Journal of Hygiene. 27, 494-497 (1938).</li><li>Hui, R. K., Leung, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+Expression+Profile+of+Chicken+Embryo+Fibroblast+DF-1+Cells+Infected+with+Cell-Adapted+Infectious+Bursal+Disease+Virus.">Differential Expression Profile of Chicken Embryo Fibroblast DF-1 Cells Infected with Cell-Adapted Infectious Bursal Disease Virus.</a> PLoS One. 10 (6), e0111771 (2015).</li><li>Li, Y. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+profiles+of+chicken+embryo+cell+cultures+following+infection+with+infectious+bursal+disease+virus.">Transcriptional profiles of chicken embryo cell cultures following infection with infectious bursal disease virus.</a> Archives of Virology. 152 (3), 463-478 (2007).</li><li>Lin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+profiling+of+chicken+dendritic+cell+response+to+infectious+bursal+disease.">Genome-wide profiling of chicken dendritic cell response to infectious bursal disease.</a> BMC Genomics. 17 (1), 878 (2016).</li><li>Quan, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+profiles+in+bursal+B-lymphoid+DT40+cells+infected+with+very+virulent+infectious+bursal+disease+virus.">Transcriptional profiles in bursal B-lymphoid DT40 cells infected with very virulent infectious bursal disease virus.</a> Virology Journal. 14 (1), 7 (2017).</li><li>Wong, R. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Screening+of+differentially+expressed+transcripts+in+infectious+bursal+disease+virus-induced+apoptotic+chicken+embryonic+fibroblasts+by+using+cDNA+microarrays.">Screening of differentially expressed transcripts in infectious bursal disease virus-induced apoptotic chicken embryonic fibroblasts by using cDNA microarrays.</a> Journal of General Virology. 88 (Pt 6), 1785-1796 (2007).</li></ol>

The authors have nothing to disclose.

In this study, we describe the successful culture of chicken primary bursal cells ex vivo in the presence of soluble chCD40L and demonstrate that these cells can support the replication of an attenuated strain and a very virulent strain of IBDV. This ex vivo model can be used to determine how the cells respond to an IBDV infection13, which has distinct advantages over in vivo and in vitro studies.
When harvesting the BF, it is critical to not puncture the gut so as to avoid bacterial contamination of the isolated bursal cells. In addition, it is important to isolate the primary cells as soon as possible after the organ harvest to limit cell death. The need to use chCD40L is a limitation of the technique; however, work conducted by Soubies et al. shows that the use of phorbol 12-myristate 13-acetate (PMA) to prolong bursal cell viability instead of chCD40L14 may enable the model to be adopted by a greater number of laboratories. The protocol outlined above determines the optimal concentration of chCD40L empirically, by culturing primary B cells in serially diluted concentrations of the molecule and observing cell proliferation and viability. One potential modification to the protocol could be to purify the chCD40L molecule and to add a specific concentration to the cell culture media to avoid batch-to-batch variability.
In vivo studies have shown that following IBDV infection, there is an increase in the expression of genes involved in pro-inflammatory cytokine responses, Type I IFN responses, and apoptosis in the BF5,9,10. However, following infection, there is an influx of inflammatory cells and effector T cells into the BF, which differ in the genes they express compared to the infected B cell population9. It is, therefore, difficult to interpret how infected cells respond to IBDV. To address this, some research groups have characterized the transcriptional response of cells infected with IBDV in culture16,17,18,19,20. These in vitro studies have the advantage of well-defined MOIs and time-points postinfection. However, in vitro studies have typically been characterized in either fibroblast cells16,17,20 or dendritic cells18. While providing some insight into host cell-IBDV interactions, the current belief is that the infection of B cells is crucial to the pathogenesis of IBDV and, therefore, the relevance of the data cannot be overinterpreted. Prior to our ex vivo bursal cell culture model, only one study had characterized the cellular response of B cells to IBDV infection19; however, this study utilized an immortalized B cell line that was transformed due to infection with ALV, limiting the conclusions that could be made. In contrast, the ex vivo model of IBDV infection described here allows researchers to retain the advantages of in vitro studies, such as defined MOIs and time-points, while studying the interactions of the virus with its relevant host cell. As the primary bursal cells are obtained from uninfected BF tissue, there are no inflammatory or T cells present, and we have demonstrated by flow cytometry (using standard conditions) that, following chCD40L stimulation, 97% of the cell population is positive for the B cell marker Bu-1 (data not shown). Given that 3% of the cells are Bu-1 negative, it will be interesting to determine whether these cells become infected with IBDV and explore their gene expression and contribution to the pathogenesis.
We anticipate that the ex vivo chicken primary bursal cell culture model can also be expanded to study the host cell-virus interactions of other B-cell tropic viruses infecting chickens, such as ALV or REV, and could also be expanded to other avian species (e.g., ducks or turkeys). The ability to culture primary bursal cells ex vivo also opens up the possibility to study aspects of the pathogenesis and immunosuppression caused by these viruses without the need to infect birds. As in vivo studies cause significant morbidity, this will have a substantial impact on the replacement, refinement, and reduction of the use of animals in research.
In summary, the ex vivo chicken primary bursal cell culture model described here has the potential to expand the understanding of how avian B-cell tropic viruses interact with their host cells while reducing the number of birds used in in vivo infection studies. The techniques can be applied to multiple lymphoid organs, multiple viruses, and, potentially, multiple species of birds, making it an attractive model that can contribute to the avian virology and immunology fields.

