This work was funded by NIAID 1K22AI118929-01. EBP was supported by a Summer Research Fellowship Program Grant from the Office of Research at Old Dominion University, Norfolk, Virginia, USA.

1. Inducible Overexpression of a Histidine-tagged Protein
<ol>
	<li>Amplify rsh from C. difficile R20291 genomic DNA.
	<ol>
		<li>Use a high-fidelity polymerase and follow the manufacturer&#8217;s instructions.</li>
		<li>Amplify C. difficile rsh using primers 
		rsh_F(CAGGTACCGGTTATATGCATGATAAAGAATTACAAG) and 
		rsh_R(CCCTGCAGCTAATGGTGATGGTGATGGTGATTTGTCATTCTATAAATAC), which introduces a C-terminal hexahistidine tag. 
		NOTE: The KpnI and PstI cut sites in the primer sequences are bolded.</li>
		<li>Digest the pMMBneo vector and the rsh-his6 PCR product with Pstl and KpnI restriction cut sites at 37 &#176;C for 45 min.</li>
		<li>Purify the linearized vector and the PCR fragments via agarose gel electrophoresis and subsequent purification with a DNA gel extraction kit.</li>
		<li>Measure the 280 nm absorbance (A280) of the vector and the amplified PCR product. Use the equation <img alt="Equation 1" src="/files/ftp_upload/58547/58547eq1.jpg" /> to determine the DNA concentration of each DNA fragment.</li>
	</ol>
	</li>
	<li>Ligate rsh into pMMBneo for expression.
	<ol>
		<li>Combine 25 ng of digested PMMBneo vector, 125 ng of rsh-his6 gene product, 2 &#956;L of 10x ligase buffer, and 1 &#956;L of DNA ligase. Use the nuclease free water to adjust the total volume to 20 &#956;L. Incubate at 16 &#176;C for 16 h. 
		NOTE: The efficacy of ligation depends on fragment size and must be adjusted based on manufacturer protocols.</li>
		<li>Transform the ligated vector product into E. coli DH5-&#945; or another recA- plasmid maintenance strain. Select for transformed cells on LB plates with 100 &#956;g/mL kanamycin and incubate for 16&#8211;24 h at 37 &#176;C.</li>
		<li>Pick four colonies from the transformation plate (s) and streak each on a fresh plate containing 100 &#956;g/mL kanamycin for DNA isolation. Incubate the new plates at 37 &#176;C for 16&#8211;24 h and select one isolate for the subsequent protein expression.</li>
		<li>To confirm the successful ligation of the intact rsh protein coding region, pick a colony of the chosen isolate into 20 &#956;L of water, heat at 95 &#176;C for 10 min, and use as a template for a confirmatory PCR using the same primer used to amplify the gene.</li>
	</ol>
	</li>
	<li>Transform the verified plasmid according to standard transformation protocols for E. coli bacterial plasmid transformation into E. coli BL21 system for high yield protein production.</li>
	<li>Express RSH-His6 in E. coli.
	<ol>
		<li>Select a single colony of E. coli BL21 transformed with pMMBneo::rsh and inoculate 2 mL of LB medium with 50 &#956;g/mL kanamycin. Incubate at 37 &#176;C 12&#8211;16 h while shaking at 250 rpm.</li>
		<li>Inoculate 500 mL of LB medium containing 50 &#956;g/mL kanamycin with 0.5 mL of the overnight culture for cell growth and protein expression.</li>
		<li>Incubate the expression culture at 37 &#176;C and 250 rpm in an incubator shaker until the cell density reaches an&#160;OD600 0.167 at 37 &#176;C.</li>
		<li>Reduce the incubator temperature to 30 &#176;C and wait 30 min for the culture temperature to drop.</li>
		<li>Induce RSH expression by adding isopropyl &#946;-D-thiogalactoside (IPTG) to a final concentration of 0.5 mM. Allow the induction to take place overnight (for 16&#8211;18 h) at 30 &#176;C, shaking at 250 rpm.</li>
		<li>Pellet by centrifugation at 3,080 x g for 30 min at 4 &#176;C. 
		NOTE: The pellet can be stored overnight at -20 &#176;C for purifying target protein the following day without noticeable loss of protein yield or enzymatic activity.</li>
	</ol>
	</li>
</ol>
2. Protein Purification by Nickel Affinity Chromatography
NOTE: Continue directly with protein purification steps provided below after clarifying the cell lysate. Storing clarified lysate at 4 &#176;C overnight for subsequent protein purification reduces the protein yield.
<ol>
	<li>Purify protein using 1 mL of Nickel-Nitriloacetic Acid (Ni-NTA) resin on a gravity column.
	<ol>
		<li>The day before use, equilibrate the column overnight at 4 &#176;C with 2 mL of equilibration buffer (10 mM Tris-HCl pH 7.79, 300 mM NaCl, 50 mM NaH2PO4, 0.5 mg/mL lysozyme, 5 mM MgCl2, 10 mM imidazole, 0.25 mM DTT, 5 mM phenylmethane sulfonyl fluoride (PMSF), 10% glycerol).</li>
		<li>The following day bring the column from 4 &#176;C to RT prior to loading the clarified lysate and let it stand for ~2&#8211;3 h. 
		NOTE: Bringing the column to thermal equilibrium is crucial to avoid air bubbles forming within the column.</li>
		<li>Resuspend the pellet obtained in step 1.3.6 in the lysis buffer (10 mM Tris-HCl pH 7.8, 300 mM NaCl, 5 mM MgCl2, 50 mM NaH2PO4, 10% glycerol, 0.5 mg/mL lysozyme, 10 mM imidazole, 0.25 mM DTT and 5 mM PMSF).</li>
		<li>Sonicate cells on ice for 8&#160;x 10 s intervals, pausing 30 s between pulses.</li>
		<li>Clarify the lysate by centrifugation at 3,080 x g for 30 min at 4 &#176;C using a microcentrifuge.</li>
		<li>Prepare lysate with equal volumes of lysis buffer then apply the prepped clarified lysate to the column and collect the flow-through.</li>
		<li>Reapply clarified lysate flow-through to the column and collect the secondary flow-through.</li>
		<li>Wash the column with wash buffer 1 (10 mM Tris-HCl (pH 7.79), 300 mM NaCl, 5 mM MgCl2, 50 mM NaH2PO4, 30 mM imidazole, 10% glycerol). Collect the flow-through. 
		NOTE: Inclusion of 5 mM MgCl2 in the wash and elution buffers is important for enzymatic activity of the purified protein.</li>
		<li>Wash the column with wash buffer 2 (10 mM Tris-HCl (pH 7.79), 300 mM NaCl, 5 mM MgCl2, 50 mM NaH2PO4 and 50 mM imidazole). Collect the flow-through.</li>
		<li>Apply 2 mL elution buffer (10 mM Tris-HCl (pH 7.79), 300 mM NaCl, 50 mM NaH2PO4, 10% glycerol and 75 mM imidazole). Collect flow-through in two fractions of 1 mL each. 
		NOTE: The column after this step can be stored in equilibration buffer at 4 &#176;C if the same protein will be purified in the next purification assay. The column can be used up to 3 times if stored properly.</li>
	</ol>
	</li>
	<li>Assess column fractions for purity by SDS-PAGE.
	<ol>
		<li>To qualitatively assess protein purification, run 20 &#956;L aliquots of all column fractions on a 4%/10% polyacrylamide gel for 60 min at 170&#160;V.</li>
		<li>Stain the gel with 0.1% Coomassie blue at room temperature for 5 h, rocking gently on a benchtop rocker.</li>
		<li>Destain the gel in 40% methanol, 10% glacial acetic acid overnight at room temperature, rocking on a benchtop rocker. 
		NOTE: A representative gel is pictured in Figure 1.</li>
	</ol>
	</li>
	<li>Dialyze elute fraction 2 overnight at 4 &#176;C.
	<ol>
		<li>Dialyze against dialysis buffer (15.7 mM Tris-HCl (pH 7.6), 471.9 mM NaCl, 15.69 mM MgCl2, 1.57 mM DTT, 1.5 mM PMSF, and 15.7% glycerol) at a 200:1 ratio using a 1 mL dialysis device with a 20 kDa molecular weight cut-off (MWCO).</li>