The global poultry industry is essential to secure enough food for an expanding human population. However, immunosuppression is the threat to food security and the welfare of affected birds and represents a key economic challenge to the industry. The majority of cases of immunosuppression in chickens are caused by the infection with immunosuppressive viruses, with those most responsible for impairing acquired immunity having a tropism for T and B lymphocytes1. In birds, the majority of B cells are located within an organ known as the bursa of Fabricius (BF). B cells are susceptible to infection with several immunosuppressive viruses, including those that cause lysis, such as IBDV and Marek&#39;s disease virus (MDV), and those that cause transformation, such as avian leukosis virus (ALV) and reticuloendotheliosis virus (REV).
In order to develop better strategies for controlling these infections, it is essential to characterize the interaction of the viruses with chicken B cells. However, when B cells are removed from a bird, they do not survive well in ex vivo culture2, making it difficult to perform a thorough analysis of the interactions of IBDV with chicken B cells, or the early events following ALV or REV infection. Consequently, many host cell-virus interactions have been studied in vivo3,4,5,6,7,8,9,10. Although these studies are informative, they involve the use of infected birds which suffer from diseases that can be severe.
The CD40 ligand is a molecule that induces B cell proliferation11. Following identification of the gene encoding chicken CD40L (chCD40L), a soluble fusion protein was engineered that, when added to the culture media, induced the proliferation of chicken primary B cells ex vivo12. In 2015, B cells cultured in this fashion were found to support the replication of MDV2 and in 2017, we and others found that primary bursal cells stimulated with chCD40L could be used as a model to study IBDV replication13,14. Here, we describe the isolation and culture of chicken primary bursal cells, the infection of the cells with IBDV, and the quantification of viral replication. Although we describe the method in the context of the BF, this could be applied to isolate and culture cells from different lymphoid organs.

<table><tbody><tr><td>RPMI-1640 Medium</td><td>Merck</td><td>R8758-500ML</td><td></td></tr><tr><td>FBS</td><td>gibco by Life Technologies</td><td>10099-141</td><td>heat-inactivate at 56 &amp;deg;C for 1 h</td></tr><tr><td>Puromycin Dihydrochloride</td><td>Thermo Fisher Scientific</td><td>A1113802</td><td></td></tr><tr><td>Nalgene Rapid-Flow Sterile Disposable Filter with a PES membrane</td><td>Thermo Fisher Scientific</td><td>168-0045</td><td></td></tr><tr><td>Pierce Protein Concentrator PES (10K MWCO, 20 mL)</td><td>Thermo Fisher Scientific</td><td>88528</td><td></td></tr><tr><td>0.22 &amp;micro;m Millex-GP Syringe Filter</td><td>Merck</td><td>F7648</td><td></td></tr><tr><td>Hanks&#039; Balanced Salt Solution (HBBS) + CaCl&lt;sup&gt;2&lt;/sup&gt; + MgCl&lt;sup&gt;2&lt;/sup&gt;</td><td>gibco by Life Technologies</td><td>14060-040</td><td></td></tr><tr><td>Hanks&#039; Balanced Salt Solution (HBBS) - CaCl2&lt;sup&gt;2&lt;/sup&gt; - MgCl&lt;sup&gt;2&lt;/sup&gt;</td><td>gibco by Life Technologies</td><td>14180-046</td><td></td></tr><tr><td>Ethylenediaminetetraacetic acid solution (EDTA)</td><td>Merck</td><td>03690-100ML</td><td></td></tr><tr><td>Iscove&#039;s Modified Dulbecco&#039;s Medium (IMDM) (1 X) + GlutaMAX</td><td>gibco by Life Technologies</td><td>31980-030</td><td></td></tr><tr><td>Chicken Serum</td><td>Merck</td><td>C5405-100ML</td><td></td></tr><tr><td>2-Mercaptoethanol 50 mM</td><td>gibco by Life Technologies</td><td>31350-010</td><td></td></tr><tr><td>Insulin-transferrin-sodium-selenite</td><td>gibco by Life Technologies</td><td>41400-045</td><td></td></tr><tr><td>Collagenase D</td><td>Roche Diagnostics GmbH</td><td>11088882001</td><td></td></tr><tr><td>100 &amp;micro;m Cell Strainer</td><td>Corning</td><td>431752</td><td></td></tr><tr><td>Histopaque-1083</td><td>Merck</td><td>10831-100ML</td><td></td></tr><tr><td>Trypan Blue solution</td><td>Merck</td><td>T8154-20ML</td><td></td></tr><tr><td>Nunc96 Well-Polystyrene Round Bottom Microwell Plates</td><td>Thermo Fisher Scientific</td><td>163320</td><td></td></tr><tr><td>Falcon 24-well Clear Flat Bottom TC-treated Multiwell Cell Culture Plate, with Lid, Sterile</td><td>Corning</td><td>353047</td><td></td></tr><tr><td>Rneasy Mini Kit</td><td>Qiagen</td><td>74104</td><td></td></tr></tbody></table>

an ex vivo chicken primary bursal-cell culture model to study infectious bursal disease virus pathogenesis

Infectious bursal disease virus (IBDV) is a birnavirus of economic importance to the poultry industry. The virus infects B cells, causing morbidity, mortality, and immunosuppression in infected birds. In this study, we describe the isolation of chicken primary bursal cells from the bursa of Fabricius, the culture and infection of the cells with IBDV, and the quantification of viral replication. The addition of chicken CD40 ligand significantly increased cell proliferation fourfold over six days of culture and significantly enhanced cell viability. Two strains of IBDV, a cell-culture adapted strain, D78, and a very virulent strain, UK661, replicated well in the ex vivo cell cultures. This model will be of use in determining how cells respond to IBDV infection and will permit a reduction in the number of infected birds used in IBDV pathogenesis studies. The model can also be expanded to include other viruses and could be applied to different species of birds.