		<li>Determine the concentration of dialyzed protein sample by measuring absorbance at 280 nm and using the calculated molar extinction coefficient 82085 M-1cm-1 20.</li>
		<li>Store 5 &#956;L aliquots of the dialyzed protein sample in aliquots at -80 &#176;C until use.</li>
	</ol>
	</li>
</ol>
3. Protein Activity Assay by Thin Layer Chromatography
<ol>
	<li>Prepare the thin layer chromatography plate.
	<ol>
		<li>Prior to performing the reaction, prepare polyethyleneimine (PEI)-cellulose plates by washing in deionized water. Place the plates in a glass chamber with double distilled water to a depth of ~0.5 cm.</li>
		<li>Allow water to migrate to the top of the plate. 
		NOTE: Washing the plates is not strictly necessary, as plates may be used without it, but washing does increase the clarity of resulting images. Washing the plates in two perpendicular directions further ensures that any contaminants present in the resin are isolated in one corner of the plate (Figure 2).</li>
		<li>Bring the plates out of the glass chamber and leave on a benchtop rack to dry overnight (12&#8211;18 h).</li>
		<li>Mark the dry plates 2.0 cm from one edge with a soft pencil to indicate where the samples will be applied for TLC. For 2 &#956;L samples, apply samples no less than 1.0 cm apart (Figure 2). 
		NOTE: This allows clear separation between adjacent spot, which is critical for signal quantification. As long as the cellulose resin is not scratched, small pencil marks on the surface will not interfere with solvent migration.</li>
		<li>When planning experiments, always leave one spot on each plate unused. 
		NOTE: This will provide a blank lane for sample quantification (Figure 2). A 20 cm TLC plate will have room for 19 spots.</li>
	</ol>
	</li>
	<li>Enzyme activity assay
	<ol>
		<li>Prepare a 5x buffer mix containing 50 mM Tris-HCl (pH 7.5), 25 mM ammonium acetate, 10 mM KCl, 1 mM DTT and 0.6 mM ATP. 
		NOTE: This mix may be prepared in large quantities and frozen in 10 &#956;L aliquots for later use. Do not subject mix to multiple freeze-thaw cycles.</li>
		<li>Prepare individual reactions containing 3 &#956;M RSH, 1x buffer mix, 0.6 mM GDP, 1.2 mM MgCl2. Add 1.0 &#956;Ci of &#947;-32P-ATP per 10 &#956;L of reaction and use nuclease free water to bring the reaction up to a desired volume. Add the RSH after the other components have been mixed, as the addition of RSH to the nucleotide-containing mix initiates the enzymatic activity assay. 
		NOTE: Final reaction volume will depend on the number of timepoints sampled. To sample 2 &#956;L/timepoint, assemble 10 &#956;L of reaction mixture for each 4 timepoints.</li>
		<li>To control for ATP hydrolysis from contaminating nuclease activity, assemble a 10 &#956;L reaction containing no protein and incubate it in parallel. Spot 2 &#956;L samples at t = 0 and at the end of the experiment to ensure that ATP was not hydrolyzed in the absence of protein.</li>
		<li>Immediately upon addition of RSH, remove 2 &#956;L and spot it onto the labeled PEI-cellulose plate as the t = 0 min sample.</li>
		<li>Incubate the reaction at 37 &#176;C, removing 2 &#956;L aliquots at desired timepoints. 
		NOTE: Enzymatic activity will cease when the sample is adsorbed onto the cellulose plate. Wait 10&#8211;30 min after the last spot is added to plate before development to ensure complete adsorption and sample drying.</li>
	</ol>
	</li>
	<li>Thin layer chromatography
	<ol>
		<li>Fill the chromatography chamber with 1.5 M 1.5 M KH2PO4 (pH 3.64) to a depth of 0.5 cm. 
		NOTE: The volume needed will depend on the dimensions of the chromatography tank. Any glass container with a level bottom that is wide enough to allow insertion of the TLC plate without bending may be used as a developing tank with the addition of a cover. The TLC plate can be cut into narrower strips with a clean razorblade to enable development in a glass beaker covered in plastic film.</li>
		<li>Immerse the bottom edge of the plate in solvent. Allow the solvent to migrate to the top of the plate (~90 min). 
		NOTE: While solvent migration will halt at the top of the plate and samples will not be lost or run together during a longer immersion, plates should not be left in solvent overnight. Immersions longer than 4 h can cause the resin to detach from the plate backing and result in loss of signal.</li>
		<li>Remove the plate from the chromatography tank and place it on a benchtop drying rack.</li>
		<li>Allow the plate to air dry overnight. 
		NOTE: Drying may be accelerated by the use of a hair drier. Dryness can be assessed by the color of the resin, which will darken when wet and return to the color of an unused plate when completely dry.</li>
		<li>After the plate is dry, wrap the plate in plastic film to avoid transfer of radioactive material to the imaging cassette and analyze by autoradiography (Figure 3).</li>
	</ol>
	</li>
	<li>Data analysis
	<ol>
		<li>Expose the PEI-cellulose plate containing separated reactions to a phosphorimager cassette for 4 h at room temperature. 
		NOTE: This is sufficient exposure to yield a very clear image using the indicated concentrations of fresh &#947;-32P-ATP. If lower amounts of radiolabelled substrate are used, exposure time can be increased to 12-16 h.</li>
		<li>Image the cassette on a phosphorimager.</li>
		<li>Using imaging software with a graphical user interface, draw Regions of Interest (ROIs) by selecting Draw Rectangle and using the mouse to draw rectangular ROIs around one entire lane and the ATP and ppGpp spots contained within that lane (Figure 3).</li>
		<li>Use the Select, Copy, and Paste commands (or corresponding commands based on the imaging software being used) to draw identical ROIs within the other lanes to ensure that the ROIs are measuring signal within identical areas in each lane. Include ROIs from an unused lane, to be used as blanks.</li>
		<li>Using the Analyze | Tools | ROI Manager | Add commands of the imaging software, select all of the ROIs drawn on the PEI cellulose plate.</li>
		<li>Using the Analyze | Set Measurements | Measure commands, quantify the signal intensity within each ROI and export the measurements as a spreadsheet (Figure 3). Subtract blank ROI values from experimental signals.</li>
		<li>Calculate what percentage of the blanked signal within each lane is attributable to ATP and ppGpp using the formulas <img alt="Equation" src="/files/ftp_upload/58547/58547eq2.jpg" /> 
		NOTE: ROIs may be drawn and quantitated using commercial software compatible with the phosphorimager or freely available ImageJ software (National Institutes of Health).</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Cheek, S., Ginalski, K., Zhang, H., Grishin, N. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+update+of+the+sequence+and+structure+classification+of+kinases.">A comprehensive update of the sequence and structure classification of kinases.</a> BMC Structural Biology. 5 (1), 6 (2005).</li><li>Porath, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilized+metal+ion+affinity+chromatography.">Immobilized metal ion affinity chromatography.</a> Protein Expression and Purification. 3 (4), 263-281 (1992).</li><li>Arnau, J., Lauritzen, C., Pedersen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+strategy,+production+and+purification+of+proteins+with+exopeptidase-cleavable+His-tags.">Cloning strategy, production and purification of proteins with exopeptidase-cleavable His-tags.</a> Nature Protocols. 1 (5), 2326-2333 (2006).</li><li>Porath, J., Carlsson, J., Olsson, I., Belfrage, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metal+chelate+affinity+chromatography,+a+new+approach+to+protein+fractionation.">Metal chelate affinity chromatography, a new approach to protein fractionation.</a> Nature. 258 (5536), 598-599 (1975).</li><li>Smith, M. C., Furman, T. C., Ingolia, T. D., Pidgeon, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chelating+peptide-immobilized+metal+ion+affinity+chromatography.+A+new+concept+in+affinity+chromatography+for+recombinant+proteins.">Chelating peptide-immobilized metal ion affinity chromatography. A new concept in affinity chromatography for recombinant proteins.</a> Journal of Biological Chemistry. 263 (15), 7211-7215 (1988).</li><li>Graslund, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+purification.">Protein production and purification.</a> Nature Methods. 5 (2), 135-146 (2008).</li><li>Booth, W. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+an+N-terminal+Polyhistidine+Tag+on+Protein+Thermal+Stability.">Impact of an N-terminal Polyhistidine Tag on Protein Thermal Stability.</a> ACS Omega. 3 (1), 760-768 (2018).</li><li>Thielges, M. C., Chung, J. K., Axup, J. Y., Fayer, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+histidine+tag+attachment+on+picosecond+protein+dynamics.">Influence of histidine tag attachment on picosecond protein dynamics.</a> Biochemistry. 50 (25), 5799-5805 (2011).</li><li>Chaga, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Twenty-five+years+of+immobilized+metal+ion+affinity+chromatography:+past,+present+and+future.">Twenty-five years of immobilized metal ion affinity chromatography: past, present and future.</a> Journal of Biochemical and Biophysical Methods. 49 (1-3), 313-334 (2001).</li><li>Ma, H., Deacon, S., Horiuchi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+challenge+of+selecting+protein+kinase+assays+for+lead+discovery+optimization.">The challenge of selecting protein kinase assays for lead discovery optimization.</a> Expert opinion on drug discovery. 3 (6), 607-621 (2008).</li><li>Tamayo, R., Tischler, A. D., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+EAL+domain+protein+VieA+is+a+cyclic+diguanylate+phosphodiesterase.">The EAL domain protein VieA is a cyclic diguanylate phosphodiesterase.</a> Journal of Biological Chemistry. 280 (39), 33324-33330 (2005).</li><li>Purcell, E. B., McKee, R. W., McBride, S. M., Waters, C. M., Tamayo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+Diguanylate+Inversely+Regulates+Motility+and+Aggregation+in+Clostridium+difficile.">Cyclic Diguanylate Inversely Regulates Motility and Aggregation in Clostridium difficile.</a> Journal of Bacteriology. 194 (13), 3307-3316 (2012).</li><li>Purcell, E. B., Tamayo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+cyclic+nucleotide+phosphodiesterases.">Identification and characterization of cyclic nucleotide phosphodiesterases.</a> Methods in Molecular Biology. 1016, 235-243 (2013).</li><li>Ross, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+cellulose+synthesis+Acetobacter+xylinum.+A+unique+guanyl+oligonucleotide+is+the+immediate+activator+of+the+cellulose+synthase.">Control of cellulose synthesis Acetobacter xylinum. A unique guanyl oligonucleotide is the immediate activator of the cellulose synthase.</a> Carbohydrate Research. 149 (1), 101-117 (1986).</li><li>Potrykus, K., Cashel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=(p)ppGpp:+still+magical?.">(p)ppGpp: still magical?.</a> Annual Review of Microbiology. 62, 35-51 (2008).</li><li>Boutte, C. C., Crosson, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+lifestyle+shapes+stringent+response+activation.">Bacterial lifestyle shapes stringent response activation.</a> Trends in Microbiology. 21 (4), 174-180 (2013).</li><li>Nanamiya, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+functional+analysis+of+novel+(p)ppGpp+synthetase+genes+in+Bacillus+subtilis.">Identification and functional analysis of novel (p)ppGpp synthetase genes in Bacillus subtilis.</a> Molecular Microbiology. 67 (2), 291-304 (2008).</li><li>Gaca, A. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basal+Levels+of+(p)ppGpp+in+Enterococcus+faecalis:+the+Magic+beyond+the+Stringent+Response.">Basal Levels of (p)ppGpp in Enterococcus faecalis: the Magic beyond the Stringent Response.</a> mBio. 4 (5), (2013).</li><li>Sebaihia, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multidrug-resistant+human+pathogen+Clostridium+difficile+has+a+highly+mobile,+mosaic+genome.">The multidrug-resistant human pathogen Clostridium difficile has a highly mobile, mosaic genome.</a> Nature Genetics. 38 (7), 779-786 (2006).</li><li>Gasteiger, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ExPASy:+The+proteomics+server+for+in-depth+protein+knowledge+and+analysis.">ExPASy: The proteomics server for in-depth protein knowledge and analysis.</a> Nucleic Acids Research. 31 (13), 3784-3788 (2003).</li><li>Purcell, E. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nutrient-regulated+cyclic+diguanylate+phosphodiesterase+controls+Clostridium+difficile+biofilm+and+toxin+production+during+stationary+phase.">A nutrient-regulated cyclic diguanylate phosphodiesterase controls Clostridium difficile biofilm and toxin production during stationary phase.</a> Infection and Immunity. , (2017).</li><li>Mechold, U., Murphy, H., Brown, L., Cashel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intramolecular+Regulation+of+the+Opposing+(p)ppGpp+Catalytic+Activities+of+RelSeq,+the+Rel/Spo+Enzyme+from+Streptococcus+equisimilis.">Intramolecular Regulation of the Opposing (p)ppGpp Catalytic Activities of RelSeq, the Rel/Spo Enzyme from Streptococcus equisimilis.</a> Journal of Bacteriology. 184 (11), 2878-2888 (2002).</li><li>Dalebroux, Z. D., Svensson, S. L., Gaynor, E. C., Swanson, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ppGpp+Conjures+Bacterial+Virulence.">ppGpp Conjures Bacterial Virulence.</a> Microbiology and Molecular Biology Reviews. 74 (2), 171-199 (2010).</li><li>Bartlett, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clostridium+difficile:+progress+and+challenges.">Clostridium difficile: progress and challenges.</a> Annals of the New York Academy of Sciences. 1213, 62-69 (2010).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> US Department of Health and Human Services. , (2013).</li></ol>