Chicken Primary Bursal Cells Can Be Cultured in the Presence of Chicken CD40L
When chicken primary bursal cells were cultured in the presence of soluble chCD40L, the number of cells increased fourfold from 9.02 x 105 to 3.63 x 106 per mL over a period of 6 days, in contrast to when it was absent (p &#60;0.05) (Figure 1A). Cell viability was also significantly improved, for example from 25% at day 3 post-culture in the absence of chCD40L to 48% in the presence of chCD40L (p &#60;0.05) (Figure 1B)13.
Chicken Primary Bursal Cells Can Support the Replication of Both Cell-culture Adapted and Very Virulent Strains of IBDV
Mock-infected and infected cell cultures were fixed 18 h postinfection, labeled with a monoclonal antibody against IBDV VP2 and a secondary antibody conjugated to Alexa Fluor 488, and counterstained with DAPI. Infected cells had evidence of green fluorescence around the nucleus (Figure 2A), consistent with the presence of IBDV in the cytoplasm. This was evident for two strains of IBDV, a cell-culture adapted strain, D78, and a very virulent strain, UK661 (Figure 2A). At 5, 18, 24, and 48 h postinfection, RNA was extracted from infected cultures and subjected to RT-qPCR with primers specific to a conserved region of the IBDV VP4 gene. The expression of VP4 was first normalized to the house-keeping gene TBP and then expressed as fold change relative to mock samples in a &#916;&#916;Ct analysis. IBDV VP4 expression increased to 16,603 copies at 48 h postinfection with D78 and 38,632 copies at 48 h postinfection with UK661. Taken together, these data demonstrate that the chicken primary bursal cells could support the replication of cell-culture-adapted and very virulent IBDV strains13.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58489/58489fig1.jpg" /> 
Figure 1: Chicken primary bursal cells can be cultured in the presence of chicken CD40L. Chicken primary bursal cells were cultured in the presence or absence of chCD40L (black bars and white bars, respectively). (A) The number of live cells and (B) the percentage of viable cells were determined at the indicated time-points postinfection. The data shown are representative of at least three replicate experiments, the error bars represent the standard deviation of the mean, and the statistical significance was determined using a paired Student&#39;s t-test at each time-point, * p &#60;0.05. This figure has been modified with permission from Dulwich et al.13.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58489/58489fig2.jpg" /> 
Figure 2: Chicken primary bursal cells can support the replication of both cell-culture adapted and very virulent strains of IBDV. (A) Chicken primary bursal cells were mock-infected or infected with either D78 or UK661 and a sample from each culture was fixed, labeled and imaged: IBDV VP2, green; nuclei, blue. Scale bar = 7 &#181;m. (B) RNA was extracted at the indicated time-points postinfection, reverse-transcribed, and a conserved region of the IBDV VP4 gene was amplified by quantitative PCR. The log10 fold change in VP4 copy number was normalized to the TBP housekeeping gene and expressed relative to mock-infected samples as per the 2-&#916;&#916;CT method. The data shown are representative of at least three replicate experiments, and the error bars represent the standard deviation of the mean. This figure has been modified with permission from Dulwich et al.13.

Watch this Scientific Journal Video about An Ex Vivo Chicken Primary Bursal-cell Culture Model to Study Infectious Bursal Disease Virus Pathogenesis at JoVE.com

An Ex Vivo Chicken Primary Bursal-cell Culture Model to Study Infectious Bursal Disease Virus Pathogenesis

Here we describe the isolation of chicken primary bursal cells from the bursa of Fabricius, the culture and infection of the cells with infectious bursal disease virus, and the quantification of viral replication.

An Ex Vivo Chicken Primary Bursal-cell Culture Model to Study Infectious Bursal Disease Virus Pathogenesis

Infectious bursal disease virus (IBDV) is a birnavirus of economic importance to the poultry industry. The virus infects B cells, causing morbidity, ...

an-ex-vivo-chicken-primary-bursal-cell-culture-model-to-study

Research

JoVE Journal

Immunology and Infection

8.9K Views.  The Pirbright Institute. Here we describe the isolation of chicken primary bursal cells from the bursa of Fabricius, the culture and infection of the cells with infectious bursal disease virus, and the quantification of viral replication.

Video: An Ex Vivo Chicken Primary Bursal-cell Culture Model to Study Infectious Bursal Disease Virus Pathogenesis

Optimized Ex-ovo Culturing of Chick Embryos to Advanced Stages of Development

Research in anatomy, embryology, and developmental biology has largely relied on the use of model organisms. In order to study development in live embryos model organisms, such as the chicken, are often used. The chicken is an excellent model organism due to its low cost and minimal maintenance, however they present observational challenges because they are enclosed in an opaque eggshell. In order to properly view the embryo as it develops, the shell must be windowed or removed. Both windowing and ex ovo techniques have been developed to assist researchers in the study of embryonic development. However, each of the methods has limitations and challenges. Here, we present a simple, optimized ex ovo culture technique for chicken embryos that enables the observation of embryonic development from stage HH 19 into late stages of development (HH 40), when many organs have developed. This technique is easy to adopt in both undergraduate classes and more advanced research laboratories where embryo manipulations are conducted.