The authors declare no competing financial interests or other conflicts of interest.

Here we report the purification of His-tagged RSH from C. difficile and present a method for activity quantification using radiolabeled thin layer chromatography. This method has previously been used to assess the activity of diguanylate cyclase enzymes from C. difficile, as well as (p)ppGpp synthetase, nucleotide cyclase, kinase and phosphodiesterase enzymes from other organisms11,12,13,<sup class="...

Kinase and pyrophosphokinase (or diphospho-kinase) enzymes transfer phosphates from nucleotide triphosphate (NTP) precursors to substrate molecules. The substrates can include other nucleotides, amino acids or proteins, carbohydrates, and lipids1. Bioinformatic analyses can sometimes predict an enzyme&#39;s cognate substrate or substrates based on the similarity to characterized enzymes, but experimental validation is still necessary. Similarly, the affinity of an enzyme for its substrate(s) and the rate at which it catalyzes the phosphor-transfer reaction, and the effects of co-factors, inhibitors, or other enzyme effectors must be determined experimentally. To avoid depletion of the ATP precursor by other ATP-consuming enzymes present in bacterial cytoplasm, quantitative activity assays require purified protein.
Protein purification by metal affinity chromatography has been covered thoroughly in the literature2,3. Histidine tags consisting of six consecutive histidine residues appended to the N- or C-terminus of a recombinant protein allow rapid purification by metal affinity chromatography4,5,6. These sequences are small compared to the proteins they modify and typically have a minimal effect on protein function, although they can sometimes alter protein stability and/or enzyme kinetics7,8. Histidine tags at the N- and C-termini of the same protein can have different effects, which are difficult to predict without knowing the structure of the protein in question. Histidine tags are typically incorporated during the cloning of a recombinant protein by designing primers that encode six histidine residues, either immediately 3&#39; to the ATG start codon or immediately 5&#39; to the stop codon of the open reading frame. After amplification, the hexahistidine-containing gene is ligated into a vector under the control of an inducible promoter and expressed, typically in a laboratory strain of E. coli. The recombination protein can then be isolated on an affinity resin containing immobilized divalent cations (typically nickel or cobalt)9. Contaminating native metal-binding proteins can be removed by titration with imidazole, which competitively displaces bound protein2. Finally, the target protein is eluted from the column with higher concentrations of imidazole. There are several commercial sources for immobilized metal cation resins, and the manufacturers provide recommendations for the buffer conditions and imidazole concentrations. After elution, protein may be analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), dialyzed, or used immediately in functional assays.
There are several methods to indirectly monitor kinase activity by coupling ATP phosphate bond hydrolysis to a second reaction that releases or excites a fluorophore or generates chemiluminescence, but these reactions have multiple moving parts and can be logistically challenging10. The most straightforward way to specifically measure phosphor-transfer activity is to directly monitor the transfer of a radiolabeled phosphate group from a commercially available &#947;-32-P NTP precursor to a non-radiolabeled substrate11,12,13. Mixtures of radiolabeled substrates and products can be separated and quantified by thin layer chromatography (TLC). TLC utilizes the differential mobility of solutes in a given solvent by allowing the solvent (liquid phase) to migrate by capillary action across a surface (solid phase) upon which a mixture of solutes has been adsorbed14. Solutes that are small and/or lack favorable interactions with the solid phase will migrate longer distances from their initial location than solutes with higher molecular weights or great affinities for the solid. For examination of phosphor-transfer, phosphate moieties increase the molecular weight of molecules they are added to, and add negative ionic charge at neutral or acidic pH11,12,14. This decreases their mobility on a basic surface such as PEI-cellulose. When developed in acidic potassium phosphate buffer, mixtures of mono-, di-, tri-, tetra-, and pentaphosphate species can be readily separated on PEI-cellulose, allowing quantification of each species (Figure 2, Figure 3). Such assays can be performed using cell lysates containing the enzyme of interest, but this includes the potential for the activity of other kinases, phosphatases, and general ATPases to deplete the substrate and/or product. For a quantitative in vitro assessment of enzyme activity, it is necessary to purify the enzyme of interest.
Guanosine tetraphosphate (ppGpp) and guanosine pentaphosphate (pppGpp) are ribonucleotide signaling molecules formed by the transfer of a pyrophosphate group from an adenosine triphosphate (ATP) precursor to, respectively, a guanosine diphosphate (GDP) or guanosine tetraphosphate (GTP) substrate15. These single ribonucleotide signals, collectively known as (p)ppGpp, mediate a cell-wide response to environmental stress known as the stringent response in diverse bacterial species15,16. Two conserved classes of enzymes catalyze the formation of (p)ppGpp15,17 Rel/Spo homolog (RSH) enzymes are &#39;long&#39; bifunctional (p)ppGpp synthetase/hydrolases named for their similarity to the RelA and SpoT (p)ppGpp metabolic enzymes from Escherichia coli which contain synthetase, hydrolase, and regulatory domains, while small alarmone synthetase (SAS) enzymes are short monofunctional synthetases found exclusively in Gram positive bacteria15,17,18. The spore-forming Gram-positive bacterium Clostridium difficile encodes putative RSH and SAS genes19. Here, we present initial activity assays that confirm that the C. difficile RSH enzyme is a catalytically active (p)ppGpp synthetase.

<table>
	<tbody>
		<tr>
			<td>Inducible overexpression of a histidine-tagged protein</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Phusion polymerase</td>
			<td>New England Biolabs (NEB)</td>
			<td>M0530L</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAEX II DNA Gel Extraction Kit</td>
			<td>Qiagen</td>
			<td>20021</td>
			<td></td>
		</tr>
		<tr>
			<td>KpnI restriction enzyme</td>
			<td>NEB</td>
			<td>R0142S</td>
			<td></td>
		</tr>
		<tr>
			<td>PstI restriction enzyme</td>
			<td>NEB</td>
			<td>R0140S</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>NEB</td>
			<td>M0202</td>
			<td></td>
		</tr>
		<tr>
			<td>NEB&#174; 5-alpha Competent&#160;E. coli&#160;(High Efficiency)</td>
			<td>NEB</td>
			<td>C2987I</td>
			<td></td>
		</tr>
		<tr>
			<td>BL21 (DE3) Competent E. coli</td>
			<td>NEB</td>
			<td>C2527I</td>
			<td></td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>Sigma-Aldrich</td>
			<td>10724815001</td>
			<td></td>
		</tr>
		<tr>
			<td>JXN-26 centrifuge with JLA 10.500 rotor</td>
			<td>Beckman Coulter Avanti</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge with D3024/D3024R rotor</td>
			<td>Scilogex</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>MaxQ SHKE6000 Incubator</td>
			<td>Thermo Scientific</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultrasonic processor</td>
			<td>Sonics</td>
			<td>VC-750</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein purification by nickel affinity chromatography</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ni-NTA resin</td>
			<td>G Biosciences</td>
			<td>786-940/941</td>
			<td></td>
		</tr>
		<tr>
			<td>Pierce Disposable Gravity columns, 10 mL</td>
			<td>Thermo Scientific</td>
			<td>29924</td>
			<td></td>
		</tr>
		<tr>
			<td>1 mL Spectra/ Por float-A-lyzer G2 dialysis device (MWCO: 20-kD)</td>
			<td>Spectrum</td>
			<td>G235033</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-Protean Electrophoresis Cell</td>
			<td>BioRad</td>
			<td>1658004</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein activity assay by thin layer chromatography</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Thin layer chromatograph (TLC) development tank</td>
			<td>General Glass Blowing Company</td>
			<td>80-3</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyethylenimine (PEI)-cellulose plates (20 cm x 20 cm, 100 um thickness) with polyester support</td>
			<td>Sigma-Aldrich</td>
			<td>Z122882-25EA</td>
			<td></td>
		</tr>
		<tr>
			<td>ATP, [&#947;-32P]- 3000 Ci/mmol 10mCi/ml lead, 100 &#956;Ci</td>
			<td>Perkin Elmer</td>
			<td>NEG002A</td>
			<td></td>
		</tr>
		<tr>
			<td>Adenosine 5&#8217;-triphosphate (ATP) 100 mM</td>
			<td>Bio Basic Canada</td>
			<td>AB0311</td>
			<td></td>
		</tr>
		<tr>
			<td>Guanosine-5&#8217;-diphosphate disodium salt (GDP)</td>
			<td>Alfa Aesar</td>
			<td>AAJ61646MC/E</td>
			<td></td>
		</tr>
		<tr>
			<td>Storage phosphor screen</td>
			<td>GE Healthcare Life Sciences</td>
			<td>BAS-IP TR 2040 E Tritium Screen</td>
			<td></td>
		</tr>
		<tr>
			<td>Storm 860 phosphorimager</td>
			<td>GE Healthcare Life Sciences</td>
			<td>-</td>
			<td></td>
		</tr>
	</tbody>
</table>

a purification and in vitro activity assay for a (p)ppgpp synthetase from clostridium difficile

Kinase and pyrophosphokinase enzymes transfer the gamma phosphate or the beta-gamma pyrophosphate moiety from nucleotide triphosphate precursors to substrates to create phosphorylated products. The use of &#947;-32-P labeled NTP precursors allows simultaneous monitoring of substrate utilization and product formation by radiography. Thin layer chromatography (TLC) on cellulose plates allows rapid separation and sensitive quantification of substrate and product. We present a method for utilizing the thin-layer chromatography to assay the pyrophosphokinase activity of a purified (p)ppGpp synthetase. This method has previously been used to characterize the activity of cyclic nucleotide and dinucleotide synthetases and is broadly suitable for characterizing the activity of any enzyme that hydrolyzes a nucleotide triphosphate bond or transfers a terminal phosphate from a phosphate donor to another molecule.