Optimized Ex-ovo Culturing of Chick Embryos to Advanced Stages of Development

Viewing and accessing the chicken embryo during development can be challenging. We have developed an ex ovo method that is simple, cost effective, and can easily be used in a classroom or research setting. This method provides access to the embryo into late stages of embryonic development (HH 40).

Research in anatomy, embryology, and developmental biology has largely relied on the use of model organisms. In order to study development in live embryos ...

Developmental Biology

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contribution of specific mutations in viral proteins in viral replication and/or pathogenesis and, also, viral vectors using recombinant influenza viruses expressing foreign proteins 3.

Rescue of influenza A viruses from plasmid DNA is a basic and essential experimental technique that allows influenza researchers to generate recombinant viruses to study multiple aspects in the biology of influenza virus, and to be used as potential vectors or vaccines.

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Primary Endodermal Epithelial Cell Culture from the Yolk Sac Membrane of Japanese Quail Embryos

We established an endodermal epithelial cell culture model (EEC) for studying the function of certain enzymes and proteins in mediating nutrient utilization by avian embryos during development. Fertilized Japanese quail eggs were incubated at 37 &#176;C for 5 days and then yolk sac membranes (YSM) were collected to establish the EEC culture system. We isolated the embryonic endoderm layer from YSM, and sliced the membrane into 2 - 3 mm pieces and partially digested with collagenase before seeding in 24-well culture plates. The EECs proliferate out of the tissue and are ready for cell culture studies. We found that the EECs had typical characteristics of YSM in vivo, for example, accumulation of lipid droplets, expression of sterol O-acyltransferase and lipoprotein lipase. The partial digestion treatment significantly increased the successful rate of EEC culture. Utilizing the EECs, we demonstrated that the expression of SOAT1 was regulated by the cAMP dependent protein kinase A related pathway. This primary Japanese quail EEC culture system is a useful tool to study embryonic lipid transportation and to clarify the role of genes involved in mediating nutrient utilization in YSM during avian embryonic development.

To study the mechanism of lipid utilization in yolk sac membranes during the late stages of avian embryonic development, we established a primary Japanese quail embryonic endodermal epithelial cell culture system.

We established an endodermal epithelial cell culture model (EEC) for studying the function of certain enzymes and proteins in mediating nutrient ...

Ex Vivo Organotypic Corneal Model of Acute Epithelial Herpes Simplex Virus Type I Infection

Herpes keratitis is one of the most severe pathologies associated with the herpes simplex virus-type 1 (HSV-1). Herpes keratitis is currently the leading cause of both cornea-derived and infection-associated blindness in the developed world. Typical presentation of herpes keratitis includes infection of the corneal epithelium and sometimes the deeper corneal stroma and endothelium, leading to such permanent corneal pathologies as scarring, thinning, and opacity 1.
Corneal HSV-1 infection is traditionally studied in two types of experimental models. The in vitro model, in which cultured monolayers of corneal epithelial cells are infected in a Petri dish, offers simplicity, high level of replicability, fast experiments, and relatively low costs. On the other hand, the in vivo model, in which animals such as rabbits or mice are inoculated directly in the cornea, offers a highly sophisticated physiological system, but has higher costs, longer experiments, necessary animal care, and a greater degree of variability. 
In this video article, we provide a detailed demonstration of a new ex vivo model of corneal epithelial HSV-1 infection, which combines the strengths of both the in vitro and the in vivo models. The ex vivo model utilizes intact corneas organotypically maintained in culture and infected with HSV-1. The use of the ex vivo model allows for highly physiologically-based conclusions, yet it is rather inexpensive and requires time commitment comparable to that of the in vitro model.