We present a method for the affinity purification of a (p)ppGpp synthetase from Clostridium difficile and the assessment of its enzymatic activity. Figure 1 demonstrates the protein purification achieved by metal affinity chromatography. The second elution (E2) fraction from this purification was dialyzed and used for the enzymatic activity assay. Figure 2 details the necessary steps to prepare for and carry out pyrophos...

Watch this Scientific Journal Video about A Purification and In Vitro Activity Assay for a pppGpp Synthetase from Clostridium difficile at JoVE.com

A Purification and In Vitro Activity Assay for a pppGpp Synthetase from Clostridium difficile

Here, we describe a method for purifying histidine-tagged pyrophosphokinase enzymes and utilizing thin layer chromatography of radiolabelled substrates and products to assay for the enzymatic activity in vitro. The enzyme activity assay is broadly applicable to any kinase, nucleotide cyclase, or phosphor-transfer reaction whose mechanism includes nucleotide triphosphate hydrolysis.

A Purification and In Vitro Activity Assay for a (p)ppGpp Synthetase from Clostridium difficile

Kinase and pyrophosphokinase enzymes transfer the gamma phosphate or the beta-gamma pyrophosphate moiety from nucleotide triphosphate precursors to ...

a-purification-vitro-activity-assay-for-p-ppgpp-synthetase-from

Research

JoVE Journal

Immunology and Infection

8.3K Views.  Old Dominion University. Here, we describe a method for purifying histidine-tagged pyrophosphokinase enzymes and utilizing thin layer chromatography of radiolabelled substrates and products to assay for the enzymatic activity in vitro. The enzyme activity assay is broadly applicable to any kinase, nucleotide cyclase, or phosphor-transfer reaction whose mechanism includes nucleotide triphosphate hydrolysis.

Video: A Purification and In Vitro Activity Assay for a pppGpp Synthetase from Clostridium difficile

In vitro Biofilm Formation in an 8-well Chamber Slide

The chronic nature of many diseases is attributed to the formation of bacterial biofilms which are recalcitrant to traditional antibiotic therapy. Biofilms are community-associated bacteria attached to a surface and encased in a matrix. The role of the extracellular matrix is multifaceted, including facilitating nutrient acquisition, and offers significant protection against environmental stresses (e.g. host immune responses). In an effort to acquire a better understanding as to how the bacteria within a biofilm respond to environmental stresses we have used a protocol wherein we visualize bacterial biofilms which have formed in an 8-well chamber slide. The biofilms were stained with the BacLight Live/Dead stain and examined using a confocal microscope to characterize the relative biofilm size, and structure under varying incubation conditions. Z-stack images were collected via confocal microscopy and analyzed by COMSTAT. This protocol can be used to help elucidate the mechanism and kinetics by which biofilms form, as well as identify components that are important to biofilm structure and stability.

In vitro Biofilm Formation in an 8-well Chamber Slide

This article describes the procedure for the formation and visualization of a bacterial biofilm grown within an 8-well chamber slide

The chronic nature of many diseases is attributed to the formation of bacterial biofilms which are recalcitrant to traditional antibiotic therapy. ...

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Measurement of Factor V Activity in Human Plasma Using a Microplate Coagulation Assay

In response to injury, blood coagulation is activated and results in generation of the clotting protease, thrombin. Thrombin cleaves fibrinogen to fibrin which forms an insoluble clot that stops hemorrhage. Factor V (FV) in its activated form, FVa, is a critical cofactor for the protease FXa and accelerator of thrombin generation during fibrin clot formation as part of prothrombinase 1, 2. Manual FV assays have been described 3, 4, but they are time consuming and subjective. Automated FV assays have been reported 5-7, but the analyzer and reagents are expensive and generally provide only the clot time, not the rate and extent of fibrin formation. The microplate platform is preferred for measuring enzyme-catalyzed events because of convenience, time, cost, small volume, continuous monitoring, and high-throughput 8, 9. Microplate assays have been reported for clot lysis 10, platelet aggregation 11, and coagulation Factors 12, but not for FV activity in human plasma. The goal of the method was to develop a microplate assay that measures FV activity during fibrin formation in human plasma.
This novel microplate method outlines a simple, inexpensive, and rapid assay of FV activity in human plasma. The assay utilizes a kinetic microplate reader to monitor the absorbance change at 405nm during fibrin formation in human plasma (Figure 1) 13. The assay accurately measures the time, initial rate, and extent of fibrin clot formation. It requires only &mu;l quantities of plasma, is complete in 6 min, has high-throughput, is sensitive to 24-80pM FV, and measures the amount of unintentionally activated (1-stage activity) and thrombin-activated FV (2-stage activity) to obtain a complete assessment of its total functional activity (2-stage activity - 1-stage activity).
Disseminated intravascular coagulation (DIC) is an acquired coagulopathy that most often develops from pre-existing infections 14. DIC is associated with a poor prognosis and increases mortality above the pre-existing pathology 15. The assay was used to show that in 9 patients with DIC, the FV 1-stage, 2-stage, and total activities were decreased, on average, by 54%, 44%, and 42%, respectively, compared with normal pooled human reference plasma (NHP).
The FV microplate assay is easily adaptable to measure the activity of any coagulation factor. This assay will increase our understanding of FV biochemistry through a more accurate and complete measurement of its activity in research and clinical settings. This information will positively impact healthcare environments through earlier diagnosis and development of more effective treatments for coagulation disorders, such as DIC.

This study describes a novel microplate assay that measures FV coagulation activity during fibrin clot formation in human plasma which has not been reported previously. The method uses a kinetic microplate reader to continuously measure the change in absorbance at 405nm during fibrin clot formation in human plasma.

 In response to injury, blood coagulation is activated and results in generation of the clotting protease, thrombin. Thrombin cleaves fibrinogen to fibrin ...