Ex Vivo Organotypic Corneal Model of Acute Epithelial Herpes Simplex Virus Type I Infection

In this video article we describe the use of a new ex vivo model of acute herpes simplex virus type I corneal epithelial infection.

Herpes keratitis is one of the most severe pathologies associated with the herpes simplex virus-type 1 (HSV-1).  Herpes keratitis is currently the leading ...

Neuroscience

Production of High-Titer Recombinant Newcastle Disease Virus from Allantoic Fluid

Newcastle disease virus (NDV), also known as avian orthoavulavirus serotype-1, is a negative sense, single-stranded RNA virus that has been developed both as an oncolytic virus and a viral-vectored vaccine. NDV is an attractive therapeutic and prophylactic agent due to its well-established reverse genetics system, potent immunostimulatory properties, and excellent safety profile. When administered as an oncolytic virus or a viral-vectored vaccine, NDV elicits a robust antitumor or antigen-specific immune response, activating both the innate and adaptive arms of the immune system. 
Given these desirable characteristics, NDV has been evaluated in numerous clinical trials and is one of the most well-studied oncolytic viruses. Currently, there are two registered clinical trials involving NDV: one evaluating a recombinant NDV-vectored vaccine for SARS-CoV-2 (NCT04871737), and a second evaluating a recombinant NDV encoding Interleukin-12 in combination with Durvalumab, an antiPD-L1 antibody (NCT04613492). To facilitate further advancement of this highly promising viral vector, simplified methods for generating high-titer, in vivo-grade, recombinant NDV (rNDV) are needed. 
This paper describes a detailed procedure for amplifying rNDV in specified pathogen-free (SPF) embryonated chicken eggs and purifying rNDV from allantoic fluid, with improvements to reduce loss during purification. Also included are descriptions of the recommended quality control assays, which should be performed to confirm lack of contaminants and virus integrity. Overall, this detailed procedure enables the synthesis, purification, and storage of high-titer, in vivo-grade, recombinant, lentogenic, and mesogenic NDV for use in preclinical studies.

Here we provide a detailed procedure for production, purification, and quantification of high-titer recombinant Newcastle disease virus. This protocol consistently yields &#62; 6 &#215; 109 plaque-forming units/mL, providing virus quantities appropriate for in vivo animal studies. Additional quality control assays to ensure safety in vivo are described.

Newcastle disease virus (NDV), also known as avian orthoavulavirus serotype-1, is a negative sense, single-stranded RNA virus that has been developed both ...

Cancer Research

"Liver-on-a-Chip" Cultures of Primary Hepatocytes and Kupffer Cells for Hepatitis B Virus Infection

Despite the exceptional infectivity of the hepatitis B virus (HBV) in vivo, where only three viral genomes can result in a chronicity of experimentally infected chimpanzees, most in vitro models require several hundreds to thousands of viral genomes per cell in order to initiate a transient infection. Additionally, static 2D cultures of primary human hepatocytes (PHH) allow only short-term studies due to their rapid dedifferentiation. Here, we describe 3D liver-on-a-chip cultures of PHH, either in monocultures or in cocultures with other nonparenchymal liver-resident cells. These offer a significant improvement to studying long-term HBV infections with physiological host cell responses. In addition to facilitating drug efficacy studies, toxicological analysis, and investigations into pathogenesis, these microfluidic culture systems enable the evaluation of curative therapies for HBV infection aimed at eliminating covalently closed, circular (ccc)DNA. This presented method describes the set-up of PHH monocultures and PHH/Kupffer cell co-cultures, their infection with purified HBV, and the analysis of host responses. This method is particularly applicable to the evaluation of long-term effects of HBV infection, treatment combinations, and pathogenesis.

The goal of this protocol is to provide a step-by-step guide to perform 3-D &#34;liver-on-a-chip&#34; infection experiments with the hepatitis B virus.

Despite the exceptional infectivity of the hepatitis B virus (HBV) in vivo, where only three viral genomes can result in a chronicity of experimentally ...

A Cell Culture Model for Producing High Titer Hepatitis E Virus Stocks

Hepatitis E virus is the leading cause of liver cirrhosis and liver failure with increasing prevalence worldwide. The single-stranded RNA virus is predominantly transmitted by blood transfusions, inadequate sanitary conditions and contaminated food products. To date the off-label drug ribavirin (RBV) is the treatment of choice for many patients. Nonetheless, a specific HEV treatment remains to be identified. So far, the knowledge about the HEV life cycle and pathogenesis has been severely hampered because of the lack of an efficient HEV cell culture system. A robust cell culture system is essential for the study of the viral life cycle which also includes the viral pathogenesis. With the method described here one can produce viral titers of up to 3 x 106 focus forming unit/mL (FFU/mL) of non-enveloped HEV and up to 5 x 104 FFU/mL of enveloped HEV. Using these particles, it is possible to infect a variety of cells of diverse origins including primary cells and human, as well as animal cell lines. The production of infectious HEV particles from plasmids poses an infinite source, which makes this protocol exceedingly efficient.

Described here is an effective method on how to produce high viral titer stocks of hepatitis E virus (HEV) to efficiently infect hepatoma cells. With the presented method, both non-enveloped, as well as enveloped viral particles can be harvested and used for inoculating various cell lines.

Hepatitis E virus is the leading cause of liver cirrhosis and liver failure with increasing prevalence worldwide. The single-stranded RNA virus is ...

Modeling Hepatitis B Virus Infection in Non-Hepatic 293T-NE-3NRs Cells

HBV mainly infects human hepatocytes, but it has also been found to infect extrahepatic tissues such as kidney and testis. Nonetheless, cell-based HBV models are limited to hepatoma cell lines (such as HepG2 and Huh7) overexpressing a functional HBV receptor, sodium taurocholate co-transporting polypeptide (NTCP). Here, we used 293T-NE-3NRs (293T&#160;overexpressing human NTCP, HNF4&#945;, RXR&#945; and PPAR&#945;) and HepG2-NE (HepG2 overexpressing NTCP) as model cell lines.&#160;HBV infection in these cell lines was performed either by using concentrated HBV virus particles from HepG2.2.15 or co-culturing HepG2.2.15 with the target cell lines. HBcAg immunofluorescence for HBcAg was performed to confirm HBV infection. The two methods presented here will help us study HBV infection in non-hepatic cell lines.&#160;&#160;

This manuscript describes a detailed protocol for Hepatitis B virus (HBV) infection in novel engineered 293T cells (293T-NE-3NRs, expressing human NTCP, HNF4&#945;, RXR&#945; and PPAR&#945;) and traditional hepatic cells (HepG2-NE, expressing human NTCP).

HBV mainly infects human hepatocytes, but it has also been found to infect extrahepatic tissues such as kidney and testis. Nonetheless, cell-based HBV ...

Establishment of a 2D Monolayer from 3D Bovine Ileal Enteroid Culture

Generation of a Bovine Primary Enteroid-Derived Two-Dimensional Monolayer Culture System for Applications in Translational Biomedical Research

Organoid cell culture systems can recapitulate the complexity observed in tissues, making them useful in studying host-pathogen interactions, evaluating drug efficacy and toxicity, and tissue bioengineering. However, applying these models for the described reasons may be limited because of the three-dimensional (3D) nature of these models. For example, using 3D enteroid culture systems to study digestive diseases is challenging due to the inaccessibility of the intestinal lumen and its secreted substances. Indeed, stimulation of 3D organoids with pathogens requires either luminal microinjection, mechanical disruption of the 3D structure, or generation of apical-out enteroids. Moreover, these organoids cannot be co-cultured with immune and stromal cells, limiting in-depth mechanistic analysis into pathophysiological dynamics. To circumvent this, we optimized a bovine primary cell two-dimensional (2D) enteroid-derived monolayer culture system, allowing co-culture with other relevant cell types. Ileal crypts isolated from healthy adult cattle were cultured to generate 3D organoids that were cryopreserved for future use. A 2D monolayer was created using revived 3D enteroids that were passaged and disrupted to yield single cells, which were seeded on basement membrane extract-coated transwell cell culture inserts, thereby exposing their apical surface. The intestinal monolayer polarity, cellular differentiation, and barrier function were characterized using immunofluorescence microscopy and measuring transepithelial electrical resistance. Stimulation of the apical surface of the monolayer revealed the expected functionality of the monolayer, as demonstrated by cytokine secretion from both apical and basal compartments. The described 2D enteroid-derived monolayer model holds great promise in investigating host-pathogen interactions and intestinal physiology, drug development, and regenerative medicine.