Saliva, Salivary Gland, and Hemolymph Collection from Ixodes scapularis Ticks

Ticks are found worldwide and afflict humans with many tick-borne illnesses. Ticks are vectors for pathogens that cause Lyme disease and tick-borne relapsing fever (Borrelia spp.), Rocky Mountain Spotted fever (Rickettsia rickettsii), ehrlichiosis (Ehrlichia chaffeensis and E. equi), anaplasmosis (Anaplasma phagocytophilum), encephalitis (tick-borne encephalitis virus), babesiosis (Babesia spp.), Colorado tick fever (Coltivirus), and tularemia (Francisella tularensis) 1-8. To be properly transmitted into the host these infectious agents differentially regulate gene expression, interact with tick proteins, and migrate through the tick 3,9-13. For example, the Lyme disease agent, Borrelia burgdorferi, adapts through differential gene expression to the feast and famine stages of the tick's enzootic cycle 14,15. Furthermore, as an Ixodes tick consumes a bloodmeal Borrelia replicate and migrate from the midgut into the hemocoel, where they travel to the salivary glands and are transmitted into the host with the expelled saliva 9,16-19.
As a tick feeds the host typically responds with a strong hemostatic and innate immune response 11,13,20-22. Despite these host responses, I. scapularis can feed for several days because tick saliva contains proteins that are immunomodulatory, lytic agents, anticoagulants, and fibrinolysins to aid the tick feeding 3,11,20,21,23. The immunomodulatory activities possessed by tick saliva or salivary gland extract (SGE) facilitate transmission, proliferation, and dissemination of numerous tick-borne pathogens 3,20,24-27. To further understand how tick-borne infectious agents cause disease it is essential to dissect actively feeding ticks and collect tick saliva. This video protocol demonstrates dissection techniques for the collection of hemolymph and the removal of salivary glands from actively feeding I. scapularis nymphs after 48 and 72 hours post mouse placement. We also demonstrate saliva collection from an adult female I. scapularis tick.

Saliva, Salivary Gland, and Hemolymph Collection from Ixodes scapularis Ticks

The collection of infected tick hemolymph, salivary glands, and saliva is important to study how tick-borne pathogens cause disease. In this protocol we demonstrate how to collect hemolymph and salivary glands from feeding Ixodes scapularis nymphs. We also demonstrate saliva collection from female I. scapularis adults.

Ticks are found worldwide and afflict humans with many tick-borne illnesses. Ticks are vectors for pathogens that cause Lyme disease and tick-borne ...

Culturing and Maintaining Clostridium difficile in an Anaerobic Environment

Clostridium difficile is a Gram-positive, anaerobic, sporogenic bacterium that is primarily responsible for antibiotic associated diarrhea (AAD) and is a significant nosocomial pathogen. C. difficile is notoriously difficult to isolate and cultivate and is extremely sensitive to even low levels of oxygen in the environment. Here, methods for isolating C. difficile from fecal samples and subsequently culturing C. difficile for preparation of glycerol stocks for long-term storage are presented. Techniques for preparing and enumerating spore stocks in the laboratory for a variety of downstream applications including microscopy and animal studies are also described. These techniques necessitate an anaerobic chamber, which maintains a consistent anaerobic environment to ensure proper conditions for optimal C. difficile growth. We provide protocols for transferring materials in and out of the chamber without causing significant oxygen contamination along with suggestions for regular maintenance required to sustain the appropriate anaerobic environment for efficient and consistent C. difficile cultivation.

Culturing and Maintaining Clostridium difficile in an Anaerobic Environment

Clostridium difficile is a pathogenic bacterium that is a strict anaerobe and causes antibiotic associated diarrhea (AAD). Here, methods for isolating, culturing and maintaining C. difficile vegetative cells and spores are described. These techniques necessitate an anaerobic chamber, which requires regular maintenance to ensure proper conditions for optimal C. difficile cultivation.

Clostridium  difficile is a Gram-positive, anaerobic, sporogenic bacterium  that is primarily responsible for antibiotic associated diarrhea (AAD) and is ...

In vitro Coculture Assay to Assess Pathogen Induced Neutrophil Trans-epithelial Migration

Mucosal surfaces serve as protective barriers against pathogenic organisms.&#160;Innate immune responses are activated upon sensing pathogen leading to the infiltration of tissues with migrating inflammatory cells, primarily neutrophils.&#160;This process has the potential to be destructive to tissues if excessive or held in an unresolved state.&#160; Cocultured in vitro models can be utilized to study the unique molecular mechanisms involved in pathogen induced neutrophil trans-epithelial migration.&#160;This type of model provides versatility in experimental design with opportunity for controlled manipulation of the pathogen, epithelial barrier, or neutrophil.&#160;Pathogenic infection of the apical surface of polarized epithelial monolayers grown on permeable transwell filters instigates physiologically relevant basolateral to apical trans-epithelial migration of neutrophils applied to the basolateral surface.&#160;The in vitro model described herein demonstrates the multiple steps necessary for demonstrating neutrophil migration across a polarized lung epithelial monolayer that has been infected with pathogenic P. aeruginosa (PAO1).&#160;Seeding and culturing of permeable transwells with human derived lung epithelial cells is described, along with isolation of neutrophils from whole human blood and culturing of PAO1 and nonpathogenic K12 E. coli (MC1000).&#160; The emigrational process and quantitative analysis of successfully migrated neutrophils that have been mobilized in response to pathogenic infection is shown with representative data, including positive and negative controls.&#160;This in vitro model system can be manipulated and applied to other mucosal surfaces.&#160;Inflammatory responses that involve excessive neutrophil infiltration can be destructive to host tissues and can occur in the absence of pathogenic infections.&#160;A better understanding of the molecular mechanisms that promote neutrophil trans-epithelial migration through experimental manipulation of the in vitro coculture assay system described herein has significant potential to identify novel therapeutic targets for a range of mucosal infectious as well as inflammatory diseases.

In vitro Coculture Assay to Assess Pathogen Induced Neutrophil Trans-epithelial Migration

Neutrophil trans-epithelial migration in response to mucosal bacterial infection contributes to epithelial injury and clinical disease.&#160;An in vitro model has been developed that combines pathogen, human neutrophils, and polarized human epithelial cell layers grown on transwell filters to facilitate investigations towards unraveling the molecular mechanisms orchestrating this phenomenon.

Mucosal surfaces serve as protective barriers against pathogenic organisms.&#160;Innate immune responses are activated upon sensing pathogen leading to ...

Isolation, Identification, and Purification of Murine Thymic Epithelial Cells

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple stages of T cell development: T cell commitment, positive selection and negative selection. However, the function of TECs in the thymus remains incompletely understood. In the article, we provide a method to isolate TEC subsets from fresh mouse thymus using a combination of mechanical disruption and enzymatic digestion. The method allows thymic stromal cells and thymocytes to be efficiently released from cell-cell and cell-extracellular matrix connections and to form a single-cell suspension. Using the isolated cells, multiparameter flow cytometry can be applied to identification and characterization of TECs and dendritic cells. Because TECs are a rare cell population in the thymus, we also describe an effective way to enrich and purify TECs by depleting thymocytes, the most abundant cell type in the thymus. Following the enrichment, cell sorting time can be decreased so that loss of cell viability can be minimized during purification of TECs. Purified cells are suitable for various downstream analyses like Real Time-PCR, Western blot and gene expression profiling. The protocol will promote research of TEC function and as well as the development of in vitro T cell reconstitution.

Here we describe an efficient method for isolation, identification, and purification of mouse thymic epithelial cells (TECs). The protocol can be utilized for studies of thymus function for normal T cell development, thymus dysfunction, and T cell reconstitution.

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple ...

RNA Purification from Intracellularly Grown Listeria monocytogenes in Macrophage Cells

Analysis of the transcriptome of bacterial pathogens during mammalian infection is a valuable tool for studying genes and factors that mediate infection. However, isolating bacterial RNA from infected cells or tissues is a challenging task, since mammalian RNA mostly dominates the lysates of infected cells. Here we describe an optimized method for RNA isolation of Listeria monocytogenes bacteria growing within bone marrow derived macrophage cells. Upon infection, cells are mildly lysed and rapidly filtered to discard most of the host proteins and RNA, while retaining intact bacteria. Next, bacterial RNA is isolated using hot phenol-SDS extraction followed by DNase treatment. The extracted RNA is suitable for gene transcription analysis by multiple techniques. This method is successfully employed in our studies of Listeria monocytogenes gene regulation during infection of macrophage cells 1-4. The protocol can be easily modified to study other bacterial pathogens and cell types.

RNA Purification from Intracellularly Grown Listeria monocytogenes in Macrophage Cells

Here we describe a method for bacterial RNA isolation from Listeria monocytogenes bacteria growing inside murine macrophages. This technique can be used with other intracellular pathogens and mammalian host cells.

Analysis of the transcriptome of bacterial pathogens during mammalian infection is a valuable tool for studying genes and factors that mediate infection. ...

Flow Cytometric Analysis of Natural Killer Cell Lytic Activity in Human Whole Blood

NK cell cytotoxicity is a widely used measure to determine the effect of outside intervention on NK cell function. However, the accuracy and reproducibility of this assay can be considered unstable, either because of user&#39;s errors or because of the sensitivity of NK cells to experimental manipulation. To eliminate these issues, a workflow that reduces them to a minimum was established and is presented here. To illustrate, we obtained blood samples, at various time points, from runners (n = 4) that were submitted to an intense bout of exercise. First, NK cells are simultaneously identified and isolated through CD56 tagging and magnetic-based sorting, directly from whole blood and from as little as one milliliter. The sorted NK cells are removed of any reagent or capping antibodies. They can be counted in order to establish an accurate NK cell count per milliliter of blood. Secondly, the sorted NK cells (effectors cells or E) can be mixed with 3,3&#39;-Diotadecyloxacarbocyanine Perchlorate (DiO) tagged K562 cells (target cells or T) at an assay-optimal 1:5 T:E ratio, and analyzed using an imaging flow-cytometer that allows for the visualization of each event and the elimination of any false positive or false negatives (such as doublets or effector cells). This workflow can be completed in about 4 h, and allows for very stable results even when working with human samples. When available, research teams can test several experimental interventions in human subjects, and compare measurements across several time points without compromising the data&#39;s integrity.

This work describes an advanced workflow for the accurate and fast determination of NK (Natural Killer) cell count and NK cell cytotoxicity in human blood samples.

NK cell cytotoxicity is a widely used measure to determine the effect of outside intervention on NK cell function. However, the accuracy and ...

Cefoperazone-treated Mouse Model of Clinically-relevant Clostridium difficile Strain R20291

Clostridium difficile is an anaerobic, gram-positive, spore-forming enteric pathogen that is associated with increasing morbidity and mortality and consequently poses an urgent threat to public health. Recurrence of a C. difficile infection (CDI) after successful treatment with antibiotics is high, occurring in 20-30% of patients, thus necessitating the discovery of novel therapeutics against this pathogen. Current animal models of CDI result in high mortality rates and thus do not approximate the chronic, insidious disease manifestations seen in humans with CDI. To evaluate therapeutics against C. difficile, a mouse model approximating human disease utilizing a clinically-relevant strain is needed. This protocol outlines the cefoperazone mouse model of CDI using a clinically-relevant and genetically-tractable strain, R20291. Techniques for clinical disease monitoring, C. difficile bacterial enumeration, toxin cytotoxicity, and histopathological changes throughout CDI in a mouse model are detailed in the protocol. Compared to other mouse models of CDI, this model is not uniformly lethal at the dose administered, allowing for the observation of a prolonged clinical course of infection concordant with the human disease. Therefore, this cefoperazone mouse model of CDI proves a valuable experimental platform to assess the effects of novel therapeutics on the amelioration of clinical disease and on the restoration of colonization resistance against C. difficile.

Cefoperazone-treated Mouse Model of Clinically-relevant Clostridium difficile Strain R20291

This protocol outlines the cefoperazone mouse model of Clostridium difficile infection (CDI) using a clinically-relevant and genetically-tractable strain, R20291. Emphasis on clinical disease monitoring, C. difficile bacterial enumeration, toxin cytotoxicity, and histopathological changes throughout CDI in a mouse model are detailed in the protocol.

Clostridium difficile is an anaerobic, gram-positive, spore-forming enteric pathogen that is associated with increasing morbidity and mortality and ...