Author Spotlight: Advanced Enteroid Model for Studying Host-Pathogen Interactions 

Enteroids are emerging as a novel model for studying tissue physiology and pathophysiology, drug development, and regenerative medicine. Here, we describe a bovine primary cell 2D enteroid-derived culture system that permits co-culture with relevant tissue cell types. This model offers a translational advantage for gastrointestinal research modeling.

Organoid cell culture systems can recapitulate the complexity observed in tissues, making them useful in studying host-pathogen interactions, evaluating ...

Quantifying Pyroptosis in Infectious Bursal Disease Virus-Infected DF-1 Cells

Examination of Pyroptosis by Flow Cytometry

Pyroptosis is an inflammatory type of programmed cell death predominantly driven by the formation of plasma membrane pores by the N-terminus generated from the cleaved Gasdermin (GSDM) family proteins. Examination of membrane-attached GSDM-NT by Western Blot is the most commonly used method for evaluating pyroptosis. However, it is difficult to differentiate cells with pyroptosis from other forms of cell death using this method. In this study, Infectious Bursal Disease Virus (IBDV)-infected DF-1 cells were employed as a model to quantify the proportion of cells undergoing pyroptosis by flow cytometry, utilizing specific antibodies against the N-terminal fragment of chicken GSDME (chGSDME-NT) and propidium iodide (PI) staining. The chGSDME-NT-positive cells were readily detectable by flow cytometry using Alexa Fluor 647-labeled anti-chGSDME-NT antibodies. Moreover, the proportion of chGSDME-NT/PI double-positive cells in IBDV-infected cells (around 33%) was significantly greater than in mock-infected controls (P &#60; 0.001). These findings indicate that examination of membrane-bound chGSDME-NT by flow cytometry is an effective approach for determining pyroptotic cells among cells undergoing cell death.

Author Spotlight: Flow Cytometric Determination of Pyroptosis in Avian Cells

This article describes the identification of pyroptotic cells using flow cytometry after dual staining with antibodies against the N-terminal fragment of chicken GSDME (chGSDME-NT) and propidium iodide (PI).

Pyroptosis is an inflammatory type of programmed cell death predominantly driven by the formation of plasma membrane pores by the N-terminus generated ...

An Ex Vivo Chicken Primary Bursal-cell Culture Model to Study Infectious Bursal Disease Virus Pathogenesis

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Optimized Ex-ovo Culturing of Chick Embryos to Advanced Stages of Development

Generation of Recombinant Influenza Virus from Plasmid DNA

Primary Endodermal Epithelial Cell Culture from the Yolk Sac Membrane of Japanese Quail Embryos

Ex Vivo Organotypic Corneal Model of Acute Epithelial Herpes Simplex Virus Type I Infection

Production of High-Titer Recombinant Newcastle Disease Virus from Allantoic Fluid

"Liver-on-a-Chip" Cultures of Primary Hepatocytes and Kupffer Cells for Hepatitis B Virus Infection

A Cell Culture Model for Producing High Titer Hepatitis E Virus Stocks

Modeling Hepatitis B Virus Infection in Non-Hepatic 293T-NE-3NRs Cells

Generation of a Bovine Primary Enteroid-Derived Two-Dimensional Monolayer Culture System for Applications in Translational Biomedical Research

Examination of Pyroptosis by Flow Cytometry